Complex locus A1BG and ZNF497: Difference between revisions
m (→C-boxes) |
m (→G-boxes) |
||
Line 406: | Line 406: | ||
|accessdate=26 March 2019 }}</ref> For the C-box of Song, eight of the ten random datasets gave at least one result, one gave two sequences in the UTR vs. one in the UTR for the real promoters, none occurred in the core promoter vs. one for the positive direction in the core promoter, the real promoter in the positive direction had eight sequences vs. four in the negative and three in the positive for the randoms. | |accessdate=26 March 2019 }}</ref> For the C-box of Song, eight of the ten random datasets gave at least one result, one gave two sequences in the UTR vs. one in the UTR for the real promoters, none occurred in the core promoter vs. one for the positive direction in the core promoter, the real promoter in the positive direction had eight sequences vs. four in the negative and three in the positive for the randoms. | ||
# hybrids described by Song<ref name=Song/> (C/A-box TGACGTAT have none in either real promoter, C/G-box TGACGTGT positive direction at 3962, C/T-box TGACGTTA none). The random datasets have two sequences out of twenty, both inverse complements for the hybrid C/A box. For the C/G box hydrid, there was one random sequence in the negative direction in the distal promoter TGACGTGT at 915 whereas in the reals it was an inverse complement in the positive direction ACACGTCA at 3962. For the C/T box hybrids, there were two inverse complements in the distal promoter for the arbitrary negative direction: TAACGTCA at 2405 and TAACGTCA at 1638. The differences indicate the one real C/G box is likely real and active. | # hybrids described by Song<ref name=Song/> (C/A-box TGACGTAT have none in either real promoter, C/G-box TGACGTGT positive direction at 3962, C/T-box TGACGTTA none). The random datasets have two sequences out of twenty, both inverse complements for the hybrid C/A box. For the C/G box hydrid, there was one random sequence in the negative direction in the distal promoter TGACGTGT at 915 whereas in the reals it was an inverse complement in the positive direction ACACGTCA at 3962. For the C/T box hybrids, there were two inverse complements in the distal promoter for the arbitrary negative direction: TAACGTCA at 2405 and TAACGTCA at 1638. The differences indicate the one real C/G box is likely real and active. | ||
====Gal4 transcription factors==== | |||
{{main|Gal4p gene transcriptions}} | |||
====G-boxes==== | ====G-boxes==== |
Revision as of 01:05, 22 August 2021
Associate Editor(s)-in-Chief: Henry A. Hoff
Alpha-1-B glycoprotein is a 54.3 kDa protein in humans that is encoded by the A1BG gene.[1] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins.
A1BG was located on the DNA strand of chromosome 19.[2] Additionally, A1BG, in current nucleotide numbering (58,345,183-58,353,492), is located adjacent to the ZSCAN22 gene (58,326,994-58,342,332) on the positive DNA strand, as well as the ZNF837 (58,367,623 - 58,381,030, complement) and ZNF497 (58,354,357 - 58,362,751, complement) genes on the negative strand.[2] In the current nucleotide numbering, the A1BG untranslated region (UTR) has been expanded so that with ZSCAN22 ending at 58,342,332, the nucleotides used in this study are 58,342,347 to 58,346,897 on both strands, with the current UTR for A1BG beginning at 58,345,183.
Introduction
"Many important disease-related pathways utilize transcription factors that specifically bind DNA (e.g., c-Myc, HIF-1, TCF1, p53) as key nodes or endpoints in complex signaling networks. In such cases the transcription factor itself is often the most attractive target. However, drugging transcription factors is challenging owing to an absence of small ligand binding sites in their DNA-binding domain and the presence of a highly charged DNA-binding surface [1]."[3]
If a specific gene appears to be involved in a disease-related or deleterious pathway being able to alter its expression so as to improve the person's health may be needed. To alter its expression constructively may require knowing what regulatory elements exist in the gene's nearby promoters.
Response elements
Identifying a bona fide response element is more difficult than a simple inspection. In order to attribute the response element to a candidate sequence, some observations have to be conducted using molecular, biological and biophysical methods and functional approaches. Findings may indicate that response element in the promoter is a functional element.[4]
A likely response element found by simple inspection may also be inactive due to methylation.
Response Elements: "Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions."[5]
"Under conditions of stress, a transcription activator protein binds to the response element and stimulates transcription. If the same response element sequence is located in the control regions of different genes, then these genes will be activated by the same stimuli, thus producing a coordinated response."[6]
WD-40 repeat family
"Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During Phaseolus vulgaris root development, RACK1 (PvRACK1) mRNA expression was induced by auxins, abscissic acid, cytokinin, and gibberellic acid."[7]
Abscissic acid (ABA) response elements
In A1BG response element positive results, abscissic acid (ABA) response elements (ABREs) have been identified for example in the UTR for A1BG between ZSCAN22 and A1BG. If these response elements are active then A1BG can be transcribed as a key cis-regulatory element in ABA signaling. "However, for ABA responsive transcription to occur, a single copy of the ABRE is not sufficient. In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996). It was also shown that a pair of ABREs can function as an ABRC with the second ABRE playing the role of the coupling element in rice (Hobo et al. 1999), barley (Shen et al. 1996) and Arabidopsis (Nakashima et al. 2006). Coupling of two CE3s is much less active in conferring ABA response to the minimal promoter (Shen et al. 2004). Interestingly, CE3 appears to be specific to monocots. In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."[8]
No coupling elements occur in the negative direction between ZSCAN22 and A1BG. Two ABREs occur in both directions suggesting pairs may be available to function as an ABRC on either side of A1BG, subject to needed proximity.
No DRE (TACCGACAT) occurs in either direction of A1BG.
Auxin response factors
In A1BG response element positive results, auxin response factors (ARFs) have been identified in the UTR for A1BG between ZSCAN22 and A1BG and between ZNF497 and A1BG. ARF5s occur in this side's core promoter or proximal promoter. If these response elements are active then A1BG can be transcribed as a regulatory element in auxin signaling. The "genome binding of two ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferred ARF binding site (ARFbs) arrangements (orientation and spacing)."[9]
The position weight matrices (PWMs) used to model ARF DNA binding specificity suggest more general consensus sequences may be (C/G/T)N(G/T)G(C/T)(C/T), where ARF2 is (C/G/T)(A/C/T)(G/T)G(C/T)(C/T)(G/T)(C/G)(A/C/T)(A/G/T) and ARF5/MP is (C/G/T)N(G/T)GTC(G/T).[9] The likely consensus sequence for ARF2 would allow 2592 possible response elements, and that for ARF5/MP would be 48.
Ulmasov ARFbs
"ARFbs were originally defined as TGTCTC (Ulmasov et al., 1995, Guilfoyle et al., 1998), [...]."[9]
The consensus sequence found by Ulmasov (1995) TGTCTC occurs in the negative direction for the UTR (four), proximal promoter (one) and distal promoter (twelve) and in the positive direction only in the distal promoter (ten). But, the random datasets had only one on average in the distal promoter for either direction and only 0.2 in the UTR and none in the proximal promoter. This suggests that the occurrences of the consensus sequences of Ulmasov in the promoters of A1BG are real and likely active or activatable.
Boer ARFbs
"More recently, protein binding microarray (PBM) experiments suggested that TGTCGG are preferred ARFbs, [...] (Boer et al., 2014, Franco-Zorrilla et al., 2014, Liao et al., 2015)."[9]
The consensus sequence of Boer 2014 TGTCGG occurs only once in the UTR in the negative direction and seven times in the positive direction in the distal promoters. The random datasets had about one per dataset in the UTR. The random occurrences of one to three times in the distal promoters for each of ten data sets. While the occurrence in the UTR about matches a random occurrence, the occurrences in the distal promoters are more frequent in the real promoters vs. the random datasets.
Stigliani ARF2s
Random sampling (even numbered datasets for ZSCAN22 to A1BG) for UTRs range from two to eight ARFs whereas the two strands have 6 (negative strand) and 12, respectively, in the negative direction. The negative strand, negative direction results (6) for A1BG fall within the range of random results by number of results, whereas the results for the positive strand, negative direction (12) are well outside the number of random results, suggesting they are real. None of the actual nucleotide sequences for either strand, negative direction match any of the random results.
For ARF core promoters, four of the ten random nucleotide sequences have core promoters, ranging from one to two, correspond (odd numbered random sequences for positive direction, ZNF497 to A1BG) only and none match the nucleotide sequence for the real, negative strand, positive direction.
Only three of the ten random datasets had results for the proximal promoters, only one result each, in the negative direction and none matched the real result. The positive direction random datasets had results in seven ranging from one to four with no nucleotide sequence matches.
The nucleotide sequences for the distal promoters do not match: the random data sets range from (2 to 9) in number and (5 to 14) but the real sets range from (14 to 38) and (15 to 51), respectively. The real occurrences way outnumber the random results.
The results in the promoters of A1BG have about 100 unique nucleotide sequences (Stigliani et al) of the total possible 2592 such sequences per the PMWs assuming a weight of one. The actual weighting is expected to reduce the number of likely sequences resulting in few duplicates between sequences found to occur and those found in the random data sets. Common to both results are only six nucleotide sequences.
Stigliani ARF5s
The varieties of the short consensus sequence for ARF5/MP (C/G/T)N(G/T)GTC(G/T) have been detected in the UTR (25), proximal (3) and distal (49) promoters for A1BG between ZSCAN22 and the A1BG gene and the core (5), proximal (1) and distal (84) promoters for A1BG on the ZNF497 side.
Random datasets arbitrarily chosen to represent the negative direction (even numbered datasets) and positive direction (odd numbered datasets) have only from one to five for the consensus sequence UTRs and two to nine for the inverse complement sequences. Regarding core promoters, two random datasets had one or two inverse complement nucleotide sequences on the even numbered sites, whereas the positive direction random datasets had two datasets with one and three nucleotide sequences. Random datasets had proximal promoters only on the positive side (one to two). Distal promoter sequences for the negative direction had from two to nine nucleotide sequences. For the positive direction, the consensus sequences ranged from eight to fifteen.
Starting with the random occurrences among the ARF5 possibilities 68 have duplicates among the random or real datasets. These same duplicates only occur 78 % of the time among the real datasets.
Using the real consensus sequences to look for duplicates first among the other reals then among the randoms found 97 % had duplicates among either the other reals or among the randoms.
The possible variety of ARF5s within the consensus sequences (C/G/T)N(G/T)GTC(G/T): 3*4*2*1*1*1*2 = 48 plus complement inverses (A/C)GAC(A/C)N(A/C/G): 2*1*1*1*2*4*3 = 48 with duplicates, 96 minus duplicates of some 18 suggests that up to 78 could occur if sampling were large enough.
That the randoms and real occurrences do not match up suggests that the reals are not randomly occurring.
Cytokinins
In A1BG response element positive results, several of the cytokinin response regulators: ARR10s, ARR12s, and those of Rashotte et al. (2003) have occurrences in the UTR of A1BG from the ZSCAN22 side and in the proximal promoters of A1BG from the ZNF497 side.
Any of the randomly generated nucleotide data sets (0 through 9) can be used to represent any of the real data for the response element of interest.
Every response element ARR1 has 6 in the distal promoter (2 negative direction and 4 positive direction). Random samplings ranges from 0-3. For the proximal promoter there is one for two datasets out of 20. No random in the core promoter. And, four for two datasets in the UTR out of 20.
ARR10 has only one element in the negative direction in the UTR. Four of the 10 random datasets had 1.25 response elements in the UTR. No sequences in the core promoters, but one sequence in the proximal promoter and many in the distal promoters. The only response element in the A1BG promoters is an inverse complement and five of the six random UTR response elements are inverse complements.
For ARR12, the random samples have about 2.5 UTR elements, but ARR12 has only one in the UTR. The A1BG has no core promoters on either side but one random sample out of ten has one on the positive direction from ZNF497. The ARR12 in A1BG proximal promoters have none while two out of ten random datasets have one each. In the distal promoters the negative directions averaged four while the random datasets average 1.3. The positive direction has only one and the random datasets averaged 1.3.
The Rashotte1 ARR (ARRR1) results differ from random datasets: one in the UTR on the ZSCAN22 side versus two (random). No core promoter elements versus one in two of ten (random). Three proximal promoters versus none (random). Distal promoters: one in the negative direction and three in the positive and one to three (random).
For (G/A)GAT(T/C) in ARRR2 (Rashotte2) UTRs, there are none for the negative strand, negative direction, but each random data set finds 2-8. For the positive strand, negative direction, there are seven versus 2-8 from the randomly generated nucleotide data sets (0 through 9).
For (A/G)ATC(C/T) in ARRR2 (Rashotte2) UTRs, all four of the negative strand, negative direction results are inverse complements, where the random data sets have (4-9). For the positive strand, negative direction there are eleven, but the random datasets have 2-9.
Neither direction for ARRR2 (Rashotte2) has core promoter elements, while the random results have an average of (1 per data set, 0-1, negative direction, 0-3, positive direction).
For the negative direction and the proximal promoter, ARRR2 (Rashotte2) produced only one. And, the random datasets have an average of (1 per data set, 0-4).
The positive direction, ARRR2 (Rashotte2) has six. The random datasets have about 1 per dataset (0-3).
The distal promoters, negative direction, ARRR2 (Rashotte2) has 37 and the positive direction 25. The random datasets cover 8-20.
Ethylene response factors
Two ethylene response factors or ethylene responsive elements occur in the promoters of A1BG: positive strand, negative direction: ATTTCAAA at 1383 and negative strand, positive direction: ATTTCAAA at 2648. Both of these occur in the distal promoters on either side of A1BG. Sampling of ten random datasets looking for the ERE and its inverse complement found only one: ATTTCAAA at 934. Half way between ZSCAN22 and A1BG is about 2300 nucleotides and between ZNF497 and A1BG is about 2200. One is closer to ZSCAN22 and the other is closer to A1BG. The random occurrence is closer to the zinc finger than A1BG. The response element closer to A1BG is likely real even if inactive. As the real occurrences are more frequent and nearer mid points than the random result, it is likely that the EREs are not random but real and perhaps active.
Gibberellic acid response elements
The TAACAAA box (GARE) has an inverse complement TTTGTTA at 230 nucleotides from ZSCAN22 toward A1BG. This is in the distal promoter for A1BG or is a response element for ZSCAN22 rather than A1BG. The GARE-like 1 TTAACA(A/G)A occurs as an inverse complement TTTGTTA at 230 nucleotides from the gene end of ZSCAN22 and may be a response element for ZSCAN22.
Random datasets have been sampled using TAAC(A/G)(A/G/T)A as a general form to test for GARE-like 2 (TAACGTA), GARE-like 1 (TAACA(A/G)A) and GARE (TAACAAA). Occurrences of TAACGGA, TAACGAA, and TAACATA have been listed but disallowed from analysis. The same has been done for the inverse complement T(A/C/T)(C/T)GTTA with disallowing TCCGTTA, TTCGTTA, and TATGTTA.
Half of the random datasets (10 for TAAC(A/G)(A/G/T)A) and (10 for T(A/C/T)(C/T)GTTA) produced no results. Individual occurrences of TAACAAA at 3592, TAACAAA at 1376, TAACAGA at 1059, TAACAAA at 961, or TAACGTA at 932 were recorded. For the inverse complements: TACGTTA at 3929, TCTGTTA at 3622, TACGTTA at 3228, TTTGTTA at 3209, TTTGTTA at 1168, TTTGTTA at 453 were recorded. One dataset produced three inverse complements: TACGTTA at 3929, TACGTTA at 3228, TTTGTTA at 1168. All occurrences were in the A1BG negative direction UTR or distal promoters in both directions. None were even close to the real occurrences. This suggests that the few real occurrences were not random.
Hypoxia response elements
A1BG has hypoxia response elements that are distal on both sides. The closest ones are in the UTR for A1BG on the positive strand in the negative direction: CACGC at 3280, GCGTG at 3046. Random datasets have almost identical results and core and proximal promoters not in the same datasets. Real sides of A1BG have many more elements in the distal promoters than the random datasets.
General Regulatory Factors
"General regulatory factors (GRFs), such as Reb1, Abf1, Rap1, Mcm1, and Cbf1, positionally organize yeast chromatin through interactions with a core consensus DNA sequence."[10]
"Ribosome biogenesis in Saccharomyces cerevisiae involves a regulon of >200 genes (Ribi genes) coordinately regulated in response to nutrient availability and cellular growth rate. Two cis-acting elements called PAC and RRPE are known to mediate Ribi gene repression in response to nutritional downshift. [Most] Ribi gene promoters also contain binding sites for one or more General Regulatory Factors (GRFs), most frequently Abf1 and Reb1, and that these factors are enriched in vivo at Ribi promoters. Abf1/Reb1/Tbf1 promoter association was required for full Ribi gene expression in rich medium and for its modulation in response to glucose starvation, characterized by a rapid drop followed by slow recovery. Such a response did not entail changes in Abf1 occupancy, but it was paralleled by a quick increase, followed by slow decrease, in Rpd3L histone deacetylase occupancy. [...] Abf1 site disruption also abolished Rpd3L complex recruitment in response to starvation. Extensive mutational analysis of the DBP7 promoter revealed a complex interplay of Tbf1 sites, PAC and RRPE in the transcriptional regulation of this Ribi gene. [...] GRFs [are] multifaceted players in Ribi gene regulation both during exponential growth and under repressive conditions."[11]
Abf1 regulatory factors
The general consensus sequence for Abf1 CGTNNNNN(A/G)(C/T)GA(C/T) occurs on both sides of A1BG but only in the distal promoters. Random datasets, even numbered assigned to the negative direction and odd numbered assigned to the positive direction yielded a sequence in the UTR, core promoter and distal promoter for the negative direction and a sequence in the distal promoter for the positive direction. The real consensus sequence yielded only three results: one in the negative direction and two in the positive, all in the distal promoters. The random sequences (four total) occurred in the UTR, proximal promoter and distal promoter for the negative direction and one in the distal promoter for the positive direction. While the differences between real and random are small (three vs. four), (all distal vs. UTR, proximal and two distal), they are likely significant as the random datasets (10) should have encompassed the real (2, each side of A1BG) but this did not occur.
Cbf1 regulatory factors
Consensus sequence TCACGTGA[10] did not have any real or random results.
Mcm1 regulatory factors
Neither TT(A/T)CCNN(A/T)TNGG(A/T)AA nor TTNCCNNNTNNGGNAA produced any real or random results.
Rap1 regulatory factors
When the Rap1 motif was held constant to ACCCRNRCA[10], no real results occurred. However, using the ten random datasets for testing ACCCRNRCA and its inverse complement yielded five consensus sequence results and four inverse complements. Two were in the UTR of A1BG from the negative direction. One was in the proximal promoter from the positive direction, and the remaining five were in the distal promoters.
The reduced consensus (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C)[10] had one result GAACCCACACCTC in the positive direction at 1807, less than half way from ZNF497. Of ten random datasets only one had a result: GCACCCGGGCATC at 1454. Also, for the inverse complement, there was only one TATGCCTGGGTTT at 1380. In both the real sequences and random sequences, each was in the distal promoter closer to the zinc finger than A1BG. The occurrence of one random result per ten datasets suggests that such a result is rarely random. While the real occurrence is likely active as a regulatory response.
The full consensus sequence C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T)[10] gave four to six results in the UTR negative direction, one in the core promoter in the positive direction, two in the proximal promoter in the negative direction and one in the positive direction. In the distal promoter each direction had eight to nine results.
For the random data sets: UTR ranged from zero to four in the UTR, core promoter produced only zero to one, proximal promoter produced zero to one, and the distal promoter contained one to seven for either direction.
Comparing the two, the real UTR, proximal promoter, and distal promoter usually exceeded the random results. This suggests that some of the real results could just be due to random associations of nucleotides, but the rest are likely real.
Reb1 regulatory factors
Reb1 consensus sequences TTACCC(G/T) have three occurrences in A1BG: UTR at 3661 and two distal promoters at 3170 and 2912 in the positive direction all more than half way from either Zn finger.
Using the random datasets: there are three sequences in two datasets within the UTR: TTACCCG at 4135 and CGGGTAA at 3979, with AGGGTAA at 3112; the core promoters contained only TTACCCG at 4416 in the positive direction; the proximal promoters contained only TTACCCT at 4250 in the positive direction; and the distal promoters contained four to five sequences: five in the negative direction all more than half way to ZSCAN22 and four in the positive direction: one TTACCCG at 2965 more than halfway toward A1BG and the remaining three less than halfway.
The extended Reb1 consensus sequence ATTACCCGAA had no locations in either direction or in random datasets for either the extended consensus sequence or its inverse complement.
Tbf1 regulatory factors
The usual consensus sequence for Tbf1 ARCCCTAA[11] occurs three times around A1BG: once in the negative direction within the UTR: the inverse complement TTAGGGTT at 3978 and twice in the positive direction: negative strand TTAGGGCT at 2768 and positive strand AACCCTAA at 2545. Both are closer to A1BG than either zinc finger.
In the random datasets, only the inverse complements occur in one data set: TTAGGGCT at 3616, TTAGGGTT at 198 representing the positive direction, distal promoter. The second is less than halfway from ZNF497.
Basic leucine zipper class response elements
"Most bZIP proteins show high binding affinity for the ACGT motifs, which include CACGTG (G box), GACGTC (C box), TACGTA (A box), AACGTT (T box), and a GCN4 motif, namely TGA(G/C)TCA (Landschulz et al., 1988; Nijhawan et al., 2008)."[12]
"A majority of the plant bZIP proteins isolated to date recognize elements with an ACGT core (Foster et al., 1994)."[13]
"Most recombinant bZIP proteins can interact with ACGT elements derived from different plant genes, albeit with different affinity. Systematic protein/DNA binding studies have shown that sequences flanking the ACGT core affect bZIP protein binding specificity. These studies have provided the basis for a concise ACGT nomenclature and defined high-affinity A-box, C-box, and G-box elements."[14]
"HY5 binds to the promoter of light-responsive genes featuring "ACGT-containing elements" such as the G-box (CACGTG), C-box (GACGTC), Z-box (ATACGGT), and A-box (TACGTA) (4, 6)."[15]
A-boxes
In the A1BG promoters, the consensus sequence TACGTA occurs in the negative direction UTR at 4246 nucleotides from ZSCAN22 and the positive direction distal promoter at 3071 nucleotides from ZNF497.
For the random datasets, it occurs only in the distal promoters at 398 or 2107 (two out of ten datasets) of the assigned negative direction and at 3126 or 3688 (two out of ten datasets) of the assigned positive direction.
The real promoters have twice as many consensus sequences relative to any random dataset with a result and the real promoters have them located in the UTR or distal promoter instead of just the distal promoter, which suggests they are real rather than random.
Activating transcription factors
C-boxes
C-boxes come in several varieties:
- described by Johnson (GAGGCCATCT, none occur on either side of A1BG),[16] none occurred for GAGGCCATCT in the random datasets or its inverse complement AGATGGCCTC,
- described by Samarsky (AGTAGT, occur on both sides of A1BG),[17] in the negative direction are five in the UTR versus two for the random datasets, neither have sequences in the core promoters, two occurred only in the random datasets in the proximal promoters, and one in each direction in the real distal promoters versus four in each direction in the random datasets,
- described by Voronina (GGTGATG, positive strand, negative direction at 3798).[18] Only four random datasets yielded Voronina C boxes: three in the negative direction by arbitrary choice of evens including one an inverse complement in the UTR CATCACC at 3456. The rest are in the distal promoters where none occurred in the real promoters.
- described by Song (GACGTC, both sides of A1BG),[19] For the C-box of Song, eight of the ten random datasets gave at least one result, one gave two sequences in the UTR vs. one in the UTR for the real promoters, none occurred in the core promoter vs. one for the positive direction in the core promoter, the real promoter in the positive direction had eight sequences vs. four in the negative and three in the positive for the randoms.
- hybrids described by Song[19] (C/A-box TGACGTAT have none in either real promoter, C/G-box TGACGTGT positive direction at 3962, C/T-box TGACGTTA none). The random datasets have two sequences out of twenty, both inverse complements for the hybrid C/A box. For the C/G box hydrid, there was one random sequence in the negative direction in the distal promoter TGACGTGT at 915 whereas in the reals it was an inverse complement in the positive direction ACACGTCA at 3962. For the C/T box hybrids, there were two inverse complements in the distal promoter for the arbitrary negative direction: TAACGTCA at 2405 and TAACGTCA at 1638. The differences indicate the one real C/G box is likely real and active.
Gal4 transcription factors
G-boxes
There are at least two G-boxes: that of Oeda[20] (GCCACGTGGC, none found) and that of Loake[21] (CACGTG, positive direction only: negative strand at 570 and positive strand at 3884, at 2961, at 1219, and at 547). The G-box of Loake is the same as the abscisic acid-responsive element.[22] The random datasets have the even numbered sets arbitrarily assigned to the negative direction. Had they been assigned to the positive direction they additively appear similar to the Loake G-boxes found on the ZNF497 side promoter of A1BG. But, at most only two occur in any dataset. This suggests that those consensus sequences found in the positive direction are real and likely active.
Binding "activity to the G-box of the light-responsive unit 1 (U1) region of the parsley (Petroselinum crispum) CHS promoter (CHS-U1: TCCACGTGGC; Schulze-Lefert et al., 1989) or the G-box of GmAux28 (TCCACGTGTC) was much weaker than to the PA G-box [...]."[19]
(G/T)CCACGTG(G/T)C combines the PA G-box (GCCACGTGGC)[19] with the G-box of GmAux28 (TCCACGTGTC) for testing both. No examples of either the PA G-box or the G-box of GmAux28 were found in either promoter of A1BG. The random datasets had one occurrence on the designated negative direction TCCACGTGTC at 2907.
GCN4 motif
UAS Sequence for the transcription factor Gcn4p is ATGACTCTT.[23]
"The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) [TGA(C/G/T)T(A/C/G)(A/T)] and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters."[24]
"The predicted Gln3p and Gcn4p binding sites in the UGA3 promoter are [...] the consensus Gln3p (GATA) and Gcn4p (GCRE) [TGAGTCA] binding sites present in the minimal UGA3 promoter at -206 and -112, respectively, [...]."[24]
For TGA(C/G/T)T(A/C/G)(A/T) there are three UTRs for each strand, one core promoter for each strand in the positive direction only, one proximal promoter in the negative direction and three in the positive direction, with five distal promoters on the negative direction and seventeen in the positive direction.
The random datasets have thirteen UTRs for ten datasets, three core promoters in the positive direction only for ten datasets, one proximal promoter in the negative direction for ten datasets and seven proximal promoters in the positive direction for ten datasets, and twenty-three distal promoters for ten datasets in the negative direction and twenty-three distal promoters in the positive direction for ten datasets.
T boxes
"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] AACGTT (T box) [...]."[12]
Real promoter sequences on either side of A1BG only have this T box AACGTT at 2691 and 1614 in the positive direction.
Z-boxes
A more general Z-box consensus sequence A(C/T)A(C/G)GT(A/G)T, which includes CAGGTA[25] and ATACGTGT[19], has two occurrences only in the positive direction from ZNF497 of ACAGGTGT at 1969 on the negative strand and ACACGTGT at 2962 on the positive strand.
Helix-turn-helix transcription factors
Gene ID: 4602 is MYB [myeloblastosis] MYB proto-oncogene, transcription factor on 6q23.3: "This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants."[26]
MYB recognition elements
"These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs)."[27]
Basic helix-loop-helix transcription factors
"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."[10]
"Pho4 bound to virtually all E-boxes in vitro (96%) [...]. That was not the case in vivo, where only 5% were bound by Pho4, under activating conditions as determined by ChIP-seq [Zhou and O'Shea 2011]."[10]
"Pho4 possesses the intrinsic ability to bind every E-box, but in vivo is prevented from binding by chromatin unless assisted by chromatin remodelers (Svaren et al. 1994) that are targeted at promoter regions."[10]
"On one end of that spectrum, typical transcription factors like Pho4 do not appear to compete with nucleosomes and instead predominantly sample motifs that already exist in the [nucleosome-free promoter regions] NFRs generated by other factors. In vitro (PB-exo), Pho4 bound nearly every instance of an E-box motif across the yeast genome. However, in vivo, Pho4 is a low-abundance protein that is recruited to the nucleus upon phosphate starvation by other factors, to act at a few dozen genes (Komeili and O'Shea 1999; Zhou and O'Shea 2011). Since Pho4 appears unable to compete with nucleosomes, competent sites that are occluded by nucleosomes are invisible to Pho4."[10]
The Pho4 homodimer binds to DNA sequences containing the bHLH binding site CACGTG.[28]
The upstream activating sequence (UAS) for Pho4p is CAC(A/G)T(T/G) in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].[23]
bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG.[29]
"A computer search for transcription promoter elements [...] showed the presence of a prominent TATA box 22 nucleotides upstream of the transcription start site and an Sp1 site at position -42 to -33. The 5'-flanking sequence also contains three E boxes with CANNTG consensus sequences at positions -464 to -459, -90 to -85, and -52 to -47 that have been marked as E box, E1 box, and E2 box, respectively [...]. In addition, the 5'-flanking region contains one or more GRE, XRE, GATA-1, GCN-4, PEA-3, AP1, and AP2 consensus motifs and also three imperfect CArG sites [...]."[30]
E-boxes
Consensus sequences: CACGTG.
Consensus sequences: CANNTG.
GATAs
Simple GATA responsive element consists of GATA.
"Upstream noncoding regulatory sequences were retrieved and analyzed using Regulatory Sequence Analysis Tools (34). The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters."[24]
Glucocorticoid response elements
"DNA-binding by the GR-DBD has been well-characterized; it is highly sequence-specific, directly recognizing invariant guanine nucleotides of two AGAACA [TGTTCT] half sites called the glucocorticoid response element (GRE), and binds as a dimer in head-to-head orientation with mid-nanomolar affinity (4,12–18). [...] The consensus DNA glucocorticoid response element (GRE) is comprised of two half-sites (AGAACA) separated by a three base-pair spacer (13,15,60,61)."[31]
Pho4
Consensus sequences: CAC(A/G)T(T/G).
Xenobiotic response elements
"The megalin (LRP2) gene promoter region [shows] eight consensus sequence of XRE 5′-GCGTG-3′."[32]
Basic helix-loop-helix leucine zipper transcription factors
Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both Basic helix-loop-helix and leucine zipper motifs.
Examples include Microphthalmia-associated transcription factor and Sterol regulatory element-binding protein (SREBP).
MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes.[33]
Serum response element gene transcriptions: The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[34]
"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)6GG (CArG) motif."[22]
CArG boxes
Consensus sequences: CC(A/T)6GG.
C/EBP boxes
Consensus sequences: CCATAATAGG.
E boxes
Consensus sequences: CATCTG.
Consensus sequences: CAYRTG, CA(C/T)(A/G)TG.
M-boxes
Consensus sequences: TCAYRTG or CAYRTGA, TCA(C/T)(A/G)TG or CA(C/T)(A/G)TGA[33] ~ (T/N)CA(C/T)(A/G)TG(A/N).
The M box consensus sequence GTCATGTGCT[35] does not occur on either side of A1BG. The random datasets had only one occurrence GTCATGTGCT at 1977 in the distal promoter.
Using a more general M-box consensus of (T/N)CA(C/T)(A/G)TG(A/N) yielded four sequences in the negative direction and twelve in the positive direction. Of these only TCACATGA at 325 in the negative direction and TCACATGT at 3957, CCATGTGA at 3903, and CCACATGA at 3708 in the positive direction conform to TCAYRTG or CAYRTGA[33]. The random datasets had 25 occurrences of the general consensus but only fifteen fit TCAYRTG or CAYRTGA[33], nine in the arbitrary negative direction and six in the positive direction. The disparity between real occurrences and random occurrences suggests that the real occurrences are likely active or can be activated.
The M-box with the consensus sequence TCACATGA[36] occurred only once TCACATGA at 325 in the negative direction. There were no occurrences among the random datasets.
M-box consensus sequence is GGTCATGTGCT.[37] This contains the core consensus sequence GTCATGTGCT.[35]
SER elements
Consensus sequences: ACAGGATGT.
ZSCAN22
- Gene ID: 342945 is ZSCAN22 zinc finger and SCAN domain containing 22 on 19q13.43.[38] ZSCAN22 is transcribed in the negative direction from LOC100887072.[38]
- Gene ID: 102465484 is MIR6806 microRNA 6806 on 19q13.43: "microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop."[39] MIR6806 is transcribed in the negative direction from LOC105372480.[39]
Of the some 111 gaps between genes on chromosome locus 19q13.43 as of 4 August 2020, gap number 88 is between ZSCAN22 and A1BG. But, there is no gap between ZNF497 and A1BG.
Promoters
The core promoter begins approximately -35 nts upstream from the transcription start site (TSS). For the numbered nucleotides between ZSCAN22 and A1BG the core promoter extends from 4425 nts up to 4460 nts (TSS). The proximal promoter extends from approximately -250 to the TSS or 4210 nts up to 4460 nts. The distal promoter begins at about 2460 nts and extends to about 4210 nts.
From the ZNF497 side the core promoter begins about 4265 nts up to 4300 nts, the proximal promoter from 4050 nts to 4265 nts, and the distal promoter from 2300 nts to 4050 nts.
Alpha-1-B glycoprotein
Def. "a substance that induces an immune response, usually foreign"[40] is called an antigen.
Def. any "substance that elicits [an] immune response"[41] is called an immunogen.
An antigen "or immunogen is a molecule that sometimes stimulates an immune system response."[42] But, "the immune system does not consist of only antibodies",[42] instead it "encompasses all substances that can be recognized by the adaptive immune system."[42]
Def. "a protein produced by B-lymphocytes that binds to [a specific antigen or][43] an antigen"[44] is called an antibody.
Five different antibody isotypes are known in mammals, which perform different roles, and help direct the appropriate immune response for each different type of foreign object they encounter.[45]
Although the general structure of all antibodies is very similar, a small region, known as the hypervariable region, at the tip of the protein is extremely variable, allowing millions of antibodies with slightly different tip structures to exist, where each of these variants can bind to a different target, known as an antigen.[46]
Def. "any of the glycoproteins in blood serum that respond to invasion by foreign antigens and that protect the host by removing pathogens;"[47] "an antibody"[48] is called an immunoglobulin.
Gene ID: 1 is A1BG alpha-1-B glycoprotein on 19q13.43, a 54.3 kDa protein in humans that is encoded by the A1BG gene.[49] A1BG is transcribed in the positive direction from ZNF497.[49] "The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins."[49]
- NP_570602.2 alpha-1B-glycoprotein precursor, cd05751 Location: 401 → 493 Ig1_LILRB1_like; First immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILR)B1 (also known as LIR-1) and similar proteins, smart00410 Location: 218 → 280 IG_like; Immunoglobulin like, pfam13895 Location: 210 → 301 Ig_2; Immunoglobulin domain and cl11960 Location: 28 → 110 Ig; Immunoglobulin domain.[49]
Patients who have pancreatic ductal adenocarcinoma show an overexpression of A1BG in pancreatic juice.[50]
Immunoglobulin supergene family
"𝛂1B-glycoprotein(𝛂1B) [...] consists of a single polypeptide chain N-linked to four glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂1B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂1B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂1B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."[51]
"Some of the domains of 𝛂1B show significant homology to variable (V) and constant (C) regions of certain immunoglobulins. Likewise, there is statistically significant homology between 𝛂1B and the secretory component (SC) of human IgA (15) and also with the extracellular portion of the rabbit receptor for transepithelial transport of polymeric immunoglobulins (IgA and IgM). Mostov et al. (16) have called the later protein the poly-Ig receptor or poly-IgR and have shown that it is the precursor of SC."[51]
The immunoglobulin supergene family is "the group of proteins that have immunoglobulin-like domains, including histocompatibility antigens, the T-cell antigen receptor, poly-IgR, and other proteins involved in the vertebrate immune response (17)."[51]
"The internal homology in primary structure [...] and the presence of an intrasegment disulfide bond suggest that 𝛂1B is composed of five structural domains that arose by duplication of a primordial gene coding for about 95 amino acid residues."[51]
"Unlike immunoglobulins (25), ceruloplasmin (6), and hemopexin (7), 𝛂1B is not subject to limited interdomain cleavage by proteolytic enzymes. At least, we were not able to produce such fragments by use of a variety of proteases. This stability of 𝛂1B is probably associated with the frequency of proline in the sequences linking the domains [...]."[51]
"A peptide identified in the late and early milk proteomes showed homology to eutherian alpha 1B glycoprotein (A1BG), a plasma protein with unknown function46, as well as venom inhibitors characterised in the Southern opossum Didelphis marsupialis (DM43 and DM4647,48,49), all members of the immunoglobulin superfamily. To characterise the relationship between the peptide sequence identified in koala, A1BG, DM43 and DM46, a phylogenetic tree was constructed [...] including all marsupial and monotreme homologs (identified by BLAST), three phylogenetically representative eutherian sequences, with human IGSF1 and TARM1, related members of the immunoglobulin super family, used as outgroups. This phylogeny indicates that A1BG-like proteins in marsupials and the Didelphis antitoxic proteins are homologs of eutherian A1BG, with excellent bootstrap support (98%). The marsupial A1BG-like sequences and the Didelphis antitoxic proteins formed a single clade with strong bootstrap support (97%)."[52]
"Human TARM1 and IGSF1, related members of the immunoglobulin superfamily are used as outgroups. The tree was constructed using the maximum likelihood approach and the JTT model with bootstrap support values from 500 bootstrap tests. Bootstrap values less than 50% are not displayed. Accession numbers: Tasmanian devil (Sarcophilus harrisii; XP_012402143), Wallaby (Macropus eugenii; FY619507), Possum (Trichosurus vulpecula; DY596639) Virginia opossum (Didelphis virginiana; AAA30970, AAN06914), Southern opossum (Didelphis marsupialis; AAL82794, P82957, AAN64698), Human (Homo sapiens; P04217, B6A8C7, Q8N6C5), Platypus (Ornithorhychus anatinus; ENSOANP00000000762), Cow (Bos taurus; Q2KJF1), Alpaca (Vicugna pacos; XP_015107031)."[52]
"The sequences of 𝛂1B-glycoprotein (38) and chicken N-CAM (neural cell-adhesion molecule) (39) have been shown to be related to the immunoglobulin supergene family."[53]
A1BG contains the immunoglobulin domain: cl11960 and three immunoglobulin-like domains: pfam13895, cd05751 and smart00410.
"Immunoglobulin (Ig) domain [cl11960] found in the Ig superfamily. The Ig superfamily is a heterogenous group of proteins, built on a common fold comprised of a sandwich of two beta sheets. Members of this group are components of immunoglobulin, neuroglia, cell surface glycoproteins, such as, T-cell receptors, CD2, CD4, CD8, and membrane glycoproteins, such as, butyrophilin and chondroitin sulfate proteoglycan core protein. A predominant feature of most Ig domains is a disulfide bridge connecting the two beta-sheets with a tryptophan residue packed against the disulfide bond."[54]
"This domain [pfam13895] contains immunoglobulin-like domains."[55]
"Ig1_LILR_KIR_like: [cd05751] domain similar to the first immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILRs) and Natural killer inhibitory receptors (KIRs). This group includes LILRB1 (or LIR-1), LILRA5 (or LIR9), an activating natural cytotoxicity receptor NKp46, the immune-type receptor glycoprotein VI (GPVI), and the IgA-specific receptor Fc-alphaRI (or CD89). LILRs are a family of immunoreceptors expressed on expressed on T and B cells, on monocytes, dendritic cells, and subgroups of natural killer (NK) cells. The human LILR family contains nine proteins (LILRA1-3,and 5, and LILRB1-5). From functional assays, and as the cytoplasmic domains of various LILRs, for example LILRB1 (LIR-1), LILRB2 (LIR-2), and LILRB3 (LIR-3) contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs) it is thought that LIR proteins are inhibitory receptors. Of the eight LIR family proteins, only LIR-1 (LILRB1), and LIR-2 (LILRB2), show detectable binding to class I MHC molecules; ligands for the other members have yet to be determined. The extracellular portions of the different LIR proteins contain different numbers of Ig-like domains for example, four in the case of LILRB1 (LIR-1), and LILRB2 (LIR-2), and two in the case of LILRB4 (LIR-5). The activating natural cytotoxicity receptor NKp46 is expressed in natural killer cells, and is organized as an extracellular portion having two Ig-like extracellular domains, a transmembrane domain, and a small cytoplasmic portion. GPVI, which also contains two Ig-like domains, participates in the processes of collagen-mediated platelet activation and arterial thrombus formation. Fc-alphaRI is expressed on monocytes, eosinophils, neutrophils and macrophages; it mediates IgA-induced immune effector responses such as phagocytosis, antibody-dependent cell-mediated cytotoxicity and respiratory burst."[56]
"IG domains [smart00410] that cannot be classified into one of IGv1, IGc1, IGc2, IG."[57] "𝛂1B-glycoprotein(𝛂1B) [...] consists of a single polypeptide chain N-linked to four glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂1B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂1B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂1B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."[51]
A1BG protein species
Def. a "group of plants or animals having similar appearance"[58] or "the largest group of organisms in which [any][59] two individuals [of the appropriate sexes or mating types][59] can produce fertile offspring, typically by sexual reproduction"[60] is called a species.
The gene contains 20 distinct introns.[61] Transcription produces 15 different mRNAs, 10 alternatively spliced variants and 5 unspliced forms.[61] There are 4 probable alternative promoters, 4 non overlapping alternative last exons and 7 validated alternative polyadenylation sites.[61] The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of 4 cassette exons, overlapping exons with different boundaries, splicing versus retention of 3 introns.[61]
Variants or isoforms
Def. a "different sequence of a gene (locus)"[62] is called a variant.
Def. any "of several different forms of the same protein, arising from either single nucleotide polymorphisms,[63] differential splicing of mRNA, or post-translational modifications (e.g. sulfation, glycosylation, etc.)"[64] is called an isoform.
Regarding additional isoforms, mention has been made of "new genetic variants of A1BG."[65]
"Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein (A1BG) and its post-translationally modified isoforms."[66]
Pharmacogenomic variants have been reported.[67]
Genotypes
Def. the "part (DNA sequence) of the genetic makeup of an organism which determines a specific characteristic (phenotype) of that organism"[68] or a "group of organisms having the same genetic constitution" [69]is called a genotype.
There are A1BG genotypes.[67]
A1BG has a genetic risk score of rs893184.[67]
"A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10−5)."[67]
Polymorphs
Def. the "regular existence of two or more different genotypes within a given species or population; also, variability of amino acid sequences within a gene's protein"[70] is called polymorphism.
Def. "one of a number of alternative forms of the same gene occupying a given position, [or locus],[71] on a chromosome"[72] is called an allele.
"rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG."[67]
"Genetic polymorphism of human plasma (serum) alpha 1B-glycoprotein (alpha 1B) was observed using one-dimensional horizontal polyacrylamide gel electrophoresis (PAGE) pH 9.0 of plasma samples followed by Western blotting with specific antiserum to alpha 1B."[73]
A1B*5 is a "new allele [...] of human plasma 𝜶1B-glycoprotein [...]."[74]
"Genetic polymorphism of human plasma 𝜶1B-glycoprotein (𝜶1B) was reported first, in brief, by Altland et al. [1983; also given in Altkand and Hacklar, 1984]. A detailed description of human 𝜶1B polymorphism was reported in subsequent studies [Gahne et al., 1987; Juneja et al., 1988, 1989]. Five different 𝜶1B alleles (A1B*1, A1B*2, A1B*3, A1B*4 and A1B*5) were reported. In Caucasian whites, the frequencies of A1B*1 and ''A1B*2 were about 0.95 and 0.05, respectively. A1B*4 was observed in 2 related Czech individuals. In American blacks, A1B*1 and A1B*2 occurred with a frequency of 0.73 and 0.21, respectively, while a new allele, viz, A1B*3 had a frequency of 0.06. A1B*5 was observed only in Swedish Lapps and in Finns with a frequency of 0.04 and 0.007, respectively."[75]
"The frequency of A1B*1 varied from 0.89 to 0.91 and that of A1B*2 from 0.08 to 0.10. The A1B*3 allele, reported previously only in American blacks, was observed with a frequency range of 0.003-0.01 in 3 of the Chinese populations, in Koreans and in Malays. A new 𝜶1B allele (A1B*6) was observed in 2 Chinese individuals."[75]
Phenotypes
Def. the "appearance of an organism based on a single trait [multifactorial combination of genetic traits and environmental factors][76], especially used in pedigrees"[77] or any "observable characteristic of an organism, such as its morphological, developmental, biochemical or physiological properties, or its behavior"[78] is called a phenotype.
"The three different phenotypes of α1B observed (designated 1-1, 1-2, and 2-2) were apparently identical to those reported by Altland et al. (1983), who used double one-dimensional electrophoresis. Family data supported the hypothesis that the three α1B phenotypes are determined by two codominant alleles at an autosomal locus, designated A1B. Allele frequencies in a Swedish population were: A1B *1, 0.937; A1B *2, 0.063; PIC, 0.111."[73]
Protein species
"Both protein species of [alpha 1-beta glycoprotein] A1B (A1Ba, p = 0.008; f.c.= +1.62, A1Bb, p = 0.003; f.c. = +1.82) [...] were apparently overexpressed in patients with PTCa [...]."[79]
A1BG is mainly produced in the liver, and is secreted to plasma to levels of approximately 0.22 mg/mL.[51]
CRISPs
The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity."[80] CRISP3 has a relatively high content in human plasma.[80]
"The A1BG-CRISP-3 complex is noncovalent with a 1:1 stoichiometry and is held together by strong electrostatic forces."[80] "Similar [complex formation] between toxins from snake venom and A1BG-like plasma proteins ... inhibits the toxic effect of snake venom metalloproteinases or myotoxins and protects the animal from envenomation."[80]
Opossums have a remarkably robust immune system, and show partial or total immunity to the venom of rattlesnakes, Agkistrodon piscivorus, cottonmouths, and other Crotalinae, pit vipers.[81][82]
"Crisp3 [is] mainly [expressed] in the salivary glands, pancreas, and prostate."[83] "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."[83]
ZNF497
Gene ID: 503538 is A1BG-AS1 A1BG antisense RNA 1.[84] A1BG-AS1 is transcribed in the negative direction from ZSCAN22.[84]
Gene ID: 162968 is ZNF497 zinc finger protein 497.[85] ZNF497 is transcribed in the positive direction from RNA5SP473.[85]
- NP_001193938.1 zinc finger protein 497: "Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein."[85]
- NP_940860.2 zinc finger protein 497: "Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein."[85]
Gene ID: 100419840 is LOC100419840 zinc finger protein 446 pseudogene.[86] LOC100419840 may be transcribed in the positive direction from LOC105372483.[86]
Gene ID: 105372483 is LOC105372483 uncharacterized LOC105372483 ncRNA.[87] LOC105372483 is transcribed in the negative direction from LOC100419840.[87]
Gene ID: 106479017 is RNA5SP473 RNA, 5S ribosomal pseudogene 473.[88] RNA5SP473 may be transcribed in the negative direction from ZNF497.[88]
GC contents
Approximately "76% of human core promoters lack TATA-like elements, have a high GC content, and are enriched in Sp1 binding sites."[89]
CpG islands typically occur at or near the transcription start site of genes, particularly housekeeping genes, in vertebrates.[90]
The number of CG or GC pairs near the TSS for A1BG appears to be low: between ZSCAN22 and A1BG are 8.2 % CG/GC and between ZNF497 and A1BG are 15 % CG/GC.
19q13.43
Regulatory elements and regions
Functions of A1BG
"Receptors of the leukocyte receptor cluster (LRC) play a range of important functions in the human immune system."[91]
"The leukocyte receptor cluster (LRC) is a family of structurally related genes for immunoregulatory receptors. Originally, the term LRC was introduced to emphasize the linkage of the genes encoding killer immunoglobulin-like receptors (KIRs), leukocyte Ig-like receptors (LILRs), and FcαR on human chromosome 19q13.4 (Wagtmann et al. 1997; Wende et al. 1999). Subsequently, it has been found that the region contains some other structurally related genes, such as NCR1, GPVI, LAIR1, LAIR2, and OSCAR (Meyaard et al. 1997; Sivori et al. 1997; Clemetson et al. 1999; Kim et al. 2002). Most recently, the LRC has been further extended by adding two more genes named VSTM1/SIRL1 and TARM1 (Steevels et al. 2010; Radjabova et al. 2015)."[91]
"Except for LAIR2, which is a secreted protein, all human LRC products are type I cell surface receptors with extracellular regions composed of 1–4 C2-type Ig-like domains."[91]
The "eutherian LRC family, in addition to commonly recognized members, includes two new, IGSF1 and alpha-1-B glycoprotein (A1BG)."[91]
"Nucleotide sequences were retrieved and analyzed using utilities at the NCBI (https://www.ncbi.nlm.nih.gov/, last accessed May 20, 2019) and Ensemble (http://www.ensembl.org, last accessed May 20, 2019) websites."[91]
"In our previous studies, it was observed that the Ig-like domains of the frog and chicken LRC proteins reproducibly showed homology not only to known LRC members but also to the products of four mammalian genes that to our knowledge have never been considered in the phylogenetic analyses of LRC. These genes are VSTM1, TARM1, A1BG, and IGSF1. VSTM1 and TARM1 are the most recently identified members of the human LRC (Steevels et al. 2010; Radjabova et al. 2015). A1BG encodes alpha-1 B glycoprotein, a soluble component of mammalian blood plasma that is known for half a century (Schultze et al. 1963). The protein is composed of five Ig-like domains and has been shown to bind to CRISP-3, a small polypeptide that is present in exocrine secretions of neutrophilic granulocytes and that is believed to play a role in innate immunity (Udby et al. 2004). In the human genome, A1BG maps to 19q13.4 some 3.3 Mb away from GPVI [...]."[91]
"The attribution of IGSF1 and A1BG domains to the LRC was supported by their 3D structures predicted using homology modeling [...]."[91]
"Noteworthy is that the D1 and D6 domains of IgSF1 fall into one clade with the N-terminal (d1) domains of A1BG and OSCAR (cluster B1). Closer relationship of A1BG and OSCAR was supported by clustering of the d2–d5 domains of A1BG with membrane-proximal (d2) domain of OSCAR (cluster B2)."[91]
"Altogether, these results support the attribution of IGSF1 and A1BG to the LRC and suggest their relatedness to OSCAR, TARM1, and VSTM1."[91]
"Clustering of the N-terminal domains of OSCAR, IGSF1, and A1BG with each other and with IGSF1 d6 was also reproduced. Finally, the d2 domains of OSCAR cluster with the d2–d5 domains of A1BG (fig. 5). These results further justify grouping IGSF1, A1BG, OSCAR, TARM1, and VSTM1 into a distinct group B."[91]
Hypotheses
- Downstream core promoters may work as transcription factors even as their complements or inverses.
- In addition to the DNA binding sequences listed above, the transcription factors that can open up and attach through the local epigenome need to be known and specified.
- Each DNA binding domain serving as a transcription factor for the promoter of any immunoglobulin supergene family member, also serves or is present in the promoters for A1BG.
- The function of A1BG is the same as other immunoglobulin genes possessing the immunoglobulin domain cl11960 and/or any of three immunoglobulin-like domains: pfam13895, cd05751 and smart00410 in the order and nucleotide sequence: cd05751 Location: 401 → 493, smart00410 Location: 218 → 280, pfam13895 Location: 210 → 301 and cl11960 Location: 28 → 110.
See also
- A1BG gene transcription core promoters
- A1BG gene transcriptions
- A1BG regulatory elements and regions
- A1BG response element gene transcriptions
- A1BG response element negative results
- A1BG response element positive results
- Alpha-1-B glycoprotein
- Immunoglobulin domain cl11960
- Immunoglobulin like domain cd05751
- Immunoglobulin like domain pfam13895
- Immunoglobulin like domain smart00410
- Immunoglobulin supergene family
- Nuclear factor gene transcriptions
- SCAN domain
References
- ↑ "Entrez Gene: Alpha-1-B glycoprotein". Retrieved 2012-11-09.
- ↑ 2.0 2.1 "A1BG alpha-1-B glycoprotein". Retrieved May 10, 2013.
- ↑ Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check
|pmid=
value (help). Retrieved 29 August 2020. - ↑ Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang (July 2016). "Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region". Pediatric Research. 80 (1): 159–168. doi:10.1038/pr.2016.47. PMID 26991262. Retrieved 7 September 2020.
- ↑ U.S. National Library of Medicine (2008/07/08). "Response Elements MeSH Descriptor Data 2021". 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health. Retrieved 22 April 2021. Check date values in:
|date=
(help) - ↑ Benjamin A. Pierce (24 December 2004). Control of Gene Expression, In: Genetics Solutions and Problem Solving MegaManual. Macmillan. p. 221. Retrieved 22 April 2021.
- ↑ Tania Islas-Flores, Gabriel Guillén, Xóchitl Alvarado-Affantranger, Miguel Lara-Flores, Federico Sánchez, and Marco A. Villanueva (2011). "PvRACK1 Loss-of-Function Impairs Cell Expansion and Morphogenesis in Phaseolus vulgaris L. Root Nodules". Molecular Plant-Microbe Interactions. 24 (7): 819–826. doi:10.1094/MPMI-11-10-0261. Retrieved 25 April 2021.
- ↑ Kenneth A. Watanabe, Arielle Homayouni, Lingkun Gu, Kuan‐Ying Huang, Tuan‐Hua David Ho, Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
- ↑ 9.0 9.1 9.2 9.3 Arnaud Stigliani, Raquel Martin-Arevalillo, Jérémy Lucas, Adrien Bessy, Thomas Vinos-Poyo, Victoria Mironova, Teva Vernoux, Renaud Dumas and François Parcy (3 June 2019). "Capturing Auxin Response Factors Syntax Using DNA Binding Models". Molecular Plant. 12 (6): 822–832. doi:10.1016/j.molp.2018.09.010. PMID 30336329. Retrieved 29 August 2020.
- ↑ 10.0 10.1 10.2 10.3 10.4 10.5 10.6 10.7 10.8 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
- ↑ 11.0 11.1 Maria Cristina Bosio, Beatrice Fermi, Gloria Spagnoli, Elisabetta Levati, Ludmilla Rubbi, Roberto Ferrari, Matteo Pellegrini, Giorgio Dieci (5 May 2017). "Abf1 and other general regulatory factors control ribosome biogenesis gene expression in budding yeast". Nucleic Acids Research. 45 (8): 4493–4506. doi:10.1093/nar/gkx058. Retrieved 8 June 2021.
- ↑ 12.0 12.1 Z G E, Zhang YP, Zhou JH, Wang L (April 2014). "Roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: name (help)
- ↑ Nijhawan A, Jain M, Tyagi AK, Khurana JP (February 2008). "Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice". Plant Physiology. 146 (2): 333–50. doi:10.1104/pp.107.112821. PMID 18065552.
- ↑ Randy Foster, Takeshi Izawa and Nam-Hai Chua (1 February 1994). "Plant bZIP proteins gather at ACGT elements". FASEB. 8 (2): 192–200. doi:10.1096/fasebj.8.2.8119490. PMID 8119490. Retrieved 25 June 2021.
- ↑ Ganesh M. Nawkar, Chang Ho Kanga, Punyakishore Maibam, Joung Hun Park, Young Jun Jung, Ho Byoung Chae, Yong Hun Chi, In Jung Jung, Woe Yeon Kim, Dae-Jin Yun, and Sang Yeol Lee (21 February 2017). "HY5, a positive regulator of light signaling, negatively controls the unfolded protein response in Arabidopsis" (PDF). Proceedings of the National Academy of Sciences USA. 114 (8): 2084–89. doi:10.1073/pnas.1609844114. Retrieved 24 June 2021.
- ↑ PA Johnson, D Bunick, NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. Retrieved 6 April 2019.
- ↑ Dmitry A. Samarsky, Maurille J.Fournier, Robert H.Singer and Edouard Bertrand (1 July 1998). "The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization" (PDF). The European Molecular Biology Organization (EMBO) Journal. 17 (13): 3747–3757. doi:10.1093/emboj/17.13.3747. PMID 9649444. Retrieved 2017-02-04.
- ↑ E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko (2003). "Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11" (PDF). Molecular Biology. 37 (3): 362–371. Retrieved 11 April 2019.
- ↑ 19.0 19.1 19.2 19.3 19.4 Young Hun Song, Cheol Min Yoo, An Pio Hong, Seong Hee Kim, Hee Jeong Jeong, Su Young Shin, Hye Jin Kim, Dae-Jin Yun, Chae Oh Lim, Jeong Dong Bahk, Sang Yeol Lee, Ron T. Nagao, Joe L. Key, and Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. Retrieved 26 March 2019.
- ↑ K Oeda, J Salinas, and N H Chua (July 1991). "A tobacco bZip transcription activator (TAF-1) binds to a G-box-like motif conserved in plant genes". The EMBO Journal. 10 (7): 1793–1802. PMID 2050116. Retrieved 2017-02-13.
- ↑ Gary J. Loake, Ouriel Faktor, Christopher J. Lamb, and Richard A. Dixon (October 1992). "Combination of H-box [CCTACC(N)7CT] and G-box (CACGTG) cis elements is necessary for feed-forward stimulation of a chalcone synthase promoter by the phenylpropanoid-pathway intermediate p-coumaricacid" (PDF). Proceedings of the National Academy of Sciences USA. 89: 9230–4. Retrieved 5 May 2020.
- ↑ 22.0 22.1 Z G E, Zhang YP, Zhou JH, Wang L (April 2014). "Mini review roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: name (help)
- ↑ 23.0 23.1 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check
|pmid=
value (help). Retrieved 18 September 2020. - ↑ 24.0 24.1 24.2 Kirk A. Staschke, Souvik Dey, John M. Zaborske, Lakshmi Reddy Palam, Jeanette N. McClintick, Tao Pan, Howard J. Edenberg, and Ronald C. Wek (May 28, 2010). "Integration of General Amino Acid Control and Target of Rapamycin (TOR) Regulatory Pathways in Nitrogen Assimilation in Yeast" (PDF). The Journal of Biological Chemistry. 285 (22): 16893–16911. doi:10.1074/jbc.M110.121947. Retrieved 4 January 2021.
- ↑ Ulrike Burk, Jörg Schubert, Ulrich Wellner, Otto Schmalhofer, Elizabeth Vincan, Simone Spaderna, Thomas Brabletz (1 June 2008). "A reciprocal repression between ZEB1 and members of the miR‐200 family promotes EMT and invasion in cancer cells". EMBO Reports. 9 (6): 582–589. doi:10.1038/embor.2008.74. Retrieved 15 November 2018.
- ↑ RefSeq (January 2016). "MYB MYB proto-oncogene, transcription factor [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 7 February 2021.
- ↑ Paul J Rushton and Imre E Somssich (August 1998). "Transcriptional control of plant genes responsive to pathogens" (PDF). Current Opinion in Plant Biology. 1 (4): 311–5. doi:10.1016/1369-5266(88)80052-9. Retrieved 5 November 2018.
- ↑ Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman (1 February 1998). "A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p". Nucleic Acids Research. 26 (3): 710–4. doi:10.1093/nar/26.3.710. PMC 147311. PMID 9443961.
- ↑ Chaudhary J, Skinner MK (1999). "Basic helix-loop-helix proteins can act at the E-box within the serum response element of the c-fos promoter to influence hormone-induced promoter activation in Sertoli cells". Mol. Endocrinol. 13 (5): 774–86. doi:10.1210/mend.13.5.0271. PMID 10319327.
- ↑ Nibedita Lenka, Aruna Basu, Jayati Mullick, and Narayan G. Avadhani (22 November 1996). "The role of an E box binding basic helix loop helix protein in the cardiac muscle-specific expression of the rat cytochrome oxidase subunit VIII gene" (PDF). The Journal of Biological Chemistry. 271 (47): 30281–30289. doi:10.1074/jbc.271.47.30281. Retrieved 7 February 2019.
- ↑ Nicholas V Parsonnet, Nickolaus C Lammer, Zachariah E Holmes, Robert T Batey, Deborah S Wuttke (5 September 2019). "The glucocorticoid receptor DNA-binding domain recognizes RNA hairpin structures with high affinity". Nucleic Acids Research. 47 (15): 8180–8192. doi:10.1093/nar/gkz486. PMID 31147715. Retrieved 28 August 2020.
- ↑ Mahmoud Mohamed Mokhtar, Emad Gamil Khidr, Hesham Mohamed Shaban, Shady Allam, Bakheet E. M. Elsadek, Salama Abdou Salama & Shawkey Saddik Ali (28 February 2020). "The effect of aryl hydrocarbon receptor ligands on gentamicin-induced nephrotoxicity in rats". Environmental Science and Pollution Research. 27 (May): 16189–16202. doi:10.1007/s11356-020-08073-z. Retrieved 16 February 2021.
- ↑ 33.0 33.1 33.2 33.3 Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C, Einarsson SO, Valgeirsdottir S, Bergsteinsdottir K, Schepsky A, Dummer R, Steingrimsson E (2008). "Novel MITF targets identified using a two-step DNA microarray strategy". Pigment Cell Melanoma Res. 21 (6): 665–76. doi:10.1111/j.1755-148X.2008.00505.x. PMID 19067971.
- ↑ Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
- ↑ 35.0 35.1 Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.
- ↑ Vera M. Ripoll, Nicholas A. Meadows, Liza-Jane Raggatt, Ming K. Chang, Allison R. Pettit, Alan I. Cassady and David A. Hume (30 April 2005). "Microphthalmia transcription factor regulates the expression of the novel osteoclast factor GPNMB" (PDF). Gene. 413 (1–2): 32–41. doi:10.1016/j.gene.2008.01.014. Retrieved 18 March 2021.
- ↑ Yuanyuan Zhao, Jinzhu Meng, Guoqing Cao, Pengfei Gao & Changsheng Dong (28 August 2018). "Screening the optimal activity region of the dopachrome tautomerase gene promoter in sheep skin melanocytes". Journal of Applied Animal Research. 46 (1): 1382–1388. doi:10.1080/09712119.2018.1512497. Retrieved 6 August 2021.
- ↑ 38.0 38.1 HGNC (13 March 2020). "ZSCAN22 zinc finger and SCAN domain containing 22 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
- ↑ 39.0 39.1 RefSeq (10 September 2009). "MIR6806 microRNA 6806 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
- ↑ Jag123 (7 March 2005). "antigen". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020. Vancouver style error: non-Latin character (help)
- ↑ SemperBlotto (21 April 2008). "immunogen". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 8 March 2020.
- ↑ 42.0 42.1 42.2 C. Michael Gibson (27 April 2008). "Antigen". Boston, Massachusetts: WikiDoc Foundation. Retrieved 8 March 2020.
- ↑ Williamsayers79 (26 February 2007). "antibody". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020. Vancouver style error: non-Latin character (help)
- ↑ Jag123 (7 March 2005). "antibody". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020. Vancouver style error: non-Latin character (help)
- ↑ Eleonora Market, F. Nina Papavasiliou (2003). "V(D)J Recombination and the Evolution of the Adaptive Immune System". PLoS Biology. 1 (1): e16. doi:10.1371/journal.pbio.0000016.
- ↑ Charles A Janeway, Jr, Paul Travers, Mark Walport, and Mark J Shlomchik (2001). Immunobiolog (5th ed. ed.). Garland Publishing. ISBN 0-8153-3642-X.
- ↑ SemperBlotto (25 February 2006). "immunoglobulin". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
- ↑ SemperBlotto (28 April 2008). "immunoglobulin". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
- ↑ 49.0 49.1 49.2 49.3 RefSeq (10 December 2019). "A1BG alpha-1-B glycoprotein [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
- ↑ Mei Tian, Ya-Zhou Cui, Guan-Hua Song, Mei-Juan Zong, Xiao-Yan Zhou, Yu Chen, Jin-Xiang Han (2008). "Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients". BMC Cancer. 8: 241. doi:10.1186/1471-2407-8-241. PMC 2528014. PMID 18706098.
- ↑ 51.0 51.1 51.2 51.3 51.4 51.5 51.6 Noriaki Ishioka, Nobuhiro Takahashi, and Frank W. Putnam (April 1986). "Amino acid sequence of human plasma 𝛂1B-glycoprotein: Homology to the immunoglobulin supergene family" (PDF). Proceedings of the National Academy of Sciences USA. 83 (8): 2363–7. doi:10.1073/pnas.83.8.2363. PMID 3458201. Retrieved 9 March 2020.
- ↑ 52.0 52.1 Katrina M. Morris, Denis O’Meally, Thiri Zaw, Xiaomin Song, Amber Gillett, Mark P. Molloy, Adam Polkinghorne, and Katherine Belova (7 October 2016). "Characterisation of the immune compounds in koala milk using a combined transcriptomic and proteomic approach". Scientific Reports. 6: 35011. doi:10.1038/srep35011. PMID 27713568. Retrieved 14 March 2020.
- ↑ R. J. Paxton, G. Mooser, H. Pande, T. D. Lee, and J. E. Shively (1 February 1987). "Sequence analysis of carcinoembryonic antigen: identification of glycosylation sites and homology with the immunoglobulin supergene family" (PDF). Proceedings of the National Academy of Sciences USA. 84 (4): 920–924. doi:10.1073/pnas.84.4.920. PMID 3469650. Retrieved 26 March 2020.
- ↑ NCBI (2 February 2016). "Conserved Protein Domain Family cl11960: Ig Superfamily". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 22 May 2020.
- ↑ NCBI (5 August 2015). "Conserved Protein Domain Family pfam13895: Ig_2". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
- ↑ NCBI (16 August 2016). "Conserved Protein Domain Family cd05751: Ig1_LILR_KIR_like". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
- ↑ NCBI (16 January 2013). "Conserved Protein Domain Family smart00410: IG_like". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
- ↑ 24.98.118.180 (28 February 2007). "species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020. Vancouver style error: non-Latin character (help)
- ↑ 59.0 59.1 Peter coxhead (22 August 2018). "Species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
- ↑ Chiswick Chap (1 December 2016). "Species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
- ↑ 61.0 61.1 61.2 61.3 "AceView: A1BG". Retrieved May 11, 2013.
- ↑ Pdeitiker (26 July 2008). "variant". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
- ↑ SemperBlotto (6 January 2007). "isoform". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2 December 2018.
- ↑ 72.178.245.181 (30 November 2008). "isoform". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2 December 2018. Vancouver style error: non-Latin character (help)
- ↑ H Eiberg, ML Bisgaard, J Mohr (1 December 1989). "Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG". Clinical genetics. 36 (6): 415–8. PMID 2591067. Retrieved 2017-10-08.
- ↑ John R. Stehle Jr., Mark E. Weeks, Kai Lin, Mark C. Willingham, Amy M. Hicks, John F. Timms, Zheng Cui (January 2007). "Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice". Biochimica et Biophysica Acta (BBA) - General Subjects. 1770 (1): 79–86. doi:10.1016/j.bbagen.2006.06.020. PMID 16945486. Retrieved 2017-10-08.
- ↑ 67.0 67.1 67.2 67.3 67.4 Caitrin W. McDonough, Yan Gong, Sandosh Padmanabhan, Ben Burkley, Taimour Y. Langaee, Olle Melander, Carl J. Pepine, Anna F. Dominiczak, Rhonda M. Cooper-DeHoff, and Julie A. Johnson (June 2013). "Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes" (PDF). Hypertension. 62 (1): 48–54. doi:10.1161/HYPERTENSIONAHA.111.00823. PMID 23690342. Retrieved 2017-10-08.
- ↑ DTLHS (10 January 2018). "genotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
- ↑ SemperBlotto (22 October 2005). "genotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
- ↑ Widsith (28 March 2012). "polymorphism". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
- ↑ 217.105.66.98 (8 September 2016). "allele". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020. Vancouver style error: non-Latin character (help)
- ↑ 138.130.33.215 (7 April 2004). "allele". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020. Vancouver style error: non-Latin character (help)
- ↑ 73.0 73.1 B. Gahne, R. K. Juneja, and A. Stratil (June 1987). "Genetic polymorphism of human plasma alpha 1B-glycoprotein: phenotyping by immunoblotting or by a simple method of 2-D electrophoresis". Human Genetics. 76 (2): 111–5. doi:10.1007/bf00284904. PMID 3610142. Retrieved 25 March 2020.
- ↑ R.K. Juneja, G. Beckman, M. Lukka, B. Gahne, and C. Ehnholm (1989). "Plasma α1B-Glycoprotein Allele Frequencies in Finns and Swedish Lapps: Evidence for a New α1B Allele". Human Heredity. 39 (1): 32–36. doi:10.1159/000153828. PMID 2759622. Retrieved 25 March 2020.
- ↑ 75.0 75.1 R.K. Juneja, N. Saha, B. Gahne and J.S.H. Tay (1989). "Distribution of Plasma Alpha-1-B-Glycoprotein Phenotypes in Several Mongoloid Populations of East Asia". Human Heredity. 39: 218–222. doi:10.1159/000153863. PMID 2583734. Retrieved 25 March 2020.
- ↑ 24.235.196.118 (23 September 2007). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04. Vancouver style error: non-Latin character (help)
- ↑ SemperBlotto (14 February 2005). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.
- ↑ N2e (3 July 2008). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04. Vancouver style error: non-Latin character (help)
- ↑ Mardiaty Iryani Abdullah, Ching Chin Lee, Sarni Mat Junit, Khoon Leong Ng, and Onn Haji Hashim (13 September 2016). "Tissue and serum samples of patients with papillary thyroid cancer with and without benign background demonstrate different altered expression of proteins". Peer J. 4: e2450. doi:10.7717/peerj.2450. PMID 27672505. Retrieved 15 March 2020.
- ↑ 80.0 80.1 80.2 80.3 Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L (12 October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460. Retrieved 2011-11-28. Vancouver style error: punctuation (help)
- ↑ "The Opossum: Our Marvelous Marsupial, The Social Loner". Wildlife Rescue League.
- ↑ Journal Of Venomous Animals And Toxins – Anti-Lethal Factor From Opossum Serum Is A Potent Antidote For Animal, Plant And Bacterial Toxins. Retrieved 2009-12-29.
- ↑ 83.0 83.1 B Haendler, J Krätzschmar, F Theuring and W D Schleuning (July 1993). "Transcripts for cysteine-rich secretory protein-1 (CRISP-1; DE/AEG) and the novel related CRISP-3 are expressed under androgen control in the mouse salivary gland". Endocrinology. 133 (1): 192–8. doi:10.1210/en.133.1.192. PMID 8319566. Retrieved 2012-02-20.
- ↑ 84.0 84.1 HGNC (10 December 2019). "A1BG-AS1 A1BG antisense RNA 1 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
- ↑ 85.0 85.1 85.2 85.3 HGNC (10 December 2019). "ZNF497 zinc finger protein 497 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
- ↑ 86.0 86.1 HGNC (10 December 2019). "LOC100419840 zinc finger protein 446 pseudogene [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
- ↑ 87.0 87.1 HGNC (10 December 2019). "LOC105372483 uncharacterized LOC105372483 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
- ↑ 88.0 88.1 HGNC (10 December 2019). "RNA5SP473 RNA, 5S ribosomal pseudogene 473 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
- ↑ Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (2007). "Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters". Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMID 17123746. Unknown parameter
|month=
ignored (help) - ↑ Saxonov S, Berg P, Brutlag DL (2006). "A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters". Proc Natl Acad Sci USA. 103 (5): 1412–1417. doi:10.1073/pnas.0510310103. PMC 1345710. PMID 16432200.
- ↑ 91.0 91.1 91.2 91.3 91.4 91.5 91.6 91.7 91.8 91.9 Sergey V Guselnikov and Alexander V Taranin (1 June 2019). "Unraveling the LRC Evolution in Mammals: IGSF1 and A1BG Provide the Keys". Genome Biology and Evolution. 11 (6): 1586–1601. doi:10.1093/gbe/evz102. PMID 31106814.
|access-date=
requires|url=
(help)