Complex locus A1BG and ZNF497: Difference between revisions

Jump to navigation Jump to search
VisualWikitext
mNo edit summary
 
(636 intermediate revisions by the same user not shown)
Line 6: Line 6:
| accessdate = 2012-11-09 }}</ref> The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins.
| accessdate = 2012-11-09 }}</ref> The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins.


A1BG was located on the DNA strand of [[chromosome 19]].<ref name="A1BG alpha-1-B glycoprotein">{{ cite web
A1BG was located on the DNA strand of [[chromosome 19]].<ref name=A1BG>{{ cite web
|title=A1BG alpha-1-B glycoprotein
|title=A1BG alpha-1-B glycoprotein
|url=https://www.ncbi.nlm.nih.gov/gene/1
|url=https://www.ncbi.nlm.nih.gov/gene/1
|accessdate=May 10, 2013 }}</ref> Additionally, A1BG, in current nucleotide numbering (58,345,183-58,353,492), is located adjacent to the ZSCAN22 gene (58,326,994-58,342,332) on the positive DNA strand, as well as the ZNF837 (58,367,623 - 58,381,030, complement) and ZNF497 (58,354,357 - 58,362,751, complement) genes on the negative strand.<ref name="A1BG alpha-1-B glycoprotein"/> In the current nucleotide numbering, the A1BG untranslated region (UTR) has been expanded so that with ZSCAN22 ending at 58,342,332, the nucleotides used in this study are 58,342,347 to 58,346,897 on both strands, with the current UTR for A1BG beginning at 58,345,183.
|accessdate=May 10, 2013 }}</ref> Additionally, A1BG, in current nucleotide numbering (58,345,183-58,353,492), is located adjacent to the ZSCAN22 gene (58,326,994-58,342,332) on the positive DNA strand, as well as the ZNF837 (58,367,623 - 58,381,030, complement) and ZNF497 (58,354,357 - 58,362,751, complement) genes on the negative strand.<ref name=A1BG/>
 
In the current nucleotide numbering, the A1BG untranslated region (UTR) has been expanded so that with ZSCAN22 ending at 58,342,332, the nucleotides used in this study are 58,342,333 to 58,346,892 on both strands, with the current UTR for A1BG beginning at 58,345,183. On the other side of A1BG ending at 58,353,492, the nucleotides used are 58,353,493 to 58,357,937. With ZNF497 beginning at 58,354,357, this study goes into ZNF497 to 58,357,937 or 3580 nucleotides from its downstream TSS or 4445 nucleotides from the TSS of A1BG downstream from ZNF497.
 
For example, an abscisic acid responsive element (ABRE) with the consensus sequence of  ACGTG(G/T)C (Watanabe ''et al''. 2017) occurs in the positive strand in the negative direction from ZSCAN22 to A1BG as ACGTGGC ending at 4239 nucleotides from the end of ZSCAN22 or 58,346,571, where the A is at 58,346,565 inside the UTR of A1BG.


==Introduction==
==Introduction==
Line 54: Line 58:
|publisher=National Institutes of Health
|publisher=National Institutes of Health
|location=8600 Rockville Pike, Bethesda, MD 20894
|location=8600 Rockville Pike, Bethesda, MD 20894
|date=2008/07/08
|date=8 July 2008
|url=https://meshb.nlm.nih.gov/record/ui?name=response%20element
|url=https://meshb.nlm.nih.gov/record/ui?name=response%20element
|accessdate=22 April 2021 }}</ref>
|accessdate=22 April 2021 }}</ref>
Line 74: Line 78:
|accessdate=22 April 2021 }}</ref>
|accessdate=22 April 2021 }}</ref>


===Abscissic acid (ABA) response elements===
===WD-40 repeat family===
 
{{main|WD-40 repeat family}}
In [[A1BG response element positive results]], [[ABA-response element gene transcriptions|abscissic acid (ABA) response elements (ABREs)]] have been identified for example in the UTR for A1BG between ZSCAN22 and A1BG. If these response elements are active then A1BG can be transcribed as a key ''cis''-regulatory element in ABA signaling. "However, for ABA responsive transcription to occur, a single copy of the ABRE is not sufficient. In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996). It was also shown that a pair of ABREs can function as an ABRC with the second ABRE playing the role of the coupling element in rice (Hobo et al. 1999), barley (Shen et al. 1996) and Arabidopsis (Nakashima et al. 2006). Coupling of two CE3s is much less active in conferring ABA response to the minimal promoter (Shen et al. 2004). Interestingly, CE3 appears to be specific to monocots. In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."<ref name=Watanabe>{{ cite journal
"Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During ''Phaseolus vulgaris'' root development, RACK1 (PvRACK1) mRNA expression was induced by auxins, abscisic acid, cytokinin, and gibberellic acid."<ref name=Flores>{{ cite journal
|author=Kenneth A. Watanabe, Arielle Homayouni, Lingkun Gu, Kuan‐Ying Huang, Tuan‐Hua David Ho, Qingxi J. Shen
|title=Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element
|journal=Plant, Cell & Environment
|date=18 June 2017
|volume=40
|issue=9
|pages=2004-2016
|url=https://onlinelibrary.wiley.com/doi/full/10.1111/pce.13006
|arxiv=
|bibcode=
|doi=10.1111/pce.13006
|pmid=
|accessdate=5 October 2020 }}</ref>
 
No coupling elements occur in the negative direction between ZSCAN22 and A1BG. Two ABREs occur in both directions suggesting pairs may be available to function as an ABRC on either side of A1BG, subject to needed proximity.
 
No DRE (TACCGACAT) occurs in either direction of A1BG.
 
"Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During ''Phaseolus vulgaris'' root development, RACK1 (PvRACK1) mRNA expression was induced by auxins, abscissic acid, cytokinin, and gibberellic acid."<ref name=Flores>{{ cite journal
|author=Tania Islas-Flores, Gabriel Guillén, Xóchitl Alvarado-Affantranger, Miguel Lara-Flores, Federico Sánchez, and Marco A. Villanueva
|author=Tania Islas-Flores, Gabriel Guillén, Xóchitl Alvarado-Affantranger, Miguel Lara-Flores, Federico Sánchez, and Marco A. Villanueva
|title=PvRACK1 Loss-of-Function Impairs Cell Expansion and Morphogenesis in ''Phaseolus vulgaris'' L. Root Nodules
|title=PvRACK1 Loss-of-Function Impairs Cell Expansion and Morphogenesis in ''Phaseolus vulgaris'' L. Root Nodules
Line 110: Line 95:
|accessdate=25 April 2021 }}</ref>
|accessdate=25 April 2021 }}</ref>


===Auxin response factors===
====Abscisic acid (ABA) response elements====
{{main|ABA-response element gene transcriptions#ABRE samplings}}


In [[A1BG response element positive results]], [[Auxin response factor gene transcriptions|auxin response factors (ARFs)]] have been identified in the UTR for A1BG between ZSCAN22 and A1BG and between ZNF497 and A1BG but not in this side's core promoter or proximal promoter. If these response elements are active then A1BG can be transcribed as a key ''cis''-regulatory element in auxin signaling. The "genome binding of two ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferred ARF binding site (ARFbs) arrangements (orientation and spacing)."<ref name=Stigliani>{{ cite journal
====Auxin response factors====
|author=Arnaud Stigliani, Raquel Martin-Arevalillo, Jérémy Lucas, Adrien Bessy, Thomas Vinos-Poyo, Victoria Mironova, Teva Vernoux, Renaud Dumas and François Parcy
{{main|Auxin response factor gene transcriptions}}
|title=Capturing Auxin Response Factors Syntax Using DNA Binding Models
 
|journal=Molecular Plant
=====ARFUs=====
|date=3 June 2019
{{main|Auxin response factor gene transcriptions#TGTCTC (Ulmasov) ARFbs samplings}}
 
=====ARFBs=====
{{main|Auxin response factor gene transcriptions#TGTCGG (Boer) ARFbs samplings}}
 
=====ARF2s=====
{{main|Auxin response factor gene transcriptions#ARF (Stigliani) samplings}}
 
=====ARF5s=====
{{main|Auxin response factor gene transcriptions#ARF5 samplings}}
 
====CAACTC regulatory elements====
{{main|CARE gene transcriptions}}
 
=====CAREs (Fan)=====
{{main|CARE gene transcriptions#CARE (Fan) sampling of A1BG promoters}}
 
=====CAREs (Garaeva)=====
{{main|CARE gene transcriptions#CARE (Garaeva) samplings}}
 
====Cytokinins====
{{main|Cytokinin response regulator gene transcriptions}}
 
=====ARR1s=====
{{main|Cytokinin response regulator gene transcriptions#ARR1 Cytokinin samplings}}
 
=====ARR10s=====
{{main|Cytokinin response regulator gene transcriptions#ARR10 Cytokinin samplings}}
 
=====ARR12s=====
{{main|Cytokinin response regulator gene transcriptions#ARR12 Cytokinin samplings}}
 
=====ARRFs=====
{{main|Cytokinin response regulator gene transcriptions#ARR (Ferreira) samplings}}
 
=====ARRR1s=====
{{main|Cytokinin response regulator gene transcriptions#ARR (Rashotte1) samplings}}
 
=====ARRR2s=====
{{main|Cytokinin response regulator gene transcriptions#ARR (Rashotte2) samplings}}
 
====Coupling elements====
{{main|Coupling element gene transcriptions}}
 
=====CE3Ws=====
{{main|Coupling element gene transcriptions#CE3 (Watanabe) samplings}}
 
=====CE3Ds=====
{{main|Coupling element gene transcriptions#CE3 (Ding) samplings}}
 
====EREs====
{{main|Ethylene responsive element gene transcriptions#ERE samplings}}
 
====Gibberellic acid response elements====
{{main|GARE gene transcriptions}}
 
=====GAREs=====
{{main|GARE gene transcriptions#GARE sampling of A1BG promoters}}
 
=====GAREL1s=====
{{main|GARE gene transcriptions#GARE-like 1 samplings}}
 
====Hypoxia response elements====
{{main|Hypoxia response element gene transcriptions}}
 
=====HIFs=====
{{main|Hypoxia response element gene transcriptions#Hypoxia-inducible factor samplings}}
 
=====HREs=====
{{main|Hypoxia response element gene transcriptions#Hypoxia response element samplings}}
 
=====CACAs=====
{{main|Hypoxia response element gene transcriptions#CACA samplings}}
 
====Pyrimidine boxes====
{{main|Pyrimidine box gene transcriptions|Nuclear factor of activated T cell gene transcriptions (NFAT)}}
 
====TAT boxes====
{{main|TAT box gene transcriptions}}
 
=====TATFs=====
{{main|TAT box gene transcriptions#TAT box (Fan) samplings}}
 
=====TATYs=====
{{main|TAT box gene transcriptions#TAT box (Yang) samplings}}
 
===General Regulatory Factors===
{{main|General regulatory factors}}
The following general regulatory factors occur in the promoters between ZSCAN22, A1BG and ZNF497 on human chromosome 19.
 
====Abfms====
{{main|Abf1 regulatory factor gene transcriptions}}
 
====Rap1s====
{{main|Rap1 regulatory factor gene transcriptions}}
 
====Reb1s====
{{main|Reb1 general regulatory factor gene transcriptions}}
 
====Tbf1s====
{{main|Tbf1 regulatory factor gene transcriptions}}
 
===Basic leucine zipper (bZIP) class response elements===
 
====A-boxes====
{{main|A box gene transcriptions}}
 
====ACGTs====
{{main|ACGT-containing element gene transcriptions#ACGT samplings}}
"A majority of the plant bZIP proteins isolated to date recognize elements with an ACGT core (Foster et al., 1994)."<ref name=Nijhawan>{{ cite journal | author = Nijhawan A, Jain M, Tyagi AK, Khurana JP
| title = Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice
| journal = Plant Physiology
| volume = 146
| issue = 2
| pages = 333–50
| date = February 2008
| pmid = 18065552
| doi = 10.1104/pp.107.112821 }}</ref>
 
"Most recombinant bZIP proteins can interact with ACGT elements derived from different plant genes, albeit with different affinity. Systematic protein/DNA binding studies have shown that sequences flanking the ACGT core affect bZIP protein binding specificity. These studies have provided the basis for a concise ACGT nomenclature and defined high-affinity A-box, C-box, and G-box elements."<ref name=Foster>{{ cite journal
|author=Randy Foster, Takeshi Izawa and Nam-Hai Chua
|title=Plant bZIP proteins gather at ACGT elements
|journal=FASEB
|date=1 February 1994
|volume=8
|issue=2
|pages=192-200
|url=https://faseb.onlinelibrary.wiley.com/doi/pdfdirect/10.1096/fasebj.8.2.8119490
|arxiv=
|bibcode=
|doi=10.1096/fasebj.8.2.8119490
|pmid=8119490
|accessdate=25 June 2021 }}</ref>
 
"HY5 binds to the promoter of light-responsive genes featuring [[ACGT-containing element gene transcriptions|"ACGT-containing elements"]] such as the G-box (CACGTG), C-box (GACGTC), Z-box (ATACGGT), and A-box (TACGTA) (4, 6)."<ref name=Nawkar>{{ cite journal
|author=Ganesh M. Nawkar, Chang Ho Kanga, Punyakishore Maibam, Joung Hun Park, Young Jun Jung, Ho Byoung Chae, Yong Hun Chi, In Jung Jung, Woe Yeon Kim, Dae-Jin Yun, and Sang Yeol Lee
|title=HY5, a positive regulator of light signaling, negatively controls the unfolded protein response in ''Arabidopsis''
|journal=Proceedings of the National Academy of Sciences USA
|date=21 February 2017
|volume=114
|issue=8
|pages=2084-89
|url=https://www.pnas.org/content/pnas/114/8/2084.full.pdf
|arxiv=
|bibcode=
|doi=10.1073/pnas.1609844114
|pmid=
|accessdate=24 June 2021 }}</ref>
 
====Activating transcription factors====
{{main|Activating transcription factor gene transcriptions}}
 
=====ATFBs=====
{{main|Activating transcription factor gene transcriptions#Activating transcription factor samplings (Burton)}}
 
=====ATFKs=====
{{main|Activating transcription factor gene transcriptions#Activating transcription factor samplings (Kilberg)}}
 
====Affinity Capture-Western; Two-hybrid transcription factors====
{{main|Aft1p gene transcriptions}}
 
=====AFTs=====
{{main|Aft1p gene transcriptions#AFT1 samplings}}
 
====Box As====
{{main|A box gene transcriptions#Box A samplings}}
 
====C-boxes====
{{main|C box gene transcriptions}}
C-boxes come in several varieties:
 
=====C-boxes (Johnson)=====
{{main|C box gene transcriptions#Johnson C-box samplings}}
 
=====C boxes (Samarsky)=====
{{main|C box gene transcriptions#Samarsky C box samplings}}
 
=====C boxes (Voronina)=====
{{main|C box gene transcriptions#Voronina C box samplings}}
 
=====C boxes (Song)=====
{{main|C box gene transcriptions#Song C-box samplings}}
 
=====C boxes (Song hybrids)=====
{{main|C box gene transcriptions#Hybrid C, G box samplings}}
Hybrids: C/A-box (TGACGTAT), C/G-box (TGACGTGT), C/T-box (TGACGTTA).
 
====CAMPs====
{{main|CRE box gene transcriptions#CRE samplings of the A1BG promoters}}
 
====ESRE====
{{main|Endoplasmic reticulum stress response element gene transcriptions}}
The endoplasmic reticulum stress response element (ESRE) has two parts: (1) CCAAT and (2) CCACG which are tested separately then compared to see if any parts have any nine nucleotides between them.
 
=====CCAAT=====
{{main|Endoplasmic reticulum stress response element gene transcriptions#CCAAT samplings}}
 
=====CCACG=====
{{main|Endoplasmic reticulum stress response element gene transcriptions#CCACG samplings}}
 
According to So (2018) the endoplasmic reticulum stress response element should be CCAAT-N9-CCACG. Samplings demonstrate that the ideal CCAAT-N9-CCACG or its complement inverse do not occur on either side of A1BG or close to ZSCAN22 or ZNF497.
 
====Hap motif====
{{main|CAAT box gene transcriptions#Heme-activated protein (Hap) samplings|Endoplasmic reticulum stress response element gene transcriptions#CCAAT samplings}}
 
====G-boxes====
{{main|G box gene transcriptions}}
 
=====G-box (CACGTG)=====
{{main|Phosphate starvation-response transcription factor gene transcriptions#Pho samplings|Complex locus A1BG and ZNF497#Phors}}
 
====GCN4 motif====
{{main|Gcn4p gene transcriptions}}
 
=====GCREs (Gcn4)=====
{{main|Gcn4p gene transcriptions#GCRE samplings}}
 
====Migs====
{{main|Mig1p gene transcriptions}}
 
====Nuclear factors====
{{main|Nuclear factor gene transcriptions}}
 
=====NFATs=====
{{main|Nuclear factor of activated T cell gene transcriptions (NFAT)#NFAT samplings}}
 
=====HNF6s=====
{{main|HNF gene transcriptions#HNF6 samplings}}
 
====T boxes====
{{main|T box gene transcriptions}}
 
=====TboxCs=====
{{main|T box gene transcriptions#T box (Conlon) samplings}}
 
=====TboxZs=====
{{main|T box gene transcriptions#T box (Zhang) samplings}}
 
====Vboxes====
{{main|V box gene transcriptions#V box samplings}}
 
====Z-boxes====
{{main|Z box gene transcriptions}}
 
=====ZboxGs=====
{{main|Z box gene transcriptions#General Z-box (ZboxG) samplings}}
 
=====ZboxSps=====
{{main|Z box gene transcriptions#Z-box (ZboxSp) samplings}}
 
===Helix-turn-helix (HTH) transcription factors===
{{main|Helix-turn-helix transcription factors}}
Gene ID: 4602 is MYB [myeloblastosis] MYB proto-oncogene, transcription factor on 6q23.3: "This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants."<ref name=RefSeq4602>{{ cite web
|author=RefSeq
|title=MYB MYB proto-oncogene, transcription factor [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=January 2016
|url=https://www.ncbi.nlm.nih.gov/gene/4602
|accessdate=7 February 2021 }}</ref>
 
====CadC binding domains====
{{main|CadC binding domain gene transcriptions#Cadaverine C samplings}}
 
====Factor II B recognition elements====
{{main|Factor II B recognition element gene transcriptions#BREu samplings}}
 
====Forkhead boxes====
{{main|Forkhead box gene transcriptions#Forkhead box samplings}}
 
====Homeoboxes====
{{main|Homeobox gene transcriptions#Homeobox samplings}}
 
====Homeodomains====
{{main|Homeobox gene transcriptions#Homeodomain samplings}}
 
====HSE3 (Eastmond)====
{{main|Hsf1p gene transcriptions#HSE3 (Eastmond) samplings}}
 
====HSE4 (Eastmond)====
{{main|Hsf1p gene transcriptions#HSE4 (Eastmond) samplings}}
 
====HSE8 GAP1 (Eastmond)====
{{main|Hsf1p gene transcriptions#HSE8 GAP1 (Eastmond) samplings}}
 
====HSE9 GAP2 (Eastmond)====
{{main|Hsf1p gene transcriptions#HSE9 GAP2 (Eastmond) samplings}}
 
====Hsf (Tang)====
{{main|Hsf1p gene transcriptions#Hsf (Tang) samplings}}
 
====MREs====
{{main|MYB recognition element gene transcriptions#MRE samplings}}
 
====Tryptophan residues====
{{main|Interferon regulatory factor gene transcriptions#Tryptophan residue samplings}}
 
===Basic helix-loop-helix (bHLH) transcription factors===
{{main|Basic helix–loop–helix}}
"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."<ref name=Rossi>{{ cite journal
|author=Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh
|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
|journal=Genome Research
|date=21 March 2018
|volume=28
|issue=
|pages=497-508
|url=https://genome.cshlp.org/content/28/4/497.full
|arxiv=
|bibcode=
|doi=10.1101/gr.229518.117
|pmid=29563167
|accessdate=31 August 2020 }}</ref>
 
"Pho4 bound to virtually all E-boxes ''in vitro'' (96%) [...]. That was not the case ''in vivo'', where only 5% were bound by Pho4, under activating conditions as determined by ChIP-seq [Zhou and O'Shea 2011]."<ref name=Rossi/>
 
"Pho4 possesses the intrinsic ability to bind every E-box, but ''in vivo'' is prevented from binding by chromatin unless assisted by chromatin remodelers (Svaren ''et al.'' 1994) that are targeted at promoter regions."<ref name=Rossi/>
 
"On one end of that spectrum, typical transcription factors like Pho4 do not appear to compete with nucleosomes and instead predominantly sample motifs that already exist in the [nucleosome-free promoter regions] NFRs generated by other factors. In vitro (PB-exo), Pho4 bound nearly every instance of an E-box motif across the yeast genome. However, in vivo, Pho4 is a low-abundance protein that is recruited to the nucleus upon phosphate starvation by other factors, to act at a few dozen genes (Komeili and O'Shea 1999; Zhou and O'Shea 2011). Since Pho4 appears unable to compete with nucleosomes, competent sites that are occluded by nucleosomes are invisible to Pho4."<ref name=Rossi/>
 
The Pho4 homodimer binds to DNA sequences containing the bHLH binding site CACGTG.<ref name=Shao>{{ cite journal
|author=Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman
|title = A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p
|journal = Nucleic Acids Research
|volume = 26
|issue = 3
|pages = 710–4
|date= 1 February 1998
|pmid = 9443961
|pmc = 147311
|doi = 10.1093/nar/26.3.710
|url = https://academic.oup.com/nar/article/26/3/710/1052045 }}</ref>
 
The upstream activating sequence (UAS) for Pho4p is CAC(A/G)T(T/G) in the promoters of ''HIS4'' and ''PHO5'' regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].<ref name=Tang>{{ cite journal
|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
|journal=Metabolites
|date=6 August 2020
|volume=10
|issue=8
|pages=320-39
|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
|arxiv=
|bibcode=
|doi=10.3390/metabo10080320
|pmid=32781665
|accessdate=18 September 2020 }}</ref>
 
bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG.<ref name="pmid10319327">{{cite journal |author=Chaudhary J, Skinner MK |title=Basic helix-loop-helix proteins can act at the E-box within the serum response element of the c-fos promoter to influence hormone-induced promoter activation in Sertoli cells |journal=Mol. Endocrinol. |volume=13 |issue=5 |pages=774–86 |date=1999 |pmid=10319327 |doi=10.1210/mend.13.5.0271 }}</ref>
 
"A computer search for transcription promoter elements [...] showed the presence of a prominent TATA box 22 nucleotides upstream of the transcription start site and an [[Sp1]] site at position -42 to -33. The 5'-flanking sequence also contains three E boxes with CANNTG consensus sequences at positions -464 to -459, -90 to -85, and -52 to -47 that have been marked as [[E box]], [[E1 box]], and [[E2 box]], respectively [...]. In addition, the 5'-flanking region contains one or more [[GRE]], [[Aryl hydrocarbon receptor#DNA binding (xenobiotic response element – XRE)|XRE]], [[GATA1|GATA-1]], [[ATF4|GCN-4]], [[ETV4|PEA-3]], [[AP-1 (transcription factor)|AP1]], and [[Activating protein 2|AP2]] consensus motifs and also three imperfect CArG sites [...]."<ref name=Lenka>{{ cite journal
|author=Nibedita Lenka, Aruna Basu, Jayati Mullick, and Narayan G. Avadhani
|title=The role of an E box binding basic helix loop helix protein in the cardiac muscle-specific expression of the rat cytochrome oxidase subunit VIII gene
|journal=The Journal of Biological Chemistry
|date=22 November 1996
|volume=271
|issue=47
|pages=30281–30289
|url=http://www.jbc.org/content/271/47/30281.full.pdf
|arxiv=
|bibcode=
|doi=10.1074/jbc.271.47.30281
|pmid=
|accessdate=7 February 2019 }}</ref>
 
====AhRYs====
{{main|Xenobiotic response element gene transcriptions#TCDD*AhR DNA-binding consensus sequence sampling}}
 
====AHRE-IIs====
{{main|Xenobiotic responsive element gene transcriptions#AHRE-II samplings}}
 
====AEREs====
{{main|Antioxidant-electrophile responsive element gene transcriptions#AERE (Lacher) samplings}}
 
====CAT boxes====
{{main|CAT box gene transcriptions#CAT box samplings}}
 
====CAT-box-like elements====
{{main|CAT box gene transcriptions#CAT-box-like element samplings}}
 
===="Class C"====
{{main|N box gene transcriptions#"Class C" (Leal) samplings}}
 
===="Class I"====
 
=====TCFs=====
{{main|Transcription factor 3 gene transcriptions#TCF3 samplings}}
 
====DIOXs====
{{main|Xenobiotic response element gene transcriptions#DIOX samplings}}
 
====Enhancer boxes====
{{main|Enhancer box gene transcriptions#Enhancer box samplings}}
 
=====ChoRE motifs=====
{{main|Carbohydrate response element gene transcriptions}}
 
=====CarbE1s=====
{{main|Carbohydrate response element gene transcriptions#ATCTTG (CarbE1) samplings}}
 
=====CarbE2s=====
{{main|Carbohydrate response element gene transcriptions#CACGTG (CarbE2) samplings}}
 
=====CarbE3s=====
{{main|Carbohydrate response element gene transcriptions#TCCGCC (CarbE3) samplings}}
 
=====Phors=====
{{main|Phosphate starvation-response transcription factor gene transcriptions#Pho samplings}}
Palindromic E-box motif (CACGTG).
 
=====E2 boxes=====
{{main|E2 box gene transcriptions#E2 box samplings}}
 
====GATAs====
{{main|GATA gene transcriptions#GATA samplings}}
 
====Gln3s====
{{main|GATA gene transcriptions#Staschke Gln3 samplings}}
 
====Glucocorticoid response elements====
{{main|Glucocorticoid response element gene transcriptions#Glu samplings}}
 
====ICRE (Lopes)====
{{main|Inositol, choline-responsive element gene transcriptions}}
 
====ICRE (Schwank)====
{{main|Inositol, choline-responsive element gene transcriptions}}
 
====Pho4====
{{main|Phosphate starvation-response transcription factor gene transcriptions#Phop samplings}}
 
====QRDREs====
{{main|Xenobiotic response element gene transcriptions#QRDRE samplings}}
 
====Carbon source-responsive elements====
{{main|Carbon source-responsive element gene transcriptions}}
 
=====CATTCAs=====
{{main|Carbon source-responsive element gene transcriptions#CATTCA samplings}}
 
=====TCCGs=====
{{main|Carbon source-responsive element gene transcriptions#TCCG samplings}}
 
====XREs====
{{main|Xenobiotic response element gene transcriptions#Xenobiotic response element samplings}}
 
===Basic helix-loop-helix leucine zipper transcription factors===
 
Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both [[Basic helix-loop-helix]] and [[leucine zipper]] motifs.
 
Examples include [[Microphthalmia-associated transcription factor]] and [[Sterol regulatory element-binding protein]] (SREBP).
 
MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes.<ref name=Hoek>{{cite journal | author = Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C, Einarsson SO, Valgeirsdottir S, Bergsteinsdottir K, Schepsky A, Dummer R, Steingrimsson E | title = Novel MITF targets identified using a two-step DNA microarray strategy | journal = Pigment Cell Melanoma Res. | volume = 21 | issue = 6 | pages = 665–76 | date = 2008 | pmid = 19067971 | doi = 10.1111/j.1755-148X.2008.00505.x }}</ref>
 
[[Serum response element gene transcriptions]]: The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra>{{ cite journal
|author=Ravi P. Misra
|author2=Azad Bonni
|author3=Cindy K. Miranti
|author4=Victor M. Rivera
|author5=Morgan Sheng
|author6=Michael E.Greenberg
|title=L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway
|journal=The Journal of Biological Chemistry
|date=14 October 1994
|volume=269
|issue=41
|pages=25483-25493
|url=http://www.jbc.org/content/269/41/25483.full.pdf
|arxiv=
|bibcode=
|doi=
|pmid=7929249
|accessdate=7 December 2019 }}</ref>
 
"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)<sub>6</sub>GG (CArG) motif."<ref name=Zhang2017>{{ cite journal
|author=Xiaomin Zhang, Gohar Azhar, Jeanne Y. Wei
|title=SIRT2 gene has a classic SRE element, is a downstream target of serum response factor and is likely activated during serum stimulation
|journal=PLOS One
|date=21 December 2017
|volume=12
|volume=12
|issue=12
|pages=e0190011
|url=https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0190011
|arxiv=
|bibcode=
|doi=10.1371/journal.pone.0190011
|pmid=
|accessdate=23 February 2021 }}</ref>
====CArG boxes====
{{main|CArG box gene transcriptions#CArG box samplings}}
====MITF E-boxes====
{{main|Enhancer box gene transcriptions#MITF E-box (CAYRTG) samplings}}
=====RREs=====
{{main|MYB recognition element gene transcriptions#RRE samplings}}
Consensus sequence: CATCTG.
====M-boxes====
{{main|M box gene transcriptions}}
=====M box (Bertolotto)=====
{{main|M box gene transcriptions#M box (Bertolotto) samplings}}
=====M-box (Hoek)=====
{{main|M box gene transcriptions#M-box (Hoek) samplings}}
=====M-box (Ripoll)=====
{{main|M box gene transcriptions#M-box (Ripoll) samplings}}
====SER elements====
{{main|Serum response element gene transcriptions#SER samplings}}
===Basic helix-span-helix===
====Activating proteins====
{{main|Activating protein gene transcriptions}}
=====AP2as=====
{{main|Activating protein gene transcriptions#AP-2 alpha consensus sequences}}
=====APCo1s=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Cohen)}}
=====APCo2s=====
{{main|Activating protein gene transcriptions#Activating protein (Cohen2) samplings}}
=====APM3Ns=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Murata, 3N)}}
=====APM4Ns=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Murata, 4N)}}
=====Yao1s=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Yao1)}}
=====Yao2s=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Yao2)}}
=====Yau3s=====
{{main|Activating protein gene transcriptions#Activating protein samplings (Yao3)}}
"[[Pemphigus foliaceus]] (PF) is an autoimmune disease, endemic in Brazilian rural areas, characterized by acantholysis and accompanied by complement activation, with generalized or localized distribution of painful epidermal blisters. [[CD59]] is an essential complement regulator, inhibiting formation of the membrane attack complex, and mediating signal transduction and activation of T lymphocytes. ''CD59'' has different transcripts by alternative splicing, of which only two are widely expressed, suggesting the presence of regulatory sites in their noncoding regions. To date, there is no association study with polymorphisms in ''CD59'' noncoding regions and susceptibility to autoimmune diseases. In this study, we aimed to evaluate if ''CD59'' polymorphisms have a possible regulatory effect on gene expression and susceptibility to PF. Six noncoding polymorphisms were haplotyped in 157 patients and 215 controls by sequence-specific [[polymerase chain reaction|PCR]], and CD59 mRNA levels were measured in 82 subjects, by qPCR. The ''rs861256-allele-G'' (''rs861256*G'') was associated with increased mRNA expression (''p'' = .0113) and PF susceptibility in women (OR = 4.11, ''p'' = .0001), which were also more prone to develop generalized lesions (OR = 4.3, ''p'' = .009) and to resist disease remission (OR = 3.69, ''p'' = .045). Associations were also observed for ''rs831625*G'' (OR = 3.1, ''p'' = .007) and ''rs704697*A'' (OR = 3.4, ''p'' = .006) in Euro-Brazilian women, and for ''rs704701*C'' (OR = 2.33, ''p'' = .037) in Afro-Brazilians. These alleles constitute the ''GGCCAA'' haplotype, which also increases PF susceptibility (OR = 4.9, ''p'' = .045) and marks higher mRNA expression (''p'' = .0025). [...] higher ''CD59'' transcriptional levels may be related with PF susceptibility (especially in women), probably due to the effect of genetic polymorphism and to the CD59 role in T cell signal transduction."<ref name=Silva>{{ cite journal
|author=Amanda Salviano-Silva, Maria Luiza Petzl-Erler & Angelica Beate Winter Boldt
|title=''CD59'' polymorphisms are associated with gene expression and different sexual susceptibility to pemphigus foliaceus
|journal=Autoimmunity
|date=29 April 2017
|volume=50
|issue=6
|issue=6
|pages=822-832
|pages=377-385
|url=https://www.sciencedirect.com/science/article/pii/S167420521830306X
|url=https://www.tandfonline.com/doi/abs/10.1080/08916934.2017.1329830
|arxiv=
|bibcode=
|doi=10.1080/08916934.2017.1329830
|pmid=
|accessdate=27 September 2021 }}</ref>
 
===Stem-loops===
[[Image:Stem-loop.svg|thumb|right|300px|An example of an RNA stem-loop is shown. Credit: [[c:user:Sakurambo|Sakurambo]].{{tlx|free media}}]]
As an important secondary structure of RNA, a stem-loop can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.<ref>Svoboda, P., & Cara, A. (2006). Hairpin RNA: A secondary structure of primary importance. Cellular and Molecular Life Sciences, 63(7), 901-908.</ref>
 
Hairpin loops are often elements found within the 5'UTR of prokaryotes. These structures are often bound by proteins or cause the attenuation of a transcript in order to regulate translation.<ref name=Meyer>{{cite journal|last=Meyer|first=Michelle|author2=Deiorio-Haggar K |author3=Anthony J |title=RNA structures regulating ribosomal protein biosynthesis in bacilli|journal=RNA Biology|date=July 2013|volume=10|series=7|pages=1160–1164|doi=10.4161/rna.24151|pmid=23611891 }}</ref>
 
The mRNA stem-loop structure forming at the ribosome binding site may control an initiation of translation.<ref name=Malys2009>{{cite journal | author = Malys N, Nivinskas R | title = Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction |journal = Mol Microbiol |volume = 73 | issue = 6 | pages = 1115–1127 | date = 2009 | pmid = 19708923 | doi =10.1111/j.1365-2958.2009.06840.x }}</ref><ref name=Malys2010>{{ cite journal | author = Malys N, McCarthy JEG | title = Translation initiation: variations in the mechanism can be anticipated |journal = Cellular and Molecular Life Sciences | date = 2010 | doi =10.1007/s00018-010-0588-z | pmid=21076851 | volume = 68 | issue = 6 | pages = 991–1003 }}</ref>
{{clear}}
 
====AUREs====
{{main|Adenylate–uridylate rich element gene transcriptions#Adenylate–uridylate rich element (Bakheet) samplings}}
 
====Adenylate–uridylate rich elements (Chen and Shyu, Class I)====
{{main|Adenylate–uridylate rich element gene transcriptions#ATTTA (Chen and Shyu, Class I) samplings}}
 
====Adenylate–uridylate rich elements (Chen and Shyu, Class II)====
{{main|Adenylate–uridylate rich element gene transcriptions#UUAUUUA(U/A)(U/A) (Chen and Shyu, Class II) samplings}}
 
====Adenylate–uridylate rich elements (Chen and Shyu, Class III)====
{{main|Adenylate–uridylate rich element gene transcriptions#ATTT (Chen and Shyu, Class III)}}
 
====MERs====
{{main|Adenylate–uridylate rich element gene transcriptions#Overlapping (Siegel) mers}}
 
====Constitutive decay elements====
{{main|Adenylate–uridylate rich element gene transcriptions#Constitutive decay element (Siegel) samplings}}
 
==={{chem|Cys|2|His|2}} SP / Kruppel-like factor (KLF) transcription factor family===
 
The {{chem|Cys|2|His|2}}-like fold group ({{chem|Cys|2|His|2}}) is by far the best-characterized class of zinc fingers, and is common in mammalian transcription factors, where such domains adopt a simple ββα fold and have the amino acid sequence motif:<ref name=Pabo2001>{{cite journal | author = Pabo CO, Peisach E, Grant RA | title = Design and selection of novel Cys2His2 zinc finger proteins | journal = Annual Review of Biochemistry | volume = 70 | pages = 313–40 | date = 2001 | pmid = 11395410 | doi = 10.1146/annurev.biochem.70.1.313 }}</ref>
 
:X<sub>2</sub>-Cys-X<sub>2,4</sub>-Cys-X<sub>12</sub>-His-X<sub>3,4,5</sub>-His
 
====Alcohol dehydrogenase repressor 1====
{{main|Adr1p gene transcriptions#ADR samplings}}
 
====SP1M1s====
{{main|Specificity protein gene transcriptions#Sp1-box 1 (Motojima) Samplings}}
 
====SP1M2s====
{{main|Specificity protein gene transcriptions#Sp1-box 2 (Motojima) Samplings}}
 
====SP-1 (Sato)s====
{{main|Specificity protein gene transcriptions#Sp-1 (Sato) samplings}}
 
====SP1 (Yao)s====
{{main|Specificity protein gene transcriptions#Sp1 (Yao) samplings}}
 
====YY1Ts====
{{main|YY1 gene transcriptions#YY1 CCATCTT samplings}}
 
===AP-2/EREBP-related factors===
 
====AGC boxes====
{{main|AGC box gene transcriptions#AGC box samplings}}
 
===AP-1 transcription factor network (Pathway)===
 
Sixty-nine genes are included in the AP-1 transcription factor network (Pathway).<ref name=AP-1TFN>{{ cite web
|author=NCBI
|title=AP-1 transcription factor network
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=9 March 2021
|url=https://pubchem.ncbi.nlm.nih.gov/pathway/Pathway%20Interaction%20Database:ap1_pathway
|accessdate=26 October 2021 }}</ref>
 
====AGCEs====
{{main|AGCE gene transcriptions#AGCE samplings}}
 
===Zinc finger DNA-binding domains===
 
====AnRE1s====
{{main|Androgen response element gene transcriptions#Androgen response element1 (Kouhpayeh) samplings}}
 
====AnDRE2s====
{{main|Androgen response element gene transcriptions#Androgen response element2 (Kouhpayeh) samplings}}
 
====AnREWs====
{{main|Androgen response element gene transcriptions#Androgen response element (Wilson) samplings}}
 
====B-boxes====
{{main|B box gene transcriptions#B box (Johnson) samplings}}
 
====Box Bs====
{{main|B box gene transcriptions#B1 box (Sanchez) samplings}}
 
===β-Scaffold factors===
 
"Higher animals have [transcription factor] TF genes for the basic domain, the β-scaffold factor, and other new
structures; however, their total proportion is less than 15% and most are [zinc (Zn)-coordinating factor] ZF and [Helix-Turn-Helix] HTH genes."<ref name=Nagata>{{ cite book
|author=Toshifumi Nagata, Aeni Hosaka-Sasaki and Shoshi Kikuchi
|title=The Evolutionary Diversification of Genes that Encode Transcription Factor Proteins in Plants, In: ''Plant Transcription Factors Evolutionary, Structural and Functional Aspects''
|publisher=Academic Press
|location=
|date=2016
|editor=Daniel H. Gonzalez
|pages=73-97
|url=https://www.sciencedirect.com/science/article/pii/B9780128008546000051
|arxiv=
|bibcode=
|doi=10.1016/B978-0-12-800854-6.00005-1
|pmid=
|isbn=978-0-12-800854-6
|accessdate=28 November 2021 }}</ref>
 
====ATA boxes====
{{main|ATA box gene transcriptions#ATA box samplings}}
 
====Γ-interferon activated sequences====
{{main|Γ-interferon activated sequence gene transcriptions#Γ-interferon activated sequence samplings}}
 
====HMG boxes====
{{main|HMG box gene transcriptions#HMG box samplings}}
 
===Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins===
 
"The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins), and they recognize highly related sequences rich in GGC triplets [15]."<ref name=Ruiz>{{ cite journal
|author=Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti, Susana Correa-Garcia
|title=Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor LEU3
|journal=Microbiology
|date=1 November 2017
|volume=
|issue=
|pages=
|url=https://www.researchgate.net/profile/Mariana_Bermudez3/publication/320571623_Unravelling_the_transcriptional_regulation_of_Saccharomyces_cerevisiae_UGA_genes_the_dual_role_of_transcription_factor_Leu3/links/5c62114c299bf1d14cbf7ade/Unravelling-the-transcriptional-regulation-of-Saccharomyces-cerevisiae-UGA-genes-the-dual-role-of-transcription-factor-Leu3.pdf
|arxiv=
|bibcode=
|doi=10.1099/mic.0.000560
|pmid=
|accessdate=21 February 2021 }}</ref>
 
====Dal81====
 
====GCC boxes====
{{main|AGC box gene transcriptions#GCC box samplings}}
 
====GGC triplets====
{{main|GGC triplet gene transcriptions#GGC samplings}}
 
=====GGCGGC triplets=====
{{main|GGC triplet gene transcriptions#GGCGGC triplet samplings}}
 
====Leu3====
{{main|Leu3 gene transcriptions#Leu samplings|GGC triplet gene transcriptions#Leu3 samplings}}
 
====Uga3====
{{main|Leu3 gene transcriptions}}
 
===Hairpin-hinge-hairpin-tail===
 
"In addition to this ACA box, they have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity. Despite this lack of primary sequence conservation, the H and ACA boxes are embedded in an evolutionarily conserved hairpin-hinge-hairpin-tail core secondary structure with the H box in the single-stranded hinge region and the ACA box in the single-stranded tail (5, 16)."<ref name=Mitchell>{{ cite journal
|author=James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins
|title=A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End
|journal=Molecular and Cellular Biology
|date=January 1999
|volume=19
|issue=1
|pages=567–576
|url=http://mcb.asm.org/content/19/1/567.full.pdf
|arxiv=
|arxiv=
|bibcode=
|bibcode=
|doi=10.1016/j.molp.2018.09.010
|doi=
|pmid=30336329
|pmid=
|accessdate=29 August 2020 }}</ref>
|accessdate=5 November 2018 }}</ref>
 
====H and ACA boxes====
{{main|H and ACA box gene transcriptions#H and ACA boxes in promoters of A1BG}}
 
====H-boxes (Grandbastien)====
{{main|H box gene transcriptions#H-box (Grandbastien) samplings}}
 
====H-boxes (Lindsay)====
{{main|H box gene transcriptions#H-box (Lindsay) samplings}}
 
====H boxes (Mitchell)====
{{main|H box gene transcriptions#H boxes (Mitchell) samplings}}
 
====H boxes (Rozhdestvensky)====
{{main|H box gene transcriptions#H boxes (Rozhdestvensky) in promoters of A1BG}}
 
===Unknown response element types===
 
====ACEs====
{{main|MYB recognition element gene transcriptions#ACE samplings}}
 
====BBCABW Inrs====
{{main|Initiator element gene transcriptions#BBCABW samplings}}
 
====Calcineurin-responsive transcription factors====
{{main|Calcineurin-responsive transcription factor gene transcriptions#CRT samplings}}
 
====Carbs====
{{main|Carbohydrate response element gene transcriptions#ACCGG (Carb) samplings}}
 
====Carb1s====
{{main|Carbohydrate response element gene transcriptions#CCCAT (Carb1) samplings}}
 
====Cat8s====
{{main|Cat8p gene transcriptions#Cat8p samplings}}
 
====Cell-cycle box variants====
{{Main|Cell-cycle box gene transcriptions#CCB variant samplings}}
 
====CGCG boxes====
{{main|CGCG box gene transcriptions#CGCG box samplings}}
 
====Circadian control elements====
{{main|Circadian control element gene transcriptions#CCE samplings}}
 
====Cold-responsive elements====
{{main|Cold-responsive element gene transcriptions#Cold-responsive element samplings}}
 
====Copper response elements====
{{main|Copper response element gene transcriptions}}
 
=====CuREQs=====
{{main|Copper response element gene transcriptions#CuRE (Quinn) samplings}}
 
=====CuREPs=====
{{main|Copper response element gene transcriptions#CuRE (Park) samplings}}
 
====Cytoplasmic polyadenylation elements====
{{main|Cytoplasmic polyadenylation element gene transcriptions#CPE samplings}}
 
====DAF-16 binding elements====
{{main|DAF-16 binding element gene transcriptions#DBE samplings}}
 
====D box (Samarsky)====
{{main|D box gene transcriptions#Dbox (Samarsky) samplings}}
 
====D box (Voronina)====
{{main|D box gene transcriptions#D box (Voronina) samplings}}
 
====D-box (Motojima)====
{{main|D box gene transcriptions#(Motojima) samplings}}
 
====dBRE====
{{main|Downstream TFIIB recognition element gene transcriptions#dBRE samplings}}
 
====Downstream core elements====
{{main|Downstream core element gene transcriptions}}
 
====DCE SI====
{{main|Downstream core element gene transcriptions#Downstream core element SI samplings}}
 
====DCE SII====
{{main|Downstream core element gene transcriptions#Downstream core element SII samplings}}
 
====DCE SIII====
{{main|Downstream core element gene transcriptions#Downstream core element SIII samplings}}
 
====DPE (Juven-Gershon)====
{{main|Downstream promoter element gene transcriptions#DPE (Juven-Gershon) samplings}}
 
====DPE (Kadonaga)====
{{main|Downstream promoter element gene transcriptions#DPE (Kadonaga) samplings}}
 
====DPE (Matsumoto)====
{{main|Downstream promoter element gene transcriptions#DPE (Matsumoto) samplings}}
 
====EIN3 binding sites====
{{main|EIN3 binding site gene transcriptions#EIN3 samplings}}
 
====Endosperm expressions====
{{main|Endosperm expression gene transcriptions#Endosperm expression samplings}}
 
====Estrogen response elements====
{{main|Estrogen response element gene transcriptions}}
 
=====ERE1s=====
{{main|Estrogen response element gene transcriptions#ERE1 (Driscoll) samplings}}
 
=====ERE2s=====
{{main|Estrogen response element gene transcriptions#EREs (Driscoll) samplings}}
 
====GAAC elements====
{{main|GAAC element gene transcriptions#GAAC element samplings}}
 
====GC boxes (Briggs)====
{{main|GC box gene transcriptions#GC box (Briggs) samplings}}
 
====GC boxes (Ye)====
{{main|GC box gene transcriptions#GC box (Ye) samplings}}
 
====GC boxes (Zhang)====
{{main|GC box gene transcriptions#GC box (Zhang) samplings}}
 
====GCR1s====
{{main|Gcr1p gene transcriptions#GCR1 samplings}}
 
====GREs====
{{main|Gibberellin responsive element gene transcriptions#GRE samplings}}
 
====GT boxes (Sato)====
{{main|TC element gene transcriptions#GT box (Sato) samplings}}
 
====Hex sequences====
{{main|Hex sequence gene transcriptions#Hex core samplings}}
 
====HY boxes====
{{main|HY box gene transcriptions#HY box samplings}}
 
====IFNs====
{{main|Interferon regulatory factor gene transcriptions#IFN-stimulated response element samplings}}
 
====Inr-like, TCTs====
{{main|Initiator element gene transcriptions#Inr-like, TCTs sampling}}
 
====IRF3s====
{{main|Interferon regulatory factor gene transcriptions#IRF-3 samplings}}
 
====IRSs====
{{main|Interferon regulatory factor gene transcriptions#IRS consensus samplings}}
 
====KAR2s====
{{main|Hac1p gene transcriptions#KAR2 samplings}}
 
====MBE1s====
{{main|Musashi binding element gene transcriptions#MBE1 samplings}}
 
====MBE2s====
{{main|Musashi binding element gene transcriptions#MBE2 samplings}}
 
====MBE3s====
{{main|Musashi binding element gene transcriptions#MBE3 samplings}}
 
====NF𝜿BSs====
{{main|Nuclear factor gene transcriptions#NF𝜿B (Sato) samplings}}
 
====PREs====
{{main|Polycomb response element gene transcriptions#Core samplings}}
 
====Pribs====
{{main|Pribnow box gene transcriptions#Pribnow box samplings}}
 
====RAREs====
{{main|Retinoic acid response element gene transcriptions#RARE samplings}}
 
====Rgts====
{{main|Rgt1p gene transcriptions#RGT samplings}}
 
====ROREs====
{{main|ROR-response element gene transcriptions#RORE samplings}}
 
====SERVs====
{{main|Servenius sequence gene transcriptions#Servenius samplings}}
 
====STAT5s====
{{main|STAT5 gene transcription laboratory#STAT5 samplings}}
 
====STREs====
{{main|Msn2,4p gene transcriptions#Stress-response element samplings}}
 
====Sucroses====
{{main|Sucrose box gene transcriptions#Sucrose box samplings}}
 
====TACTs====
{{main|TACTAAC box gene transcriptions#TACT samplings}}
 
====TAGteams====
{{main|TAGteam gene transcriptions#TAGteam samplings}}
 
====TAPs====
{{main|Tapetum box gene transcriptions#Tapetum box samplings}}
 
====TATAs====
{{main|TATA box gene transcriptions#TATA box samplings}}
Examining the promoter regions upstream from ZSCAN22 to A1BG and downstream from ZNF497 to A1BG for TATA boxes has shown that TATA boxes in various forms are present and likely active or activable: (1) TATAAAA (Carninci 2006), (2) TATA(A/T)A(A/T) (Watson 2014), (3) TATA(A/T)AA(A/G) (Juven-Gershon 2010), and (4) TATA(A/T)A(A/T)(A/G) (Basehoar 2004).
 
The TATA boxes have the pattern of appearing in only the negative direction UTRs, proximal and distals. The shorter TATA box: TATAAA does appear as above but also in the positive direction as the complement inverse TTTATA at 2588 in the distal promoter.
 
====TATABs====
{{main|TATA box gene transcriptions#TATA box (Butler 2002) samplings}}
 
====TATACs====
{{main|TATA box gene transcriptions#TATA boxes (Carninci 2006) samplings}}


===Cytokinins===
====TATAJs====
{{main|TATA box gene transcriptions#TATA box (Juven-Gershon 2010) samplings}}


In [[A1BG response element positive results]], several of the [[Cytokinin response regulator gene transcriptions|cytokinin response regulators]]: ARR10s, ARR12s, and those of Rashotte ''et al.'' (2003) have occurrences in the UTR of A1BG from the ZSCAN22 side and in the proximal promoters of A1BG from the ZNF497 side.
====TATAWs====
{{main|TATA box gene transcriptions#TATA box (Watson 2014) samplings}}


Any of the randomly generated nucleotide data sets (0 through 9) can be used to represent any of the real data for the response element of interest.
====TEAs====
{{main|TEA consensus sequence gene transcriptions#TEA samplings}}


Every response element ARR1 has 6 in the distal promoter (2 negative direction and 4 positive direction). Random samplings ranges from 0-3. For the proximal promoter there is one for two datasets out of 20. No random in the core promoter. And, four for two datasets in the UTR out of 20.
====TECs====
{{main|Tec1p gene transcriptions#Tec1 samplings}}


ARR10 has only one element in the negative direction in the UTR. Four of the 10 random datasets had 1.25 response elements in the UTR. No sequences in the core promoters, but one sequence in the proximal promoter and many in the distal promoters. The only response element in the A1BG promoters is an inverse complement and five of the six random UTR response elements are inverse complements.
====THRs====
{{main|Thyroid hormone response element gene transcriptions#THR samplings}}


For ARR12, the random samples have about 2.5 UTR elements, but ARR12 has only one in the UTR. The A1BG has no core promoters on either side but one random sample out of ten has one on the positive direction from ZNF497. The ARR12 in A1BG proximal promoters have none while two out of ten random datasets have one each. In the distal promoters the negative directions averaged four while the random datasets average 1.3. The positive direction has only one and the random datasets averaged 1.3.
====TRFs====
{{main|Telomeric repeat DNA-binding factor gene transcriptions#TRF samplings}}


The Rashotte1 ARR (ARRR1) results differ from random datasets: one in the UTR on the ZSCAN22 side versus two (random). No core promoter elements versus one in two of ten (random). Three proximal promoters versus none (random). Distal promoters: one in the negative direction and three in the positive and one to three (random).
====UPREs====
{{main|Unfolded protein response element gene transcriptions#UPRE samplings}}


For (G/A)GAT(T/C) in ARRR2 (Rashotte2) UTRs, there are none for the negative strand, negative direction, but each random data set finds 2-8. For the positive strand, negative direction, there are seven versus 2-8 from the randomly generated nucleotide data sets (0 through 9).
====UPRE-1s====
{{main|Hac1p gene transcriptions#UPRE-1 samplings}}


For (A/G)ATC(C/T) in ARRR2 (Rashotte2) UTRs, all four of the negative strand, negative direction results are inverse complements, where the random data sets have (4-9). For the positive strand, negative direction there are eleven, but the random datasets have 2-9.
====URS (Sumrada, core)====
{{main|DNA damage response element gene transcriptions#URS1 (Sumrada, core) samplings}}


Neither direction for ARRR2 (Rashotte2) has core promoter elements, while the random results have an average of (1 per data set, 0-1, negative direction, 0-3, positive direction).
====VDREs====
{{main|Vitamin D response element gene transcriptions#VDRE samplings}}


For the negative direction and the proximal promoter, ARRR2 (Rashotte2) produced only one. And, the random datasets have an average of (1 per data set, 0-4).
====XCPE1s====
{{main|X core promoter element gene transcriptions#XCPE1 samplings}}


The positive direction, ARRR2 (Rashotte2) has six. The random datasets have about 1 per dataset (0-3).
====Yaps====
{{main|Yap1p,2p gene transcriptions#Yap samplings}}


The distal promoters, negative direction, ARRR2 (Rashotte2) has 37 and the positive direction 25. The random datasets cover 8-20.
====YYRNWYY Inrs====
{{main|Initiator element gene transcriptions#YYRNWYY samplings}}


===Ethylene response factors===
==A1BG orthologs==


===Gibberellic acid response elements===
===''Geotrypetes seraphini''===
[[Image:Geotrypetes seraphini 81151944.jpg|thumb|right|250px|''Geotrypetes seraphini'', the Gaboon caecilian, is a species of amphibian. Credit: [https://www.inaturalist.org/users/7865 Marius Burger].{{tlx|free media}}]]
''Geotrypetes seraphini'', the Gaboon caecilian, is a species of amphibian in the family ''Dermophiidae''.<ref name=IUCN>{{cite journal |author=IUCN SSC Amphibian Specialist Group |date=2019 |title=''Geotrypetes seraphini'' |volume=2019 |page=e.T59557A16957715 |url=https://en.wikipedia.org/wiki/IUCN_Red_List
|doi=10.2305/IUCN.UK.2019-1.RLTS.T59557A16957715.en |accessdate=16 November 2021}}</ref>


The TAACAAA box (GARE) has an inverse complement TTTGTTA at 230 nucleotides from ZSCAN22 toward A1BG. This is in the distal promoter for A1BG or is a response element for ZSCAN22 rather than A1BG. The GARE-like 1 TTAACA(A/G)A occurs as an inverse complement TTTGTTA at 230 nucleotides from the gene end of ZSCAN22 and may be a response element for ZSCAN22.
Its A1BG ortholog has 368 aa vs 495 aa for ''Homo sapiens''.
{{clear}}


==ZSCAN22==
==ZSCAN22==
{{main|ZSCAN22}}
{{main|ZSCAN22}}
# Gene ID: 342945 is ZSCAN22 zinc finger and SCAN domain containing 22 on 19q13.43.<ref name=HGNC342945>{{ cite web
# Gene ID: 342945 is ZSCAN22 zinc finger and SCAN domain containing 22 on 19q13.43.<ref name=HGNC342945>{{ cite web
|vauthors=HGNC
|author=HGNC
|title=ZSCAN22 zinc finger and SCAN domain containing 22 [ Homo sapiens (human) ]
|title=ZSCAN22 zinc finger and SCAN domain containing 22 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|publisher=National Center for Biotechnology Information
Line 170: Line 1,097:
|accessdate=2019-12-18 }}</ref> ZSCAN22 is transcribed in the negative direction from LOC100887072.<ref name=HGNC342945/>
|accessdate=2019-12-18 }}</ref> ZSCAN22 is transcribed in the negative direction from LOC100887072.<ref name=HGNC342945/>
# Gene ID: 102465484 is MIR6806 microRNA 6806 on 19q13.43: "microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop."<ref name=RefSeq102465484>{{ cite web
# Gene ID: 102465484 is MIR6806 microRNA 6806 on 19q13.43: "microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop."<ref name=RefSeq102465484>{{ cite web
|vauthors=RefSeq
|author=RefSeq
|title=MIR6806 microRNA 6806 [ Homo sapiens (human) ]
|title=MIR6806 microRNA 6806 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|publisher=National Center for Biotechnology Information
Line 189: Line 1,116:
{{main|Alpha-1-B glycoprotein}}
{{main|Alpha-1-B glycoprotein}}
'''Def.''' "a substance that induces an immune response, usually foreign"<ref name=AntigenWikt>{{ cite web
'''Def.''' "a substance that induces an immune response, usually foreign"<ref name=AntigenWikt>{{ cite web
|vauthors=[[wikt:User:Jag123|Jag123]]
|author=[[wikt:User:Jag123|Jag123]]
|title=antigen
|title=antigen
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 198: Line 1,125:


'''Def.''' any "substance that elicits [an] immune response"<ref name=ImmunogenWikt>{{ cite web
'''Def.''' any "substance that elicits [an] immune response"<ref name=ImmunogenWikt>{{ cite web
|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title=immunogen
|title=immunogen
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 216: Line 1,143:


'''Def.''' "a protein produced by B-lymphocytes that binds to [a specific antigen or]<ref name=AntibodyWikt1>{{ cite web
'''Def.''' "a protein produced by B-lymphocytes that binds to [a specific antigen or]<ref name=AntibodyWikt1>{{ cite web
|vauthors=[[wikt:User:Williamsayers79|Williamsayers79]]
|author=[[wikt:User:Williamsayers79|Williamsayers79]]
|title=antibody
|title=antibody
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 223: Line 1,150:
|url=https://en.wiktionary.org/wiki/antibody
|url=https://en.wiktionary.org/wiki/antibody
|accessdate=7 March 2020 }}</ref> an antigen"<ref name=AntibodyWikt>{{ cite web
|accessdate=7 March 2020 }}</ref> an antigen"<ref name=AntibodyWikt>{{ cite web
|vauthors=[[wikt:User:Jag123|Jag123]]
|author=[[wikt:User:Jag123|Jag123]]
|title=antibody
|title=antibody
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 245: Line 1,172:


'''Def.''' "any of the glycoproteins in blood serum that respond to invasion by foreign antigens and that protect the host by removing pathogens;"<ref name=ImmunoglobulinWikt>{{ cite web
'''Def.''' "any of the glycoproteins in blood serum that respond to invasion by foreign antigens and that protect the host by removing pathogens;"<ref name=ImmunoglobulinWikt>{{ cite web
|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title= immunoglobulin
|title= immunoglobulin
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 252: Line 1,179:
|url=https://en.wiktionary.org/wiki/immunoglobulin
|url=https://en.wiktionary.org/wiki/immunoglobulin
|accessdate=7 March 2020 }}</ref> "an antibody"<ref name=ImmunoglobulinWikt1>{{ cite web
|accessdate=7 March 2020 }}</ref> "an antibody"<ref name=ImmunoglobulinWikt1>{{ cite web
|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title= immunoglobulin
|title= immunoglobulin
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 261: Line 1,188:


Gene ID: 1 is A1BG [[alpha-1-B glycoprotein]] on 19q13.43, a 54.3 kDa [[protein]] in humans that is encoded by the A1BG [[gene]].<ref name=RefSeq1>{{ cite web
Gene ID: 1 is A1BG [[alpha-1-B glycoprotein]] on 19q13.43, a 54.3 kDa [[protein]] in humans that is encoded by the A1BG [[gene]].<ref name=RefSeq1>{{ cite web
|vauthors=RefSeq
|author=RefSeq
|title=A1BG alpha-1-B glycoprotein [ Homo sapiens (human) ]
|title=A1BG alpha-1-B glycoprotein [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|publisher=National Center for Biotechnology Information
Line 331: Line 1,258:


"Immunoglobulin (Ig) domain ['''cl11960'''] found in the Ig superfamily. The Ig superfamily is a heterogenous group of proteins, built on a common fold comprised of a sandwich of two beta sheets. Members of this group are components of immunoglobulin, neuroglia, cell surface glycoproteins, such as, T-cell receptors, CD2, CD4, CD8, and membrane glycoproteins, such as, butyrophilin and chondroitin sulfate proteoglycan core protein. A predominant feature of most Ig domains is a disulfide bridge connecting the two beta-sheets with a tryptophan residue packed against the disulfide bond."<ref name=NCBI386229>{{ cite web
"Immunoglobulin (Ig) domain ['''cl11960'''] found in the Ig superfamily. The Ig superfamily is a heterogenous group of proteins, built on a common fold comprised of a sandwich of two beta sheets. Members of this group are components of immunoglobulin, neuroglia, cell surface glycoproteins, such as, T-cell receptors, CD2, CD4, CD8, and membrane glycoproteins, such as, butyrophilin and chondroitin sulfate proteoglycan core protein. A predominant feature of most Ig domains is a disulfide bridge connecting the two beta-sheets with a tryptophan residue packed against the disulfide bond."<ref name=NCBI386229>{{ cite web
|vauthors=NCBI
|author=NCBI
|title=Conserved Protein Domain Family cl11960: Ig Superfamily
|title=Conserved Protein Domain Family cl11960: Ig Superfamily
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
Line 340: Line 1,267:


"This domain ['''pfam13895'''] contains immunoglobulin-like domains."<ref name=NCBI372793>{{ cite web
"This domain ['''pfam13895'''] contains immunoglobulin-like domains."<ref name=NCBI372793>{{ cite web
|vauthors=NCBI
|author=NCBI
|title=Conserved Protein Domain Family pfam13895: Ig_2
|title=Conserved Protein Domain Family pfam13895: Ig_2
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
Line 349: Line 1,276:


"Ig1_LILR_KIR_like: ['''cd05751'''] domain similar to the first immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILRs) and Natural killer inhibitory receptors (KIRs). This group includes LILRB1 (or LIR-1), LILRA5 (or LIR9), an activating natural cytotoxicity receptor NKp46, the immune-type receptor glycoprotein VI (GPVI), and the IgA-specific receptor Fc-alphaRI (or CD89). LILRs are a family of immunoreceptors expressed on expressed on T and B cells, on monocytes, dendritic cells, and subgroups of natural killer (NK) cells. The human LILR family contains nine proteins (LILRA1-3,and 5, and LILRB1-5). From functional assays, and as the cytoplasmic domains of various LILRs, for example LILRB1 (LIR-1), LILRB2 (LIR-2), and LILRB3 (LIR-3) contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs) it is thought that LIR proteins are inhibitory receptors. Of the eight LIR family proteins, only LIR-1 (LILRB1), and LIR-2 (LILRB2), show detectable binding to class I MHC molecules; ligands for the other members have yet to be determined. The extracellular portions of the different LIR proteins contain different numbers of Ig-like domains for example, four in the case of LILRB1 (LIR-1), and LILRB2 (LIR-2), and two in the case of LILRB4 (LIR-5). The activating natural cytotoxicity receptor NKp46 is expressed in natural killer cells, and is organized as an extracellular portion having two Ig-like extracellular domains, a transmembrane domain, and a small cytoplasmic portion. GPVI, which also contains two Ig-like domains, participates in the processes of collagen-mediated platelet activation and arterial thrombus formation. Fc-alphaRI is expressed on monocytes, eosinophils, neutrophils and macrophages; it mediates IgA-induced immune effector responses such as phagocytosis, antibody-dependent cell-mediated cytotoxicity and respiratory burst."<ref name=NCBI319306>{{ cite web
"Ig1_LILR_KIR_like: ['''cd05751'''] domain similar to the first immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILRs) and Natural killer inhibitory receptors (KIRs). This group includes LILRB1 (or LIR-1), LILRA5 (or LIR9), an activating natural cytotoxicity receptor NKp46, the immune-type receptor glycoprotein VI (GPVI), and the IgA-specific receptor Fc-alphaRI (or CD89). LILRs are a family of immunoreceptors expressed on expressed on T and B cells, on monocytes, dendritic cells, and subgroups of natural killer (NK) cells. The human LILR family contains nine proteins (LILRA1-3,and 5, and LILRB1-5). From functional assays, and as the cytoplasmic domains of various LILRs, for example LILRB1 (LIR-1), LILRB2 (LIR-2), and LILRB3 (LIR-3) contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs) it is thought that LIR proteins are inhibitory receptors. Of the eight LIR family proteins, only LIR-1 (LILRB1), and LIR-2 (LILRB2), show detectable binding to class I MHC molecules; ligands for the other members have yet to be determined. The extracellular portions of the different LIR proteins contain different numbers of Ig-like domains for example, four in the case of LILRB1 (LIR-1), and LILRB2 (LIR-2), and two in the case of LILRB4 (LIR-5). The activating natural cytotoxicity receptor NKp46 is expressed in natural killer cells, and is organized as an extracellular portion having two Ig-like extracellular domains, a transmembrane domain, and a small cytoplasmic portion. GPVI, which also contains two Ig-like domains, participates in the processes of collagen-mediated platelet activation and arterial thrombus formation. Fc-alphaRI is expressed on monocytes, eosinophils, neutrophils and macrophages; it mediates IgA-induced immune effector responses such as phagocytosis, antibody-dependent cell-mediated cytotoxicity and respiratory burst."<ref name=NCBI319306>{{ cite web
|vauthors=NCBI
|author=NCBI
|title=Conserved Protein Domain Family cd05751: Ig1_LILR_KIR_like
|title=Conserved Protein Domain Family cd05751: Ig1_LILR_KIR_like
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
Line 358: Line 1,285:


"IG domains ['''smart00410'''] that cannot be classified into one of IGv1, IGc1, IGc2, IG."<ref name=NCBI214653>{{ cite web
"IG domains ['''smart00410'''] that cannot be classified into one of IGv1, IGc1, IGc2, IG."<ref name=NCBI214653>{{ cite web
|vauthors=NCBI
|author=NCBI
|title=Conserved Protein Domain Family smart00410: IG_like
|title=Conserved Protein Domain Family smart00410: IG_like
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
Line 384: Line 1,311:


'''Def.''' a "group of plants or animals having similar appearance"<ref name=SpeciesWikt>{{ cite web
'''Def.''' a "group of plants or animals having similar appearance"<ref name=SpeciesWikt>{{ cite web
|vauthors=[[wikt:User:24.98.118.180|24.98.118.180]]
|author=[[wikt:User:24.98.118.180|24.98.118.180]]
|title=species
|title=species
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 414: Line 1,341:


'''Def.''' a "different sequence of a gene (locus)"<ref name=VariantWikt>{{ cite web
'''Def.''' a "different sequence of a gene (locus)"<ref name=VariantWikt>{{ cite web
|vauthors=[[wikt:User:Pdeitiker|Pdeitiker]]
|author=[[wikt:User:Pdeitiker|Pdeitiker]]
|title=variant
|title=variant
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 423: Line 1,350:


'''Def.''' any "of several different forms of the same protein, arising from either single nucleotide polymorphisms,<ref name=IsoformWikt1>{{ cite web
'''Def.''' any "of several different forms of the same protein, arising from either single nucleotide polymorphisms,<ref name=IsoformWikt1>{{ cite web
|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title=isoform
|title=isoform
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 430: Line 1,357:
|url=https://en.wiktionary.org/wiki/isoform
|url=https://en.wiktionary.org/wiki/isoform
|accessdate=2 December 2018 }}</ref> differential splicing of mRNA, or post-translational modifications (e.g. sulfation, glycosylation, etc.)"<ref name=IsoformWikt2>{{ cite web
|accessdate=2 December 2018 }}</ref> differential splicing of mRNA, or post-translational modifications (e.g. sulfation, glycosylation, etc.)"<ref name=IsoformWikt2>{{ cite web
|vauthors=[[wikt:User:72.178.245.181|72.178.245.181]]
|author=[[wikt:User:72.178.245.181|72.178.245.181]]
|title=isoform
|title=isoform
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 474: Line 1,401:


'''Def.''' the "part (DNA sequence) of the genetic makeup of an organism which determines a specific characteristic (phenotype) of that organism"<ref name=GenotypeWikt1>{{ cite web
'''Def.''' the "part (DNA sequence) of the genetic makeup of an organism which determines a specific characteristic (phenotype) of that organism"<ref name=GenotypeWikt1>{{ cite web
|vauthors=[[wikt:User:DTLHS|DTLHS]]
|author=[[wikt:User:DTLHS|DTLHS]]
|title=genotype
|title=genotype
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 481: Line 1,408:
|url=https://en.wiktionary.org/wiki/genotype
|url=https://en.wiktionary.org/wiki/genotype
|accessdate=25 March 2020 }}</ref> or a "group of organisms having the same genetic constitution" <ref name=GenotypeWikt>{{ cite web
|accessdate=25 March 2020 }}</ref> or a "group of organisms having the same genetic constitution" <ref name=GenotypeWikt>{{ cite web
|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title=genotype
|title=genotype
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 511: Line 1,438:


'''Def.''' the "regular existence of two or more different genotypes within a given species or population; also, variability of amino acid sequences within a gene's protein"<ref name=PolymorphismWikt>{{ cite web
'''Def.''' the "regular existence of two or more different genotypes within a given species or population; also, variability of amino acid sequences within a gene's protein"<ref name=PolymorphismWikt>{{ cite web
|vauthors=[[wikt:User:Widsith|Widsith]]
|author=[[wikt:User:Widsith|Widsith]]
|title=polymorphism
|title=polymorphism
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 520: Line 1,447:


'''Def.''' "one of a number of alternative forms of the same gene occupying a given position, [or locus],<ref name=AlleleWikt1>{{ cite web
'''Def.''' "one of a number of alternative forms of the same gene occupying a given position, [or locus],<ref name=AlleleWikt1>{{ cite web
|vauthors=[[wikt:User:217.105.66.98|217.105.66.98]]
|author=[[wikt:User:217.105.66.98|217.105.66.98]]
|title=allele
|title=allele
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 527: Line 1,454:
|url=https://en.wiktionary.org/wiki/allele
|url=https://en.wiktionary.org/wiki/allele
|accessdate=25 March 2020 }}</ref> on a chromosome"<ref name=AlleleWikt>{{ cite web
|accessdate=25 March 2020 }}</ref> on a chromosome"<ref name=AlleleWikt>{{ cite web
|vauthors=[[wikt:User:138.130.33.215|138.130.33.215]]
|author=[[wikt:User:138.130.33.215|138.130.33.215]]
|title=allele
|title=allele
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 587: Line 1,514:


'''Def.''' the "appearance of an organism based on a single trait [multifactorial combination of genetic traits and environmental factors]<ref name=PhenotypeWikt2>{{ cite web
'''Def.''' the "appearance of an organism based on a single trait [multifactorial combination of genetic traits and environmental factors]<ref name=PhenotypeWikt2>{{ cite web
|vauthors=[[wikt:User:24.235.196.118|24.235.196.118]]
|author=[[wikt:User:24.235.196.118|24.235.196.118]]
|title=phenotype
|title=phenotype
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 594: Line 1,521:
|url=https://en.wiktionary.org/wiki/phenotype
|url=https://en.wiktionary.org/wiki/phenotype
|accessdate=2016-10-04 }}</ref>, especially used in pedigrees"<ref name=PhenotypeWikt1>{{ cite web
|accessdate=2016-10-04 }}</ref>, especially used in pedigrees"<ref name=PhenotypeWikt1>{{ cite web
|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
|author=[[wikt:User:SemperBlotto|SemperBlotto]]
|title=phenotype
|title=phenotype
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 601: Line 1,528:
|url=https://en.wiktionary.org/wiki/phenotype
|url=https://en.wiktionary.org/wiki/phenotype
|accessdate=2016-10-04 }}</ref> or any "observable characteristic of an organism, such as its morphological, developmental, biochemical or physiological properties, or its behavior"<ref name=PhenotypeWikt>{{ cite web
|accessdate=2016-10-04 }}</ref> or any "observable characteristic of an organism, such as its morphological, developmental, biochemical or physiological properties, or its behavior"<ref name=PhenotypeWikt>{{ cite web
|vauthors=[[wikt:User:N2e|N2e]]
|author=[[wikt:User:N2e|N2e]]
|title=phenotype
|title=phenotype
|publisher=Wikimedia Foundation, Inc
|publisher=Wikimedia Foundation, Inc
Line 633: Line 1,560:


The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity."<ref name=Udby>{{ cite journal
The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity."<ref name=Udby>{{ cite journal
|vauthors=Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L.
|author=Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L.
|title=Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma
|title=Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma
|journal=Biochemistry
|journal=Biochemistry
Line 669: Line 1,596:
|accessdate=2012-02-20 }}</ref> "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."<ref name=Haendler/>
|accessdate=2012-02-20 }}</ref> "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."<ref name=Haendler/>


==ZNF497==
==A1BG-AS1==
{{main|ZNF497}}
 
Gene ID: 503538 is [[A1BG-AS1]] A1BG antisense RNA 1.<ref name=HGNC503538>{{ cite web
Gene ID: 503538 is [[A1BG-AS1]] A1BG antisense RNA 1.<ref name=HGNC503538>{{ cite web
|vauthors=HGNC
|author=HGNC
|title=A1BG-AS1 A1BG antisense RNA 1 [ Homo sapiens (human) ]
|title=A1BG-AS1 A1BG antisense RNA 1 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|publisher=National Center for Biotechnology Information
Line 679: Line 1,606:
|url=https://www.ncbi.nlm.nih.gov/gene/503538
|url=https://www.ncbi.nlm.nih.gov/gene/503538
|accessdate=2019-12-18 }}</ref> A1BG-AS1 is transcribed in the negative direction from ZSCAN22.<ref name=HGNC503538/>
|accessdate=2019-12-18 }}</ref> A1BG-AS1 is transcribed in the negative direction from ZSCAN22.<ref name=HGNC503538/>
Gene ID 503538 extends from 58,351,390 to 58,355,183. It is a long, non-coding (lnc) RNA.<ref name=Bai>{{ cite journal
|author=Jigang Bai, Bowen Yao, Liang Wang, Liankang Sun, Tianxiang Chen, Runkun Liu, Guozhi Yin, Qiuran Xu, Wei Yang
|title=lncRNA A1BG-AS1 suppresses proliferation and invasion of hepatocellular carcinoma cells by targeting miR-216a-5p
|journal=
|date=June 2019
|volume=120
|issue=6
|pages=10310-10322
|url=https://pubmed.ncbi.nlm.nih.gov/30556161/
|arxiv=
|bibcode=
|doi=10.1002/jcb.28315
|pmid=30556161
|accessdate=16 May 2023 }}</ref> Extensive evidence indicates that long noncoding RNAs (lncRNAs) regulate the tumorigenesis and progression of hepatocellular carcinoma (HCC).<ref name=Bai/>
The underexpression of A1BG-AS1 was found in HCC via analysis of The Cancer Genome Atlas database.<ref name=Bai/> A1BG-AS1 expression in HCC was markedly lower than that in noncancerous tissues.<ref name=Bai/>
==ZNF497==
{{main|ZNF497}}


Gene ID: 162968 is [[ZNF497]] zinc finger protein 497.<ref name=HGNC162968>{{ cite web
Gene ID: 162968 is [[ZNF497]] zinc finger protein 497.<ref name=HGNC162968>{{ cite web
|vauthors=HGNC
|author=HGNC
|title=ZNF497 zinc finger protein 497 [ Homo sapiens (human) ]
|title=ZNF497 zinc finger protein 497 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|publisher=National Center for Biotechnology Information
Line 692: Line 1,639:


Gene ID: 100419840 is LOC100419840 zinc finger protein 446 pseudogene.<ref name=HGNC100419840>{{ cite web
Gene ID: 100419840 is LOC100419840 zinc finger protein 446 pseudogene.<ref name=HGNC100419840>{{ cite web
|vauthors=HGNC
|author=HGNC
|title=LOC100419840 zinc finger protein 446 pseudogene [ Homo sapiens (human) ]
|title=LOC100419840 zinc finger protein 446 pseudogene [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|publisher=National Center for Biotechnology Information
Line 701: Line 1,648:


Gene ID: 105372483 is LOC105372483 uncharacterized LOC105372483 ncRNA.<ref name=HGNC105372483>{{ cite web
Gene ID: 105372483 is LOC105372483 uncharacterized LOC105372483 ncRNA.<ref name=HGNC105372483>{{ cite web
|vauthors=HGNC
|author=HGNC
|title=LOC105372483 uncharacterized LOC105372483 [ Homo sapiens (human) ]
|title=LOC105372483 uncharacterized LOC105372483 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|publisher=National Center for Biotechnology Information
Line 710: Line 1,657:


Gene ID: 106479017 is RNA5SP473 RNA, 5S ribosomal pseudogene 473.<ref name=HGNC106479017>{{ cite web
Gene ID: 106479017 is RNA5SP473 RNA, 5S ribosomal pseudogene 473.<ref name=HGNC106479017>{{ cite web
|vauthors=HGNC
|author=HGNC
|title=RNA5SP473 RNA, 5S ribosomal pseudogene 473 [ Homo sapiens (human) ]
|title=RNA5SP473 RNA, 5S ribosomal pseudogene 473 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information
|publisher=National Center for Biotechnology Information
Line 822: Line 1,769:


<!-- footer templates -->
<!-- footer templates -->
{{Gene project}}{{tlx|Phosphate biochemistry}}
{{Gene project}}{{Transcription factors and intracellular receptors}}{{tlx|Phosphate biochemistry}}


<!-- footer categories -->
<!-- footer categories -->
[[Category:Resources last modified in May 2021]]

Latest revision as of 21:09, 16 May 2023

Associate Editor(s)-in-Chief: Henry A. Hoff

Alpha-1-B glycoprotein is a 54.3 kDa protein in humans that is encoded by the A1BG gene.[1] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins.

A1BG was located on the DNA strand of chromosome 19.[2] Additionally, A1BG, in current nucleotide numbering (58,345,183-58,353,492), is located adjacent to the ZSCAN22 gene (58,326,994-58,342,332) on the positive DNA strand, as well as the ZNF837 (58,367,623 - 58,381,030, complement) and ZNF497 (58,354,357 - 58,362,751, complement) genes on the negative strand.[2]

In the current nucleotide numbering, the A1BG untranslated region (UTR) has been expanded so that with ZSCAN22 ending at 58,342,332, the nucleotides used in this study are 58,342,333 to 58,346,892 on both strands, with the current UTR for A1BG beginning at 58,345,183. On the other side of A1BG ending at 58,353,492, the nucleotides used are 58,353,493 to 58,357,937. With ZNF497 beginning at 58,354,357, this study goes into ZNF497 to 58,357,937 or 3580 nucleotides from its downstream TSS or 4445 nucleotides from the TSS of A1BG downstream from ZNF497.

For example, an abscisic acid responsive element (ABRE) with the consensus sequence of ACGTG(G/T)C (Watanabe et al. 2017) occurs in the positive strand in the negative direction from ZSCAN22 to A1BG as ACGTGGC ending at 4239 nucleotides from the end of ZSCAN22 or 58,346,571, where the A is at 58,346,565 inside the UTR of A1BG.

Introduction

"Many important disease-related pathways utilize transcription factors that specifically bind DNA (e.g., c-Myc, HIF-1, TCF1, p53) as key nodes or endpoints in complex signaling networks. In such cases the transcription factor itself is often the most attractive target. However, drugging transcription factors is challenging owing to an absence of small ligand binding sites in their DNA-binding domain and the presence of a highly charged DNA-binding surface [1]."[3]

If a specific gene appears to be involved in a disease-related or deleterious pathway being able to alter its expression so as to improve the person's health may be needed. To alter its expression constructively may require knowing what regulatory elements exist in the gene's nearby promoters.

Response elements

Main article: A1BG response element gene transcriptions

Identifying a bona fide response element is more difficult than a simple inspection. In order to attribute the response element to a candidate sequence, some observations have to be conducted using molecular, biological and biophysical methods and functional approaches. Findings may indicate that response element in the promoter is a functional element.[4]

A likely response element found by simple inspection may also be inactive due to methylation.

Response Elements: "Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions."[5]

"Under conditions of stress, a transcription activator protein binds to the response element and stimulates transcription. If the same response element sequence is located in the control regions of different genes, then these genes will be activated by the same stimuli, thus producing a coordinated response."[6]

WD-40 repeat family

Main article: WD-40 repeat family

"Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During Phaseolus vulgaris root development, RACK1 (PvRACK1) mRNA expression was induced by auxins, abscisic acid, cytokinin, and gibberellic acid."[7]

Abscisic acid (ABA) response elements

Main article: ABA-response element gene transcriptions § ABRE samplings

Auxin response factors

Main article: Auxin response factor gene transcriptions
ARFUs
Main article: Auxin response factor gene transcriptions § TGTCTC (Ulmasov) ARFbs samplings
ARFBs
Main article: Auxin response factor gene transcriptions § TGTCGG (Boer) ARFbs samplings
ARF2s
Main article: Auxin response factor gene transcriptions § ARF (Stigliani) samplings
ARF5s
Main article: Auxin response factor gene transcriptions § ARF5 samplings

CAACTC regulatory elements

Main article: CARE gene transcriptions
CAREs (Fan)
Main article: CARE gene transcriptions § CARE (Fan) sampling of A1BG promoters
CAREs (Garaeva)
Main article: CARE gene transcriptions § CARE (Garaeva) samplings

Cytokinins

Main article: Cytokinin response regulator gene transcriptions
ARR1s
Main article: Cytokinin response regulator gene transcriptions § ARR1 Cytokinin samplings
ARR10s
Main article: Cytokinin response regulator gene transcriptions § ARR10 Cytokinin samplings
ARR12s
Main article: Cytokinin response regulator gene transcriptions § ARR12 Cytokinin samplings
ARRFs
Main article: Cytokinin response regulator gene transcriptions § ARR (Ferreira) samplings
ARRR1s
Main article: Cytokinin response regulator gene transcriptions § ARR (Rashotte1) samplings
ARRR2s
Main article: Cytokinin response regulator gene transcriptions § ARR (Rashotte2) samplings

Coupling elements

Main article: Coupling element gene transcriptions
CE3Ws
Main article: Coupling element gene transcriptions § CE3 (Watanabe) samplings
CE3Ds
Main article: Coupling element gene transcriptions § CE3 (Ding) samplings

EREs

Main article: Ethylene responsive element gene transcriptions § ERE samplings

Gibberellic acid response elements

Main article: GARE gene transcriptions
GAREs
Main article: GARE gene transcriptions § GARE sampling of A1BG promoters
GAREL1s
Main article: GARE gene transcriptions § GARE-like 1 samplings

Hypoxia response elements

Main article: Hypoxia response element gene transcriptions
HIFs
Main article: Hypoxia response element gene transcriptions § Hypoxia-inducible factor samplings
HREs
Main article: Hypoxia response element gene transcriptions § Hypoxia response element samplings
CACAs
Main article: Hypoxia response element gene transcriptions § CACA samplings

Pyrimidine boxes

Main articles: Pyrimidine box gene transcriptions and Nuclear factor of activated T cell gene transcriptions (NFAT)

TAT boxes

Main article: TAT box gene transcriptions
TATFs
Main article: TAT box gene transcriptions § TAT box (Fan) samplings
TATYs
Main article: TAT box gene transcriptions § TAT box (Yang) samplings

General Regulatory Factors

Main article: General regulatory factors

The following general regulatory factors occur in the promoters between ZSCAN22, A1BG and ZNF497 on human chromosome 19.

Abfms

Main article: Abf1 regulatory factor gene transcriptions

Rap1s

Main article: Rap1 regulatory factor gene transcriptions

Reb1s

Main article: Reb1 general regulatory factor gene transcriptions

Tbf1s

Main article: Tbf1 regulatory factor gene transcriptions

Basic leucine zipper (bZIP) class response elements

A-boxes

Main article: A box gene transcriptions

ACGTs

Main article: ACGT-containing element gene transcriptions § ACGT samplings

"A majority of the plant bZIP proteins isolated to date recognize elements with an ACGT core (Foster et al., 1994)."[8]

"Most recombinant bZIP proteins can interact with ACGT elements derived from different plant genes, albeit with different affinity. Systematic protein/DNA binding studies have shown that sequences flanking the ACGT core affect bZIP protein binding specificity. These studies have provided the basis for a concise ACGT nomenclature and defined high-affinity A-box, C-box, and G-box elements."[9]

"HY5 binds to the promoter of light-responsive genes featuring "ACGT-containing elements" such as the G-box (CACGTG), C-box (GACGTC), Z-box (ATACGGT), and A-box (TACGTA) (4, 6)."[10]

Activating transcription factors

Main article: Activating transcription factor gene transcriptions
ATFBs
Main article: Activating transcription factor gene transcriptions § Activating transcription factor samplings (Burton)
ATFKs
Main article: Activating transcription factor gene transcriptions § Activating transcription factor samplings (Kilberg)

Affinity Capture-Western; Two-hybrid transcription factors

Main article: Aft1p gene transcriptions
AFTs
Main article: Aft1p gene transcriptions § AFT1 samplings

Box As

Main article: A box gene transcriptions § Box A samplings

C-boxes

Main article: C box gene transcriptions

C-boxes come in several varieties:

C-boxes (Johnson)
Main article: C box gene transcriptions § Johnson C-box samplings
C boxes (Samarsky)
Main article: C box gene transcriptions § Samarsky C box samplings
C boxes (Voronina)
Main article: C box gene transcriptions § Voronina C box samplings
C boxes (Song)
Main article: C box gene transcriptions § Song C-box samplings
C boxes (Song hybrids)
Main article: C box gene transcriptions § Hybrid C, G box samplings

Hybrids: C/A-box (TGACGTAT), C/G-box (TGACGTGT), C/T-box (TGACGTTA).

CAMPs

Main article: CRE box gene transcriptions § CRE samplings of the A1BG promoters

ESRE

Main article: Endoplasmic reticulum stress response element gene transcriptions

The endoplasmic reticulum stress response element (ESRE) has two parts: (1) CCAAT and (2) CCACG which are tested separately then compared to see if any parts have any nine nucleotides between them.

CCAAT
Main article: Endoplasmic reticulum stress response element gene transcriptions § CCAAT samplings
CCACG
Main article: Endoplasmic reticulum stress response element gene transcriptions § CCACG samplings

According to So (2018) the endoplasmic reticulum stress response element should be CCAAT-N9-CCACG. Samplings demonstrate that the ideal CCAAT-N9-CCACG or its complement inverse do not occur on either side of A1BG or close to ZSCAN22 or ZNF497.

Hap motif

Main articles: CAAT box gene transcriptions § Heme-activated protein (Hap) samplings, and Endoplasmic reticulum stress response element gene transcriptions § CCAAT samplings

G-boxes

Main article: G box gene transcriptions
G-box (CACGTG)
Main articles: Phosphate starvation-response transcription factor gene transcriptions § Pho samplings, and Complex locus A1BG and ZNF497 § Phors

GCN4 motif

Main article: Gcn4p gene transcriptions
GCREs (Gcn4)
Main article: Gcn4p gene transcriptions § GCRE samplings

Migs

Main article: Mig1p gene transcriptions

Nuclear factors

Main article: Nuclear factor gene transcriptions
NFATs
Main article: Nuclear factor of activated T cell gene transcriptions (NFAT) § NFAT samplings
HNF6s
Main article: HNF gene transcriptions § HNF6 samplings

T boxes

Main article: T box gene transcriptions
TboxCs
Main article: T box gene transcriptions § T box (Conlon) samplings
TboxZs
Main article: T box gene transcriptions § T box (Zhang) samplings

Vboxes

Main article: V box gene transcriptions § V box samplings

Z-boxes

Main article: Z box gene transcriptions
ZboxGs
Main article: Z box gene transcriptions § General Z-box (ZboxG) samplings
ZboxSps
Main article: Z box gene transcriptions § Z-box (ZboxSp) samplings

Helix-turn-helix (HTH) transcription factors

Main article: Helix-turn-helix transcription factors

Gene ID: 4602 is MYB [myeloblastosis] MYB proto-oncogene, transcription factor on 6q23.3: "This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants."[11]

CadC binding domains

Main article: CadC binding domain gene transcriptions § Cadaverine C samplings

Factor II B recognition elements

Main article: Factor II B recognition element gene transcriptions § BREu samplings

Forkhead boxes

Main article: Forkhead box gene transcriptions § Forkhead box samplings

Homeoboxes

Main article: Homeobox gene transcriptions § Homeobox samplings

Homeodomains

Main article: Homeobox gene transcriptions § Homeodomain samplings

HSE3 (Eastmond)

Main article: Hsf1p gene transcriptions § HSE3 (Eastmond) samplings

HSE4 (Eastmond)

Main article: Hsf1p gene transcriptions § HSE4 (Eastmond) samplings

HSE8 GAP1 (Eastmond)

Main article: Hsf1p gene transcriptions § HSE8 GAP1 (Eastmond) samplings

HSE9 GAP2 (Eastmond)

Main article: Hsf1p gene transcriptions § HSE9 GAP2 (Eastmond) samplings

Hsf (Tang)

Main article: Hsf1p gene transcriptions § Hsf (Tang) samplings

MREs

Main article: MYB recognition element gene transcriptions § MRE samplings

Tryptophan residues

Main article: Interferon regulatory factor gene transcriptions § Tryptophan residue samplings

Basic helix-loop-helix (bHLH) transcription factors

Main article: Basic helix–loop–helix

"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."[12]

"Pho4 bound to virtually all E-boxes in vitro (96%) [...]. That was not the case in vivo, where only 5% were bound by Pho4, under activating conditions as determined by ChIP-seq [Zhou and O'Shea 2011]."[12]

"Pho4 possesses the intrinsic ability to bind every E-box, but in vivo is prevented from binding by chromatin unless assisted by chromatin remodelers (Svaren et al. 1994) that are targeted at promoter regions."[12]

"On one end of that spectrum, typical transcription factors like Pho4 do not appear to compete with nucleosomes and instead predominantly sample motifs that already exist in the [nucleosome-free promoter regions] NFRs generated by other factors. In vitro (PB-exo), Pho4 bound nearly every instance of an E-box motif across the yeast genome. However, in vivo, Pho4 is a low-abundance protein that is recruited to the nucleus upon phosphate starvation by other factors, to act at a few dozen genes (Komeili and O'Shea 1999; Zhou and O'Shea 2011). Since Pho4 appears unable to compete with nucleosomes, competent sites that are occluded by nucleosomes are invisible to Pho4."[12]

The Pho4 homodimer binds to DNA sequences containing the bHLH binding site CACGTG.[13]

The upstream activating sequence (UAS) for Pho4p is CAC(A/G)T(T/G) in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].[14]

bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG.[15]

"A computer search for transcription promoter elements [...] showed the presence of a prominent TATA box 22 nucleotides upstream of the transcription start site and an Sp1 site at position -42 to -33. The 5'-flanking sequence also contains three E boxes with CANNTG consensus sequences at positions -464 to -459, -90 to -85, and -52 to -47 that have been marked as E box, E1 box, and E2 box, respectively [...]. In addition, the 5'-flanking region contains one or more GRE, XRE, GATA-1, GCN-4, PEA-3, AP1, and AP2 consensus motifs and also three imperfect CArG sites [...]."[16]

AhRYs

Main article: Xenobiotic response element gene transcriptions § TCDD*AhR DNA-binding consensus sequence sampling

AHRE-IIs

Main article: Xenobiotic responsive element gene transcriptions § AHRE-II samplings

AEREs

Main article: Antioxidant-electrophile responsive element gene transcriptions § AERE (Lacher) samplings

CAT boxes

Main article: CAT box gene transcriptions § CAT box samplings

CAT-box-like elements

Main article: CAT box gene transcriptions § CAT-box-like element samplings

"Class C"

Main article: N box gene transcriptions § "Class C" (Leal) samplings

"Class I"

TCFs
Main article: Transcription factor 3 gene transcriptions § TCF3 samplings

DIOXs

Main article: Xenobiotic response element gene transcriptions § DIOX samplings

Enhancer boxes

Main article: Enhancer box gene transcriptions § Enhancer box samplings
ChoRE motifs
Main article: Carbohydrate response element gene transcriptions
CarbE1s
Main article: Carbohydrate response element gene transcriptions § ATCTTG (CarbE1) samplings
CarbE2s
Main article: Carbohydrate response element gene transcriptions § CACGTG (CarbE2) samplings
CarbE3s
Main article: Carbohydrate response element gene transcriptions § TCCGCC (CarbE3) samplings
Phors
Main article: Phosphate starvation-response transcription factor gene transcriptions § Pho samplings

Palindromic E-box motif (CACGTG).

E2 boxes
Main article: E2 box gene transcriptions § E2 box samplings

GATAs

Main article: GATA gene transcriptions § GATA samplings

Gln3s

Main article: GATA gene transcriptions § Staschke Gln3 samplings

Glucocorticoid response elements

Main article: Glucocorticoid response element gene transcriptions § Glu samplings

ICRE (Lopes)

Main article: Inositol, choline-responsive element gene transcriptions

ICRE (Schwank)

Main article: Inositol, choline-responsive element gene transcriptions

Pho4

Main article: Phosphate starvation-response transcription factor gene transcriptions § Phop samplings

QRDREs

Main article: Xenobiotic response element gene transcriptions § QRDRE samplings

Carbon source-responsive elements

Main article: Carbon source-responsive element gene transcriptions
CATTCAs
Main article: Carbon source-responsive element gene transcriptions § CATTCA samplings
TCCGs
Main article: Carbon source-responsive element gene transcriptions § TCCG samplings

XREs

Main article: Xenobiotic response element gene transcriptions § Xenobiotic response element samplings

Basic helix-loop-helix leucine zipper transcription factors

Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both Basic helix-loop-helix and leucine zipper motifs.

Examples include Microphthalmia-associated transcription factor and Sterol regulatory element-binding protein (SREBP).

MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes.[17]

Serum response element gene transcriptions: The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[18]

"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)6GG (CArG) motif."[19]

CArG boxes

Main article: CArG box gene transcriptions § CArG box samplings

MITF E-boxes

Main article: Enhancer box gene transcriptions § MITF E-box (CAYRTG) samplings
RREs
Main article: MYB recognition element gene transcriptions § RRE samplings

Consensus sequence: CATCTG.

M-boxes

Main article: M box gene transcriptions
M box (Bertolotto)
Main article: M box gene transcriptions § M box (Bertolotto) samplings
M-box (Hoek)
Main article: M box gene transcriptions § M-box (Hoek) samplings
M-box (Ripoll)
Main article: M box gene transcriptions § M-box (Ripoll) samplings

SER elements

Main article: Serum response element gene transcriptions § SER samplings

Basic helix-span-helix

Activating proteins

Main article: Activating protein gene transcriptions
AP2as
Main article: Activating protein gene transcriptions § AP-2 alpha consensus sequences
APCo1s
Main article: Activating protein gene transcriptions § Activating protein samplings (Cohen)
APCo2s
Main article: Activating protein gene transcriptions § Activating protein (Cohen2) samplings
APM3Ns
Main article: Activating protein gene transcriptions § Activating protein samplings (Murata, 3N)
APM4Ns
Main article: Activating protein gene transcriptions § Activating protein samplings (Murata, 4N)
Yao1s
Main article: Activating protein gene transcriptions § Activating protein samplings (Yao1)
Yao2s
Main article: Activating protein gene transcriptions § Activating protein samplings (Yao2)
Yau3s
Main article: Activating protein gene transcriptions § Activating protein samplings (Yao3)

"Pemphigus foliaceus (PF) is an autoimmune disease, endemic in Brazilian rural areas, characterized by acantholysis and accompanied by complement activation, with generalized or localized distribution of painful epidermal blisters. CD59 is an essential complement regulator, inhibiting formation of the membrane attack complex, and mediating signal transduction and activation of T lymphocytes. CD59 has different transcripts by alternative splicing, of which only two are widely expressed, suggesting the presence of regulatory sites in their noncoding regions. To date, there is no association study with polymorphisms in CD59 noncoding regions and susceptibility to autoimmune diseases. In this study, we aimed to evaluate if CD59 polymorphisms have a possible regulatory effect on gene expression and susceptibility to PF. Six noncoding polymorphisms were haplotyped in 157 patients and 215 controls by sequence-specific PCR, and CD59 mRNA levels were measured in 82 subjects, by qPCR. The rs861256-allele-G (rs861256*G) was associated with increased mRNA expression (p = .0113) and PF susceptibility in women (OR = 4.11, p = .0001), which were also more prone to develop generalized lesions (OR = 4.3, p = .009) and to resist disease remission (OR = 3.69, p = .045). Associations were also observed for rs831625*G (OR = 3.1, p = .007) and rs704697*A (OR = 3.4, p = .006) in Euro-Brazilian women, and for rs704701*C (OR = 2.33, p = .037) in Afro-Brazilians. These alleles constitute the GGCCAA haplotype, which also increases PF susceptibility (OR = 4.9, p = .045) and marks higher mRNA expression (p = .0025). [...] higher CD59 transcriptional levels may be related with PF susceptibility (especially in women), probably due to the effect of genetic polymorphism and to the CD59 role in T cell signal transduction."[20]

Stem-loops

File:Stem-loop.svg
An example of an RNA stem-loop is shown. Credit: Sakurambo.{{free media}}

As an important secondary structure of RNA, a stem-loop can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.[21]

Hairpin loops are often elements found within the 5'UTR of prokaryotes. These structures are often bound by proteins or cause the attenuation of a transcript in order to regulate translation.[22]

The mRNA stem-loop structure forming at the ribosome binding site may control an initiation of translation.[23][24]

AUREs

Main article: Adenylate–uridylate rich element gene transcriptions § Adenylate–uridylate rich element (Bakheet) samplings

Adenylate–uridylate rich elements (Chen and Shyu, Class I)

Main article: Adenylate–uridylate rich element gene transcriptions § ATTTA (Chen and Shyu, Class I) samplings

Adenylate–uridylate rich elements (Chen and Shyu, Class II)

Main article: Adenylate–uridylate rich element gene transcriptions § UUAUUUA(U/A)(U/A) (Chen and Shyu, Class II) samplings

Adenylate–uridylate rich elements (Chen and Shyu, Class III)

Main article: Adenylate–uridylate rich element gene transcriptions § ATTT (Chen and Shyu, Class III)

MERs

Main article: Adenylate–uridylate rich element gene transcriptions § Overlapping (Siegel) mers

Constitutive decay elements

Main article: Adenylate–uridylate rich element gene transcriptions § Constitutive decay element (Siegel) samplings

Cys
2His
2 SP / Kruppel-like factor (KLF) transcription factor family

The Cys
2His
2-like fold group (Cys
2His
2) is by far the best-characterized class of zinc fingers, and is common in mammalian transcription factors, where such domains adopt a simple ββα fold and have the amino acid sequence motif:[25]

X2-Cys-X2,4-Cys-X12-His-X3,4,5-His

Alcohol dehydrogenase repressor 1

Main article: Adr1p gene transcriptions § ADR samplings

SP1M1s

Main article: Specificity protein gene transcriptions § Sp1-box 1 (Motojima) Samplings

SP1M2s

Main article: Specificity protein gene transcriptions § Sp1-box 2 (Motojima) Samplings

SP-1 (Sato)s

Main article: Specificity protein gene transcriptions § Sp-1 (Sato) samplings

SP1 (Yao)s

Main article: Specificity protein gene transcriptions § Sp1 (Yao) samplings

YY1Ts

Main article: YY1 gene transcriptions § YY1 CCATCTT samplings

AP-2/EREBP-related factors

AGC boxes

Main article: AGC box gene transcriptions § AGC box samplings

AP-1 transcription factor network (Pathway)

Sixty-nine genes are included in the AP-1 transcription factor network (Pathway).[26]

AGCEs

Main article: AGCE gene transcriptions § AGCE samplings

Zinc finger DNA-binding domains

AnRE1s

Main article: Androgen response element gene transcriptions § Androgen response element1 (Kouhpayeh) samplings

AnDRE2s

Main article: Androgen response element gene transcriptions § Androgen response element2 (Kouhpayeh) samplings

AnREWs

Main article: Androgen response element gene transcriptions § Androgen response element (Wilson) samplings

B-boxes

Main article: B box gene transcriptions § B box (Johnson) samplings

Box Bs

Main article: B box gene transcriptions § B1 box (Sanchez) samplings

β-Scaffold factors

"Higher animals have [transcription factor] TF genes for the basic domain, the β-scaffold factor, and other new structures; however, their total proportion is less than 15% and most are [zinc (Zn)-coordinating factor] ZF and [Helix-Turn-Helix] HTH genes."[27]

ATA boxes

Main article: ATA box gene transcriptions § ATA box samplings

Γ-interferon activated sequences

Main article: Γ-interferon activated sequence gene transcriptions § Γ-interferon activated sequence samplings

HMG boxes

Main article: HMG box gene transcriptions § HMG box samplings

Zn(II)2Cys6 proteins

"The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)2Cys6 proteins), and they recognize highly related sequences rich in GGC triplets [15]."[28]

Dal81

GCC boxes

Main article: AGC box gene transcriptions § GCC box samplings

GGC triplets

Main article: GGC triplet gene transcriptions § GGC samplings
GGCGGC triplets
Main article: GGC triplet gene transcriptions § GGCGGC triplet samplings

Leu3

Main articles: Leu3 gene transcriptions § Leu samplings, and GGC triplet gene transcriptions § Leu3 samplings

Uga3

Main article: Leu3 gene transcriptions

Hairpin-hinge-hairpin-tail

"In addition to this ACA box, they have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity. Despite this lack of primary sequence conservation, the H and ACA boxes are embedded in an evolutionarily conserved hairpin-hinge-hairpin-tail core secondary structure with the H box in the single-stranded hinge region and the ACA box in the single-stranded tail (5, 16)."[29]

H and ACA boxes

Main article: H and ACA box gene transcriptions § H and ACA boxes in promoters of A1BG

H-boxes (Grandbastien)

Main article: H box gene transcriptions § H-box (Grandbastien) samplings

H-boxes (Lindsay)

Main article: H box gene transcriptions § H-box (Lindsay) samplings

H boxes (Mitchell)

Main article: H box gene transcriptions § H boxes (Mitchell) samplings

H boxes (Rozhdestvensky)

Main article: H box gene transcriptions § H boxes (Rozhdestvensky) in promoters of A1BG

Unknown response element types

ACEs

Main article: MYB recognition element gene transcriptions § ACE samplings

BBCABW Inrs

Main article: Initiator element gene transcriptions § BBCABW samplings

Calcineurin-responsive transcription factors

Main article: Calcineurin-responsive transcription factor gene transcriptions § CRT samplings

Carbs

Main article: Carbohydrate response element gene transcriptions § ACCGG (Carb) samplings

Carb1s

Main article: Carbohydrate response element gene transcriptions § CCCAT (Carb1) samplings

Cat8s

Main article: Cat8p gene transcriptions § Cat8p samplings

Cell-cycle box variants

Main article: Cell-cycle box gene transcriptions § CCB variant samplings

CGCG boxes

Main article: CGCG box gene transcriptions § CGCG box samplings

Circadian control elements

Main article: Circadian control element gene transcriptions § CCE samplings

Cold-responsive elements

Main article: Cold-responsive element gene transcriptions § Cold-responsive element samplings

Copper response elements

Main article: Copper response element gene transcriptions
CuREQs
Main article: Copper response element gene transcriptions § CuRE (Quinn) samplings
CuREPs
Main article: Copper response element gene transcriptions § CuRE (Park) samplings

Cytoplasmic polyadenylation elements

Main article: Cytoplasmic polyadenylation element gene transcriptions § CPE samplings

DAF-16 binding elements

Main article: DAF-16 binding element gene transcriptions § DBE samplings

D box (Samarsky)

Main article: D box gene transcriptions § Dbox (Samarsky) samplings

D box (Voronina)

Main article: D box gene transcriptions § D box (Voronina) samplings

D-box (Motojima)

Main article: D box gene transcriptions § (Motojima) samplings

dBRE

Main article: Downstream TFIIB recognition element gene transcriptions § dBRE samplings

Downstream core elements

Main article: Downstream core element gene transcriptions

DCE SI

Main article: Downstream core element gene transcriptions § Downstream core element SI samplings

DCE SII

Main article: Downstream core element gene transcriptions § Downstream core element SII samplings

DCE SIII

Main article: Downstream core element gene transcriptions § Downstream core element SIII samplings

DPE (Juven-Gershon)

Main article: Downstream promoter element gene transcriptions § DPE (Juven-Gershon) samplings

DPE (Kadonaga)

Main article: Downstream promoter element gene transcriptions § DPE (Kadonaga) samplings

DPE (Matsumoto)

Main article: Downstream promoter element gene transcriptions § DPE (Matsumoto) samplings

EIN3 binding sites

Main article: EIN3 binding site gene transcriptions § EIN3 samplings

Endosperm expressions

Main article: Endosperm expression gene transcriptions § Endosperm expression samplings

Estrogen response elements

Main article: Estrogen response element gene transcriptions
ERE1s
Main article: Estrogen response element gene transcriptions § ERE1 (Driscoll) samplings
ERE2s
Main article: Estrogen response element gene transcriptions § EREs (Driscoll) samplings

GAAC elements

Main article: GAAC element gene transcriptions § GAAC element samplings

GC boxes (Briggs)

Main article: GC box gene transcriptions § GC box (Briggs) samplings

GC boxes (Ye)

Main article: GC box gene transcriptions § GC box (Ye) samplings

GC boxes (Zhang)

Main article: GC box gene transcriptions § GC box (Zhang) samplings

GCR1s

Main article: Gcr1p gene transcriptions § GCR1 samplings

GREs

Main article: Gibberellin responsive element gene transcriptions § GRE samplings

GT boxes (Sato)

Main article: TC element gene transcriptions § GT box (Sato) samplings

Hex sequences

Main article: Hex sequence gene transcriptions § Hex core samplings

HY boxes

Main article: HY box gene transcriptions § HY box samplings

IFNs

Main article: Interferon regulatory factor gene transcriptions § IFN-stimulated response element samplings

Inr-like, TCTs

Main article: Initiator element gene transcriptions § Inr-like, TCTs sampling

IRF3s

Main article: Interferon regulatory factor gene transcriptions § IRF-3 samplings

IRSs

Main article: Interferon regulatory factor gene transcriptions § IRS consensus samplings

KAR2s

Main article: Hac1p gene transcriptions § KAR2 samplings

MBE1s

Main article: Musashi binding element gene transcriptions § MBE1 samplings

MBE2s

Main article: Musashi binding element gene transcriptions § MBE2 samplings

MBE3s

Main article: Musashi binding element gene transcriptions § MBE3 samplings

NF𝜿BSs

Main article: Nuclear factor gene transcriptions § NF𝜿B (Sato) samplings

PREs

Main article: Polycomb response element gene transcriptions § Core samplings

Pribs

Main article: Pribnow box gene transcriptions § Pribnow box samplings

RAREs

Main article: Retinoic acid response element gene transcriptions § RARE samplings

Rgts

Main article: Rgt1p gene transcriptions § RGT samplings

ROREs

Main article: ROR-response element gene transcriptions § RORE samplings

SERVs

Main article: Servenius sequence gene transcriptions § Servenius samplings

STAT5s

Main article: STAT5 gene transcription laboratory § STAT5 samplings

STREs

Main article: Msn2,4p gene transcriptions § Stress-response element samplings

Sucroses

Main article: Sucrose box gene transcriptions § Sucrose box samplings

TACTs

Main article: TACTAAC box gene transcriptions § TACT samplings

TAGteams

Main article: TAGteam gene transcriptions § TAGteam samplings

TAPs

Main article: Tapetum box gene transcriptions § Tapetum box samplings

TATAs

Main article: TATA box gene transcriptions § TATA box samplings

Examining the promoter regions upstream from ZSCAN22 to A1BG and downstream from ZNF497 to A1BG for TATA boxes has shown that TATA boxes in various forms are present and likely active or activable: (1) TATAAAA (Carninci 2006), (2) TATA(A/T)A(A/T) (Watson 2014), (3) TATA(A/T)AA(A/G) (Juven-Gershon 2010), and (4) TATA(A/T)A(A/T)(A/G) (Basehoar 2004).

The TATA boxes have the pattern of appearing in only the negative direction UTRs, proximal and distals. The shorter TATA box: TATAAA does appear as above but also in the positive direction as the complement inverse TTTATA at 2588 in the distal promoter.

TATABs

Main article: TATA box gene transcriptions § TATA box (Butler 2002) samplings

TATACs

Main article: TATA box gene transcriptions § TATA boxes (Carninci 2006) samplings

TATAJs

Main article: TATA box gene transcriptions § TATA box (Juven-Gershon 2010) samplings

TATAWs

Main article: TATA box gene transcriptions § TATA box (Watson 2014) samplings

TEAs

Main article: TEA consensus sequence gene transcriptions § TEA samplings

TECs

Main article: Tec1p gene transcriptions § Tec1 samplings

THRs

Main article: Thyroid hormone response element gene transcriptions § THR samplings

TRFs

Main article: Telomeric repeat DNA-binding factor gene transcriptions § TRF samplings

UPREs

Main article: Unfolded protein response element gene transcriptions § UPRE samplings

UPRE-1s

Main article: Hac1p gene transcriptions § UPRE-1 samplings

URS (Sumrada, core)

Main article: DNA damage response element gene transcriptions § URS1 (Sumrada, core) samplings

VDREs

Main article: Vitamin D response element gene transcriptions § VDRE samplings

XCPE1s

Main article: X core promoter element gene transcriptions § XCPE1 samplings

Yaps

Main article: Yap1p,2p gene transcriptions § Yap samplings

YYRNWYY Inrs

Main article: Initiator element gene transcriptions § YYRNWYY samplings

A1BG orthologs

Geotrypetes seraphini

File:Geotrypetes seraphini 81151944.jpg
Geotrypetes seraphini, the Gaboon caecilian, is a species of amphibian. Credit: Marius Burger.{{free media}}

Geotrypetes seraphini, the Gaboon caecilian, is a species of amphibian in the family Dermophiidae.[30]

Its A1BG ortholog has 368 aa vs 495 aa for Homo sapiens.

ZSCAN22

Main article: ZSCAN22
  1. Gene ID: 342945 is ZSCAN22 zinc finger and SCAN domain containing 22 on 19q13.43.[31] ZSCAN22 is transcribed in the negative direction from LOC100887072.[31]
  2. Gene ID: 102465484 is MIR6806 microRNA 6806 on 19q13.43: "microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop."[32] MIR6806 is transcribed in the negative direction from LOC105372480.[32]

Of the some 111 gaps between genes on chromosome locus 19q13.43 as of 4 August 2020, gap number 88 is between ZSCAN22 and A1BG. But, there is no gap between ZNF497 and A1BG.

Promoters

The core promoter begins approximately -35 nts upstream from the transcription start site (TSS). For the numbered nucleotides between ZSCAN22 and A1BG the core promoter extends from 4425 nts up to 4460 nts (TSS). The proximal promoter extends from approximately -250 to the TSS or 4210 nts up to 4460 nts. The distal promoter begins at about 2460 nts and extends to about 4210 nts.

From the ZNF497 side the core promoter begins about 4265 nts up to 4300 nts, the proximal promoter from 4050 nts to 4265 nts, and the distal promoter from 2300 nts to 4050 nts.

Alpha-1-B glycoprotein

Main article: Alpha-1-B glycoprotein

Def. "a substance that induces an immune response, usually foreign"[33] is called an antigen.

Def. any "substance that elicits [an] immune response"[34] is called an immunogen.

An antigen "or immunogen is a molecule that sometimes stimulates an immune system response."[35] But, "the immune system does not consist of only antibodies",[35] instead it "encompasses all substances that can be recognized by the adaptive immune system."[35]

Def. "a protein produced by B-lymphocytes that binds to [a specific antigen or][36] an antigen"[37] is called an antibody.

Five different antibody isotypes are known in mammals, which perform different roles, and help direct the appropriate immune response for each different type of foreign object they encounter.[38]

Although the general structure of all antibodies is very similar, a small region, known as the hypervariable region, at the tip of the protein is extremely variable, allowing millions of antibodies with slightly different tip structures to exist, where each of these variants can bind to a different target, known as an antigen.[39]

Def. "any of the glycoproteins in blood serum that respond to invasion by foreign antigens and that protect the host by removing pathogens;"[40] "an antibody"[41] is called an immunoglobulin.

Gene ID: 1 is A1BG alpha-1-B glycoprotein on 19q13.43, a 54.3 kDa protein in humans that is encoded by the A1BG gene.[42] A1BG is transcribed in the positive direction from ZNF497.[42] "The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins."[42]

  1. NP_570602.2 alpha-1B-glycoprotein precursor, cd05751 Location: 401 → 493 Ig1_LILRB1_like; First immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILR)B1 (also known as LIR-1) and similar proteins, smart00410 Location: 218 → 280 IG_like; Immunoglobulin like, pfam13895 Location: 210 → 301 Ig_2; Immunoglobulin domain and cl11960 Location: 28 → 110 Ig; Immunoglobulin domain.[42]

Patients who have pancreatic ductal adenocarcinoma show an overexpression of A1BG in pancreatic juice.[43]

Immunoglobulin supergene family

Main article: Immunoglobulin supergene family

"𝛂1B-glycoprotein(𝛂1B) [...] consists of a single polypeptide chain N-linked to four glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂1B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂1B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂1B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."[44]

"Some of the domains of 𝛂1B show significant homology to variable (V) and constant (C) regions of certain immunoglobulins. Likewise, there is statistically significant homology between 𝛂1B and the secretory component (SC) of human IgA (15) and also with the extracellular portion of the rabbit receptor for transepithelial transport of polymeric immunoglobulins (IgA and IgM). Mostov et al. (16) have called the later protein the poly-Ig receptor or poly-IgR and have shown that it is the precursor of SC."[44]

The immunoglobulin supergene family is "the group of proteins that have immunoglobulin-like domains, including histocompatibility antigens, the T-cell antigen receptor, poly-IgR, and other proteins involved in the vertebrate immune response (17)."[44]

"The internal homology in primary structure [...] and the presence of an intrasegment disulfide bond suggest that 𝛂1B is composed of five structural domains that arose by duplication of a primordial gene coding for about 95 amino acid residues."[44]

"Unlike immunoglobulins (25), ceruloplasmin (6), and hemopexin (7), 𝛂1B is not subject to limited interdomain cleavage by proteolytic enzymes. At least, we were not able to produce such fragments by use of a variety of proteases. This stability of 𝛂1B is probably associated with the frequency of proline in the sequences linking the domains [...]."[44]

"A peptide identified in the late and early milk proteomes showed homology to eutherian alpha 1B glycoprotein (A1BG), a plasma protein with unknown function46, as well as venom inhibitors characterised in the Southern opossum Didelphis marsupialis (DM43 and DM4647,48,49), all members of the immunoglobulin superfamily. To characterise the relationship between the peptide sequence identified in koala, A1BG, DM43 and DM46, a phylogenetic tree was constructed [...] including all marsupial and monotreme homologs (identified by BLAST), three phylogenetically representative eutherian sequences, with human IGSF1 and TARM1, related members of the immunoglobulin super family, used as outgroups. This phylogeny indicates that A1BG-like proteins in marsupials and the Didelphis antitoxic proteins are homologs of eutherian A1BG, with excellent bootstrap support (98%). The marsupial A1BG-like sequences and the Didelphis antitoxic proteins formed a single clade with strong bootstrap support (97%)."[45]

"Human TARM1 and IGSF1, related members of the immunoglobulin superfamily are used as outgroups. The tree was constructed using the maximum likelihood approach and the JTT model with bootstrap support values from 500 bootstrap tests. Bootstrap values less than 50% are not displayed. Accession numbers: Tasmanian devil (Sarcophilus harrisii; XP_012402143), Wallaby (Macropus eugenii; FY619507), Possum (Trichosurus vulpecula; DY596639) Virginia opossum (Didelphis virginiana; AAA30970, AAN06914), Southern opossum (Didelphis marsupialis; AAL82794, P82957, AAN64698), Human (Homo sapiens; P04217, B6A8C7, Q8N6C5), Platypus (Ornithorhychus anatinus; ENSOANP00000000762), Cow (Bos taurus; Q2KJF1), Alpaca (Vicugna pacos; XP_015107031)."[45]

"The sequences of 𝛂1B-glycoprotein (38) and chicken N-CAM (neural cell-adhesion molecule) (39) have been shown to be related to the immunoglobulin supergene family."[46]

A1BG contains the immunoglobulin domain: cl11960 and three immunoglobulin-like domains: pfam13895, cd05751 and smart00410.

"Immunoglobulin (Ig) domain [cl11960] found in the Ig superfamily. The Ig superfamily is a heterogenous group of proteins, built on a common fold comprised of a sandwich of two beta sheets. Members of this group are components of immunoglobulin, neuroglia, cell surface glycoproteins, such as, T-cell receptors, CD2, CD4, CD8, and membrane glycoproteins, such as, butyrophilin and chondroitin sulfate proteoglycan core protein. A predominant feature of most Ig domains is a disulfide bridge connecting the two beta-sheets with a tryptophan residue packed against the disulfide bond."[47]

"This domain [pfam13895] contains immunoglobulin-like domains."[48]

"Ig1_LILR_KIR_like: [cd05751] domain similar to the first immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILRs) and Natural killer inhibitory receptors (KIRs). This group includes LILRB1 (or LIR-1), LILRA5 (or LIR9), an activating natural cytotoxicity receptor NKp46, the immune-type receptor glycoprotein VI (GPVI), and the IgA-specific receptor Fc-alphaRI (or CD89). LILRs are a family of immunoreceptors expressed on expressed on T and B cells, on monocytes, dendritic cells, and subgroups of natural killer (NK) cells. The human LILR family contains nine proteins (LILRA1-3,and 5, and LILRB1-5). From functional assays, and as the cytoplasmic domains of various LILRs, for example LILRB1 (LIR-1), LILRB2 (LIR-2), and LILRB3 (LIR-3) contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs) it is thought that LIR proteins are inhibitory receptors. Of the eight LIR family proteins, only LIR-1 (LILRB1), and LIR-2 (LILRB2), show detectable binding to class I MHC molecules; ligands for the other members have yet to be determined. The extracellular portions of the different LIR proteins contain different numbers of Ig-like domains for example, four in the case of LILRB1 (LIR-1), and LILRB2 (LIR-2), and two in the case of LILRB4 (LIR-5). The activating natural cytotoxicity receptor NKp46 is expressed in natural killer cells, and is organized as an extracellular portion having two Ig-like extracellular domains, a transmembrane domain, and a small cytoplasmic portion. GPVI, which also contains two Ig-like domains, participates in the processes of collagen-mediated platelet activation and arterial thrombus formation. Fc-alphaRI is expressed on monocytes, eosinophils, neutrophils and macrophages; it mediates IgA-induced immune effector responses such as phagocytosis, antibody-dependent cell-mediated cytotoxicity and respiratory burst."[49]

"IG domains [smart00410] that cannot be classified into one of IGv1, IGc1, IGc2, IG."[50] "𝛂1B-glycoprotein(𝛂1B) [...] consists of a single polypeptide chain N-linked to four glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂1B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂1B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂1B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."[44]

A1BG protein species

Def. a "group of plants or animals having similar appearance"[51] or "the largest group of organisms in which [any][52] two individuals [of the appropriate sexes or mating types][52] can produce fertile offspring, typically by sexual reproduction"[53] is called a species.

The gene contains 20 distinct introns.[54] Transcription produces 15 different mRNAs, 10 alternatively spliced variants and 5 unspliced forms.[54] There are 4 probable alternative promoters, 4 non overlapping alternative last exons and 7 validated alternative polyadenylation sites.[54] The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of 4 cassette exons, overlapping exons with different boundaries, splicing versus retention of 3 introns.[54]

Variants or isoforms

Def. a "different sequence of a gene (locus)"[55] is called a variant.

Def. any "of several different forms of the same protein, arising from either single nucleotide polymorphisms,[56] differential splicing of mRNA, or post-translational modifications (e.g. sulfation, glycosylation, etc.)"[57] is called an isoform.

Regarding additional isoforms, mention has been made of "new genetic variants of A1BG."[58]

"Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein (A1BG) and its post-translationally modified isoforms."[59]

Pharmacogenomic variants have been reported.[60]

Genotypes

Def. the "part (DNA sequence) of the genetic makeup of an organism which determines a specific characteristic (phenotype) of that organism"[61] or a "group of organisms having the same genetic constitution" [62]is called a genotype.

There are A1BG genotypes.[60]

A1BG has a genetic risk score of rs893184.[60]

"A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10−5)."[60]

Polymorphs

Def. the "regular existence of two or more different genotypes within a given species or population; also, variability of amino acid sequences within a gene's protein"[63] is called polymorphism.

Def. "one of a number of alternative forms of the same gene occupying a given position, [or locus],[64] on a chromosome"[65] is called an allele.

"rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG."[60]

"Genetic polymorphism of human plasma (serum) alpha 1B-glycoprotein (alpha 1B) was observed using one-dimensional horizontal polyacrylamide gel electrophoresis (PAGE) pH 9.0 of plasma samples followed by Western blotting with specific antiserum to alpha 1B."[66]

A1B*5 is a "new allele [...] of human plasma 𝜶1B-glycoprotein [...]."[67]

"Genetic polymorphism of human plasma 𝜶1B-glycoprotein (𝜶1B) was reported first, in brief, by Altland et al. [1983; also given in Altkand and Hacklar, 1984]. A detailed description of human 𝜶1B polymorphism was reported in subsequent studies [Gahne et al., 1987; Juneja et al., 1988, 1989]. Five different 𝜶1B alleles (A1B*1, A1B*2, A1B*3, A1B*4 and A1B*5) were reported. In Caucasian whites, the frequencies of A1B*1 and ''A1B*2 were about 0.95 and 0.05, respectively. A1B*4 was observed in 2 related Czech individuals. In American blacks, A1B*1 and A1B*2 occurred with a frequency of 0.73 and 0.21, respectively, while a new allele, viz, A1B*3 had a frequency of 0.06. A1B*5 was observed only in Swedish Lapps and in Finns with a frequency of 0.04 and 0.007, respectively."[68]

"The frequency of A1B*1 varied from 0.89 to 0.91 and that of A1B*2 from 0.08 to 0.10. The A1B*3 allele, reported previously only in American blacks, was observed with a frequency range of 0.003-0.01 in 3 of the Chinese populations, in Koreans and in Malays. A new 𝜶1B allele (A1B*6) was observed in 2 Chinese individuals."[68]

Phenotypes

Def. the "appearance of an organism based on a single trait [multifactorial combination of genetic traits and environmental factors][69], especially used in pedigrees"[70] or any "observable characteristic of an organism, such as its morphological, developmental, biochemical or physiological properties, or its behavior"[71] is called a phenotype.

"The three different phenotypes of α1B observed (designated 1-1, 1-2, and 2-2) were apparently identical to those reported by Altland et al. (1983), who used double one-dimensional electrophoresis. Family data supported the hypothesis that the three α1B phenotypes are determined by two codominant alleles at an autosomal locus, designated A1B. Allele frequencies in a Swedish population were: A1B *1, 0.937; A1B *2, 0.063; PIC, 0.111."[66]

Protein species

"Both protein species of [alpha 1-beta glycoprotein] A1B (A1Ba, p = 0.008; f.c.= +1.62, A1Bb, p = 0.003; f.c. = +1.82) [...] were apparently overexpressed in patients with PTCa [...]."[72]

A1BG is mainly produced in the liver, and is secreted to plasma to levels of approximately 0.22 mg/mL.[44]

CRISPs

The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity."[73] CRISP3 has a relatively high content in human plasma.[73]

"The A1BG-CRISP-3 complex is noncovalent with a 1:1 stoichiometry and is held together by strong electrostatic forces."[73] "Similar [complex formation] between toxins from snake venom and A1BG-like plasma proteins ... inhibits the toxic effect of snake venom metalloproteinases or myotoxins and protects the animal from envenomation."[73]

Opossums have a remarkably robust immune system, and show partial or total immunity to the venom of rattlesnakes, Agkistrodon piscivorus, cottonmouths, and other Crotalinae, pit vipers.[74][75]

"Crisp3 [is] mainly [expressed] in the salivary glands, pancreas, and prostate."[76] "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."[76]

A1BG-AS1

Gene ID: 503538 is A1BG-AS1 A1BG antisense RNA 1.[77] A1BG-AS1 is transcribed in the negative direction from ZSCAN22.[77]

Gene ID 503538 extends from 58,351,390 to 58,355,183. It is a long, non-coding (lnc) RNA.[78] Extensive evidence indicates that long noncoding RNAs (lncRNAs) regulate the tumorigenesis and progression of hepatocellular carcinoma (HCC).[78]

The underexpression of A1BG-AS1 was found in HCC via analysis of The Cancer Genome Atlas database.[78] A1BG-AS1 expression in HCC was markedly lower than that in noncancerous tissues.[78]

ZNF497

Main article: ZNF497

Gene ID: 162968 is ZNF497 zinc finger protein 497.[79] ZNF497 is transcribed in the positive direction from RNA5SP473.[79]

  1. NP_001193938.1 zinc finger protein 497: "Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein."[79]
  2. NP_940860.2 zinc finger protein 497: "Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein."[79]

Gene ID: 100419840 is LOC100419840 zinc finger protein 446 pseudogene.[80] LOC100419840 may be transcribed in the positive direction from LOC105372483.[80]

Gene ID: 105372483 is LOC105372483 uncharacterized LOC105372483 ncRNA.[81] LOC105372483 is transcribed in the negative direction from LOC100419840.[81]

Gene ID: 106479017 is RNA5SP473 RNA, 5S ribosomal pseudogene 473.[82] RNA5SP473 may be transcribed in the negative direction from ZNF497.[82]

GC contents

Approximately "76% of human core promoters lack TATA-like elements, have a high GC content, and are enriched in Sp1 binding sites."[83]

CpG islands typically occur at or near the transcription start site of genes, particularly housekeeping genes, in vertebrates.[84]

The number of CG or GC pairs near the TSS for A1BG appears to be low: between ZSCAN22 and A1BG are 8.2 % CG/GC and between ZNF497 and A1BG are 15 % CG/GC.

19q13.43

Main article: Genes on 19q13.43

Regulatory elements and regions

Main article: A1BG regulatory elements and regions

Functions of A1BG

"Receptors of the leukocyte receptor cluster (LRC) play a range of important functions in the human immune system."[85]

"The leukocyte receptor cluster (LRC) is a family of structurally related genes for immunoregulatory receptors. Originally, the term LRC was introduced to emphasize the linkage of the genes encoding killer immunoglobulin-like receptors (KIRs), leukocyte Ig-like receptors (LILRs), and FcαR on human chromosome 19q13.4 (Wagtmann et al. 1997; Wende et al. 1999). Subsequently, it has been found that the region contains some other structurally related genes, such as NCR1, GPVI, LAIR1, LAIR2, and OSCAR (Meyaard et al. 1997; Sivori et al. 1997; Clemetson et al. 1999; Kim et al. 2002). Most recently, the LRC has been further extended by adding two more genes named VSTM1/SIRL1 and TARM1 (Steevels et al. 2010; Radjabova et al. 2015)."[85]

"Except for LAIR2, which is a secreted protein, all human LRC products are type I cell surface receptors with extracellular regions composed of 1–4 C2-type Ig-like domains."[85]

The "eutherian LRC family, in addition to commonly recognized members, includes two new, IGSF1 and alpha-1-B glycoprotein (A1BG)."[85]

"Nucleotide sequences were retrieved and analyzed using utilities at the NCBI (https://www.ncbi.nlm.nih.gov/, last accessed May 20, 2019) and Ensemble (http://www.ensembl.org, last accessed May 20, 2019) websites."[85]

"In our previous studies, it was observed that the Ig-like domains of the frog and chicken LRC proteins reproducibly showed homology not only to known LRC members but also to the products of four mammalian genes that to our knowledge have never been considered in the phylogenetic analyses of LRC. These genes are VSTM1, TARM1, A1BG, and IGSF1. VSTM1 and TARM1 are the most recently identified members of the human LRC (Steevels et al. 2010; Radjabova et al. 2015). A1BG encodes alpha-1 B glycoprotein, a soluble component of mammalian blood plasma that is known for half a century (Schultze et al. 1963). The protein is composed of five Ig-like domains and has been shown to bind to CRISP-3, a small polypeptide that is present in exocrine secretions of neutrophilic granulocytes and that is believed to play a role in innate immunity (Udby et al. 2004). In the human genome, A1BG maps to 19q13.4 some 3.3 Mb away from GPVI [...]."[85]

"The attribution of IGSF1 and A1BG domains to the LRC was supported by their 3D structures predicted using homology modeling [...]."[85]

"Noteworthy is that the D1 and D6 domains of IgSF1 fall into one clade with the N-terminal (d1) domains of A1BG and OSCAR (cluster B1). Closer relationship of A1BG and OSCAR was supported by clustering of the d2–d5 domains of A1BG with membrane-proximal (d2) domain of OSCAR (cluster B2)."[85]

"Altogether, these results support the attribution of IGSF1 and A1BG to the LRC and suggest their relatedness to OSCAR, TARM1, and VSTM1."[85]

"Clustering of the N-terminal domains of OSCAR, IGSF1, and A1BG with each other and with IGSF1 d6 was also reproduced. Finally, the d2 domains of OSCAR cluster with the d2–d5 domains of A1BG (fig. 5). These results further justify grouping IGSF1, A1BG, OSCAR, TARM1, and VSTM1 into a distinct group B."[85]

Hypotheses

  1. Downstream core promoters may work as transcription factors even as their complements or inverses.
  2. In addition to the DNA binding sequences listed above, the transcription factors that can open up and attach through the local epigenome need to be known and specified.
  3. Each DNA binding domain serving as a transcription factor for the promoter of any immunoglobulin supergene family member, also serves or is present in the promoters for A1BG.
  4. The function of A1BG is the same as other immunoglobulin genes possessing the immunoglobulin domain cl11960 and/or any of three immunoglobulin-like domains: pfam13895, cd05751 and smart00410 in the order and nucleotide sequence: cd05751 Location: 401 → 493, smart00410 Location: 218 → 280, pfam13895 Location: 210 → 301 and cl11960 Location: 28 → 110.

See also

References

  1. ↑ "Entrez Gene: Alpha-1-B glycoprotein". Retrieved 2012-11-09.
  2. ↑ 2.0 2.1 "A1BG alpha-1-B glycoprotein". Retrieved May 10, 2013.
  3. ↑ Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
  4. ↑ Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang (July 2016). "Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region". Pediatric Research. 80 (1): 159–168. doi:10.1038/pr.2016.47. PMID 26991262. Retrieved 7 September 2020.
  5. ↑ U.S. National Library of Medicine (8 July 2008). "Response Elements MeSH Descriptor Data 2021". 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health. Retrieved 22 April 2021.
  6. ↑ Benjamin A. Pierce (24 December 2004). Control of Gene Expression, In: Genetics Solutions and Problem Solving MegaManual. Macmillan. p. 221. Retrieved 22 April 2021.
  7. ↑ Tania Islas-Flores, Gabriel Guillén, Xóchitl Alvarado-Affantranger, Miguel Lara-Flores, Federico Sánchez, and Marco A. Villanueva (2011). "PvRACK1 Loss-of-Function Impairs Cell Expansion and Morphogenesis in Phaseolus vulgaris L. Root Nodules". Molecular Plant-Microbe Interactions. 24 (7): 819–826. doi:10.1094/MPMI-11-10-0261. Retrieved 25 April 2021.
  8. ↑ Nijhawan A, Jain M, Tyagi AK, Khurana JP (February 2008). "Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice". Plant Physiology. 146 (2): 333–50. doi:10.1104/pp.107.112821. PMID 18065552.
  9. ↑ Randy Foster, Takeshi Izawa and Nam-Hai Chua (1 February 1994). "Plant bZIP proteins gather at ACGT elements". FASEB. 8 (2): 192–200. doi:10.1096/fasebj.8.2.8119490. PMID 8119490. Retrieved 25 June 2021.
  10. ↑ Ganesh M. Nawkar, Chang Ho Kanga, Punyakishore Maibam, Joung Hun Park, Young Jun Jung, Ho Byoung Chae, Yong Hun Chi, In Jung Jung, Woe Yeon Kim, Dae-Jin Yun, and Sang Yeol Lee (21 February 2017). "HY5, a positive regulator of light signaling, negatively controls the unfolded protein response in Arabidopsis" (PDF). Proceedings of the National Academy of Sciences USA. 114 (8): 2084–89. doi:10.1073/pnas.1609844114. Retrieved 24 June 2021.
  11. ↑ RefSeq (January 2016). "MYB MYB proto-oncogene, transcription factor [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 7 February 2021.
  12. ↑ 12.0 12.1 12.2 12.3 Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
  13. ↑ Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman (1 February 1998). "A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p". Nucleic Acids Research. 26 (3): 710–4. doi:10.1093/nar/26.3.710. PMC 147311. PMID 9443961.
  14. ↑ Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.
  15. ↑ Chaudhary J, Skinner MK (1999). "Basic helix-loop-helix proteins can act at the E-box within the serum response element of the c-fos promoter to influence hormone-induced promoter activation in Sertoli cells". Mol. Endocrinol. 13 (5): 774–86. doi:10.1210/mend.13.5.0271. PMID 10319327.
  16. ↑ Nibedita Lenka, Aruna Basu, Jayati Mullick, and Narayan G. Avadhani (22 November 1996). "The role of an E box binding basic helix loop helix protein in the cardiac muscle-specific expression of the rat cytochrome oxidase subunit VIII gene" (PDF). The Journal of Biological Chemistry. 271 (47): 30281–30289. doi:10.1074/jbc.271.47.30281. Retrieved 7 February 2019.
  17. ↑ Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C, Einarsson SO, Valgeirsdottir S, Bergsteinsdottir K, Schepsky A, Dummer R, Steingrimsson E (2008). "Novel MITF targets identified using a two-step DNA microarray strategy". Pigment Cell Melanoma Res. 21 (6): 665–76. doi:10.1111/j.1755-148X.2008.00505.x. PMID 19067971.
  18. ↑ Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
  19. ↑ Xiaomin Zhang, Gohar Azhar, Jeanne Y. Wei (21 December 2017). "SIRT2 gene has a classic SRE element, is a downstream target of serum response factor and is likely activated during serum stimulation". PLOS One. 12 (12): e0190011. doi:10.1371/journal.pone.0190011. Retrieved 23 February 2021.
  20. ↑ Amanda Salviano-Silva, Maria Luiza Petzl-Erler & Angelica Beate Winter Boldt (29 April 2017). "CD59 polymorphisms are associated with gene expression and different sexual susceptibility to pemphigus foliaceus". Autoimmunity. 50 (6): 377–385. doi:10.1080/08916934.2017.1329830. Retrieved 27 September 2021.
  21. ↑ Svoboda, P., & Cara, A. (2006). Hairpin RNA: A secondary structure of primary importance. Cellular and Molecular Life Sciences, 63(7), 901-908.
  22. ↑ Meyer, Michelle; Deiorio-Haggar K; Anthony J (July 2013). "RNA structures regulating ribosomal protein biosynthesis in bacilli". RNA Biology. 7. 10: 1160–1164. doi:10.4161/rna.24151. PMID 23611891.
  23. ↑ Malys N, Nivinskas R (2009). "Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction". Mol Microbiol. 73 (6): 1115–1127. doi:10.1111/j.1365-2958.2009.06840.x. PMID 19708923.
  24. ↑ Malys N, McCarthy JEG (2010). "Translation initiation: variations in the mechanism can be anticipated". Cellular and Molecular Life Sciences. 68 (6): 991–1003. doi:10.1007/s00018-010-0588-z. PMID 21076851.
  25. ↑ Pabo CO, Peisach E, Grant RA (2001). "Design and selection of novel Cys2His2 zinc finger proteins". Annual Review of Biochemistry. 70: 313–40. doi:10.1146/annurev.biochem.70.1.313. PMID 11395410.
  26. ↑ NCBI (9 March 2021). "AP-1 transcription factor network". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 26 October 2021.
  27. ↑ Toshifumi Nagata, Aeni Hosaka-Sasaki and Shoshi Kikuchi (2016). Daniel H. Gonzalez, ed. The Evolutionary Diversification of Genes that Encode Transcription Factor Proteins in Plants, In: Plant Transcription Factors Evolutionary, Structural and Functional Aspects. Academic Press. pp. 73–97. doi:10.1016/B978-0-12-800854-6.00005-1. ISBN 978-0-12-800854-6. Retrieved 28 November 2021.
  28. ↑ Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti, Susana Correa-Garcia (1 November 2017). "Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor LEU3" (PDF). Microbiology. doi:10.1099/mic.0.000560. Retrieved 21 February 2021.
  29. ↑ James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins (January 1999). "A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End" (PDF). Molecular and Cellular Biology. 19 (1): 567–576. Retrieved 5 November 2018.
  30. ↑ IUCN SSC Amphibian Specialist Group (2019). "Geotrypetes seraphini". 2019: e.T59557A16957715. doi:10.2305/IUCN.UK.2019-1.RLTS.T59557A16957715.en. Retrieved 16 November 2021.
  31. ↑ 31.0 31.1 HGNC (13 March 2020). "ZSCAN22 zinc finger and SCAN domain containing 22 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
  32. ↑ 32.0 32.1 RefSeq (10 September 2009). "MIR6806 microRNA 6806 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
  33. ↑ Jag123 (7 March 2005). "antigen". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
  34. ↑ SemperBlotto (21 April 2008). "immunogen". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 8 March 2020.
  35. ↑ 35.0 35.1 35.2 C. Michael Gibson (27 April 2008). "Antigen". Boston, Massachusetts: WikiDoc Foundation. Retrieved 8 March 2020.
  36. ↑ Williamsayers79 (26 February 2007). "antibody". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
  37. ↑ Jag123 (7 March 2005). "antibody". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
  38. ↑ Eleonora Market, F. Nina Papavasiliou (2003). "V(D)J Recombination and the Evolution of the Adaptive Immune System". PLoS Biology. 1 (1): e16. doi:10.1371/journal.pbio.0000016.
  39. ↑ Charles A Janeway, Jr, Paul Travers, Mark Walport, and Mark J Shlomchik (2001). Immunobiolog (5th ed. ed.). Garland Publishing. ISBN 0-8153-3642-X.
  40. ↑ SemperBlotto (25 February 2006). "immunoglobulin". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
  41. ↑ SemperBlotto (28 April 2008). "immunoglobulin". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
  42. ↑ 42.0 42.1 42.2 42.3 RefSeq (10 December 2019). "A1BG alpha-1-B glycoprotein [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
  43. ↑ Mei Tian, Ya-Zhou Cui, Guan-Hua Song, Mei-Juan Zong, Xiao-Yan Zhou, Yu Chen, Jin-Xiang Han (2008). "Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients". BMC Cancer. 8: 241. doi:10.1186/1471-2407-8-241. PMC 2528014. PMID 18706098.
  44. ↑ 44.0 44.1 44.2 44.3 44.4 44.5 44.6 Noriaki Ishioka, Nobuhiro Takahashi, and Frank W. Putnam (April 1986). "Amino acid sequence of human plasma 𝛂1B-glycoprotein: Homology to the immunoglobulin supergene family" (PDF). Proceedings of the National Academy of Sciences USA. 83 (8): 2363–7. doi:10.1073/pnas.83.8.2363. PMID 3458201. Retrieved 9 March 2020.
  45. ↑ 45.0 45.1 Katrina M. Morris, Denis O’Meally, Thiri Zaw, Xiaomin Song, Amber Gillett, Mark P. Molloy, Adam Polkinghorne, and Katherine Belova (7 October 2016). "Characterisation of the immune compounds in koala milk using a combined transcriptomic and proteomic approach". Scientific Reports. 6: 35011. doi:10.1038/srep35011. PMID 27713568. Retrieved 14 March 2020.
  46. ↑ R. J. Paxton, G. Mooser, H. Pande, T. D. Lee, and J. E. Shively (1 February 1987). "Sequence analysis of carcinoembryonic antigen: identification of glycosylation sites and homology with the immunoglobulin supergene family" (PDF). Proceedings of the National Academy of Sciences USA. 84 (4): 920–924. doi:10.1073/pnas.84.4.920. PMID 3469650. Retrieved 26 March 2020.
  47. ↑ NCBI (2 February 2016). "Conserved Protein Domain Family cl11960: Ig Superfamily". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 22 May 2020.
  48. ↑ NCBI (5 August 2015). "Conserved Protein Domain Family pfam13895: Ig_2". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
  49. ↑ NCBI (16 August 2016). "Conserved Protein Domain Family cd05751: Ig1_LILR_KIR_like". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
  50. ↑ NCBI (16 January 2013). "Conserved Protein Domain Family smart00410: IG_like". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
  51. ↑ 24.98.118.180 (28 February 2007). "species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  52. ↑ 52.0 52.1 Peter coxhead (22 August 2018). "Species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  53. ↑ Chiswick Chap (1 December 2016). "Species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  54. ↑ 54.0 54.1 54.2 54.3 "AceView: A1BG". Retrieved May 11, 2013.
  55. ↑ Pdeitiker (26 July 2008). "variant". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  56. ↑ SemperBlotto (6 January 2007). "isoform". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2 December 2018.
  57. ↑ 72.178.245.181 (30 November 2008). "isoform". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2 December 2018.
  58. ↑ H Eiberg, ML Bisgaard, J Mohr (1 December 1989). "Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG". Clinical genetics. 36 (6): 415–8. PMID 2591067. Retrieved 2017-10-08.
  59. ↑ John R. Stehle Jr., Mark E. Weeks, Kai Lin, Mark C. Willingham, Amy M. Hicks, John F. Timms, Zheng Cui (January 2007). "Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice". Biochimica et Biophysica Acta (BBA) - General Subjects. 1770 (1): 79–86. doi:10.1016/j.bbagen.2006.06.020. PMID 16945486. Retrieved 2017-10-08.
  60. ↑ 60.0 60.1 60.2 60.3 60.4 Caitrin W. McDonough, Yan Gong, Sandosh Padmanabhan, Ben Burkley, Taimour Y. Langaee, Olle Melander, Carl J. Pepine, Anna F. Dominiczak, Rhonda M. Cooper-DeHoff, and Julie A. Johnson (June 2013). "Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes" (PDF). Hypertension. 62 (1): 48–54. doi:10.1161/HYPERTENSIONAHA.111.00823. PMID 23690342. Retrieved 2017-10-08.
  61. ↑ DTLHS (10 January 2018). "genotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  62. ↑ SemperBlotto (22 October 2005). "genotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  63. ↑ Widsith (28 March 2012). "polymorphism". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  64. ↑ 217.105.66.98 (8 September 2016). "allele". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  65. ↑ 138.130.33.215 (7 April 2004). "allele". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
  66. ↑ 66.0 66.1 B. Gahne, R. K. Juneja, and A. Stratil (June 1987). "Genetic polymorphism of human plasma alpha 1B-glycoprotein: phenotyping by immunoblotting or by a simple method of 2-D electrophoresis". Human Genetics. 76 (2): 111–5. doi:10.1007/bf00284904. PMID 3610142. Retrieved 25 March 2020.
  67. ↑ R.K. Juneja, G. Beckman, M. Lukka, B. Gahne, and C. Ehnholm (1989). "Plasma α1B-Glycoprotein Allele Frequencies in Finns and Swedish Lapps: Evidence for a New α1B Allele". Human Heredity. 39 (1): 32–36. doi:10.1159/000153828. PMID 2759622. Retrieved 25 March 2020.
  68. ↑ 68.0 68.1 R.K. Juneja, N. Saha, B. Gahne and J.S.H. Tay (1989). "Distribution of Plasma Alpha-1-B-Glycoprotein Phenotypes in Several Mongoloid Populations of East Asia". Human Heredity. 39: 218–222. doi:10.1159/000153863. PMID 2583734. Retrieved 25 March 2020.
  69. ↑ 24.235.196.118 (23 September 2007). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.
  70. ↑ SemperBlotto (14 February 2005). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.
  71. ↑ N2e (3 July 2008). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.
  72. ↑ Mardiaty Iryani Abdullah, Ching Chin Lee, Sarni Mat Junit, Khoon Leong Ng, and Onn Haji Hashim (13 September 2016). "Tissue and serum samples of patients with papillary thyroid cancer with and without benign background demonstrate different altered expression of proteins". Peer J. 4: e2450. doi:10.7717/peerj.2450. PMID 27672505. Retrieved 15 March 2020.
  73. ↑ 73.0 73.1 73.2 73.3 Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (12 October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460. Retrieved 2011-11-28.
  74. ↑ "The Opossum: Our Marvelous Marsupial, The Social Loner". Wildlife Rescue League.
  75. ↑ Journal Of Venomous Animals And Toxins – Anti-Lethal Factor From Opossum Serum Is A Potent Antidote For Animal, Plant And Bacterial Toxins. Retrieved 2009-12-29.
  76. ↑ 76.0 76.1 B Haendler, J Krätzschmar, F Theuring and W D Schleuning (July 1993). "Transcripts for cysteine-rich secretory protein-1 (CRISP-1; DE/AEG) and the novel related CRISP-3 are expressed under androgen control in the mouse salivary gland". Endocrinology. 133 (1): 192–8. doi:10.1210/en.133.1.192. PMID 8319566. Retrieved 2012-02-20.
  77. ↑ 77.0 77.1 HGNC (10 December 2019). "A1BG-AS1 A1BG antisense RNA 1 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
  78. ↑ 78.0 78.1 78.2 78.3 Jigang Bai, Bowen Yao, Liang Wang, Liankang Sun, Tianxiang Chen, Runkun Liu, Guozhi Yin, Qiuran Xu, Wei Yang (June 2019). "lncRNA A1BG-AS1 suppresses proliferation and invasion of hepatocellular carcinoma cells by targeting miR-216a-5p". 120 (6): 10310–10322. doi:10.1002/jcb.28315. PMID 30556161. Retrieved 16 May 2023.
  79. ↑ 79.0 79.1 79.2 79.3 HGNC (10 December 2019). "ZNF497 zinc finger protein 497 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
  80. ↑ 80.0 80.1 HGNC (10 December 2019). "LOC100419840 zinc finger protein 446 pseudogene [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
  81. ↑ 81.0 81.1 HGNC (10 December 2019). "LOC105372483 uncharacterized LOC105372483 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
  82. ↑ 82.0 82.1 HGNC (10 December 2019). "RNA5SP473 RNA, 5S ribosomal pseudogene 473 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
  83. ↑ Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (2007). "Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters". Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMID 17123746. Unknown parameter |month= ignored (help)
  84. ↑ Saxonov S, Berg P, Brutlag DL (2006). "A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters". Proc Natl Acad Sci USA. 103 (5): 1412–1417. doi:10.1073/pnas.0510310103. PMC 1345710. PMID 16432200.
  85. ↑ 85.0 85.1 85.2 85.3 85.4 85.5 85.6 85.7 85.8 85.9 Sergey V Guselnikov and Alexander V Taranin (1 June 2019). "Unraveling the LRC Evolution in Mammals: IGSF1 and A1BG Provide the Keys". Genome Biology and Evolution. 11 (6): 1586–1601. doi:10.1093/gbe/evz102. PMID 31106814. |access-date= requires |url= (help)

External links

{{Phosphate biochemistry}}


Retrieved from "https://www.wikidoc.org/index.php?title=Complex_locus_A1BG_and_ZNF497&oldid=1734221"