ABA-response element gene transcriptions: Difference between revisions

Jump to navigation Jump to search
VisualWikitext
 
(53 intermediate revisions by the same user not shown)
Line 15: Line 15:
|pmid=30634648
|pmid=30634648
|accessdate=27 August 2020 }}</ref>
|accessdate=27 August 2020 }}</ref>
"The hypoxia response element (HRE) and estrogen response element (ERE) were located on −154 to −150 "ACGTG", and −94 to −80 "AGGTTATTGCCTCCT" on the transcript, respectively."<ref name=Matsumoto>{{ cite journal
|author=Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima
|title=Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes''
|journal=Fisheries Science
|date=9 August 2020
|volume=86
|issue=
|pages=873-887
|url=https://researchmap.jp/hiroyukiharada/published_papers/29953426/attachment_file.pdf
|arxiv=
|bibcode=
|doi=10.1007/s12562-020-01451-z
|pmid=
|accessdate=27 September 2020 }}</ref>
==Gene expressions==
{{main|Gene expressions}}
Gene ID: 6522, aka AE2, SLC4A2 solute carrier family 4 member 2, "This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers."<ref name=RefSeq6522>{{ cite book
|author=RefSeq
|title=SLC4A2 solute carrier family 4 member 2 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=November 2016
|url=https://www.ncbi.nlm.nih.gov/gene/6522
|accessdate=28 September 2023 }}</ref>
"Abscisic acid (ABA) is a hormone conserved from cyanobacteria to higher plants, where it regulates responses to environmental stimuli. ABA also plays a role in mammalian physiology, pointedly in inflammatory responses and in glycemic control. As the animal ABA receptor is on the intracellular side of the plasma membrane, a transporter is required for the hormone's action. Here we demonstrate that ABA transport in human nucleated cells occurs via the anion exchanger AE2. Together with the recent demonstration that ABA influx into human erythrocytes occurs via Band 3, this result identifies the AE family members as the mammalian ABA transporters."<ref name=Vigliarolo>{{ cite journal
|author=Tiziana Vigliarolo, Elena Zocchi, Chiara Fresia, Valeria Booz, Lucrezia Guida
|title=Abscisic acid influx into human nucleated cells occurs through the anion exchanger AE2
|journal=International Journal of Biochemistry & Cell Biology
|date=June 2016
|volume=75
|issue=
|pages=99-103
|url=https://pubmed.ncbi.nlm.nih.gov/27015766/
|arxiv=
|bibcode=
|doi=10.1016/j.biocel.2016.03.006
|pmid=27015766
|accessdate=28 September 2023 }}</ref>
Gene ID: 10314, LANCL1 LanC like glutathione S-transferase 1, "This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified."<ref name=RefSeq10314>{{ cite book
|author=RefSeq
|title=LANCL1 LanC like glutathione S-transferase 1 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=November 2008
|url=https://www.ncbi.nlm.nih.gov/gene/10314
|accessdate=28 September 2023 }}</ref>
"The abscisic acid (ABA)/LANC-like protein 1/2 (LANCL1/2) hormone/receptor system regulates glucose uptake and oxidation, mitochondrial respiration, and proton gradient dissipation in myocytes. Oral ABA increases glucose uptake and the transcription of adipocyte browning-related genes in rodent brown adipose tissue (BAT). The aim of this study was to investigate the role of the ABA/LANCL system in human white and brown adipocyte thermogenesis. Immortalized human white and brown preadipocytes, virally infected to overexpress or silence LANCL1/2, were differentiated in vitro with or without ABA, and transcriptional and metabolic targets critical for thermogenesis were explored. The overexpression of LANCL1/2 increases, and their combined silencing conversely reduces mitochondrial number, basal, and maximal respiration rates; proton gradient dissipation; and the transcription of uncoupling genes and of receptors for thyroid and adrenergic hormones, both in brown and in white adipocytes. The transcriptional enhancement of receptors for browning hormones also occurs in BAT from ABA-treated mice, lacking LANCL2 but overexpressing LANCL1. The signaling pathway downstream of the ABA/LANCL system includes AMPK, PGC-1α, Sirt1, and the transcription factor ERRα. The ABA/LANCL system controls human brown and "beige" adipocyte thermogenesis, acting upstream of a key signaling pathway regulating energy metabolism, mitochondrial function, and thermogenesis."<ref name=Spinelli>{{ cite journal
|author=Sonia Spinelli, Vanessa Cossu, Mario Passalacqua, Jacob B Hansen, Lucrezia Guida, Mirko Magnone, Gianmario Sambuceti, Cecilia Marini, Laura Sturla, Elena Zocchi
|title=Abscisic acid influx into human nucleated cells occurs through the anion exchanger AE2
|journal=International Journal of Molecular Science
|date=9 February 2023
|volume=24
|issue=4
|pages=3489
|url=https://pubmed.ncbi.nlm.nih.gov/36834900/
|arxiv=
|bibcode=
|doi=10.3390/ijms24043489
|pmid=36834900
|accessdate=28 September 2023 }}</ref>
Gene ID: 50832, aka T2R4, "This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. These apparently intronless genes encode a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception."<ref name=RefSeq50832>{{ cite book
|author=RefSeq
|title=TAS2R4 taste 2 receptor member 4 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=November 2008
|url=https://www.ncbi.nlm.nih.gov/gene/50832
|accessdate=28 September 2023 }}</ref>
"Bitter taste receptors (T2Rs) belong to the G protein-coupled receptor superfamily. In humans, 25 T2Rs mediate bitter taste sensation. In addition to the oral cavity, T2Rs are expressed in many extraoral tissues, including the central nervous system, respiratory system, and reproductive system. To understand the mechanistic roles of the T2Rs in oral and extraoral tissues, novel blockers or antagonists are urgently needed. Recently, we elucidated the binding pocket of T2R4 for its agonist quinine, and an antagonist and inhibitory neurotransmitter, γ-aminobutyric acid. This structure-function information about T2R4 led us to screen the plant hormone abscisic acid (ABA), its precursor (xanthoxin), and catabolite phaseic acid for their ability to bind and activate or inhibit T2R4. Molecular docking studies followed by functional assays involving calcium imaging confirmed that ABA is an antagonist with an IC50 value of 34.4 ± 1.1 μM. However, ABA precursor xanthoxin acts as an agonist on T2R4. Interestingly, molecular model-guided site-directed mutagenesis suggests that the T2R4 residues involved in quinine binding are also predominantly involved in binding to the novel antagonist, ABA. The antagonist ability of ABA was tested using another T2R4 agonist, yohimbine. Our results suggest that ABA does not inhibit yohimbine-induced T2R4 activity. The discovery of natural bitter blockers has immense nutraceutical and physiological significance and will help in dissecting the T2R molecular pathways in various tissues."<ref name=Pydi>{{ cite journal
|author=Sai P Pydi, Appalaraju Jaggupilli, Ken M Nelson, Suzanne R Abrams, Rajinder P Bhullar, Michele C Loewen, Prashen Chelikani
|title=Abscisic Acid Acts as a Blocker of the Bitter Taste G Protein-Coupled Receptor T2R4
|journal=Biochemistry
|date=28 April 2015
|volume=54
|issue=16
|pages=2622-31
|url=https://pubmed.ncbi.nlm.nih.gov/25844797/
|arxiv=
|bibcode=
|doi=10.1021/acs.biochem.5b00265
|pmid= 25844797
|accessdate=28 September 2023 }}</ref>
Gene ID: 51463, GPR89B G protein-coupled receptor 89B, "Enables voltage-gated anion channel activity. Involved in intracellular pH reduction. Located in Golgi cisterna membrane and Golgi-associated vesicle membrane."<ref name=Alliance51463>{{ cite book
|author=Alliance of Genome Resources
|title=GPR89B G protein-coupled receptor 89B [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=April 2022
|url=https://www.ncbi.nlm.nih.gov/gene/51463
|accessdate=28 September 2023 }}</ref>
Abscisic acid G-protein coupled receptor (ABA_GPCR), variants 1 and 2 encode the same protein (isoform 1), variants 3 and 4 encode the same protein (isoform 2), variants 4 and 5 encode the same protein (isoform 3).<ref name=Alliance51463/>
Gene ID: 55915, aka GPR69B, LANCL2 LanC like glutathione S-transferase 2, "Enables phosphatidylinositol-3-phosphate binding activity; phosphatidylinositol-4-phosphate binding activity; and phosphatidylinositol-5-phosphate binding activity. Involved in negative regulation of transcription, DNA-templated and positive regulation of abscisic acid-activated signaling pathway. Located in several cellular components, including cortical actin cytoskeleton; cytosol; and nucleoplasm."<ref name=Alliance55915>{{ cite book
|author=Alliance of Genome Resources
|title=LANCL2 LanC like glutathione S-transferase 2 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=April 2022
|url=https://www.ncbi.nlm.nih.gov/gene/55915
|accessdate=28 September 2023 }}</ref>
Gene ID: 653519, GPR89A G protein-coupled receptor 89A, "Enables voltage-gated anion channel activity. Involved in intracellular pH reduction. Located in Golgi cisterna membrane and Golgi-associated vesicle membrane."<ref name=Alliance653519>{{ cite book
|author=Alliance of Genome Resources
|title=GPR89A G protein-coupled receptor 89A [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=April 2022
|url=https://www.ncbi.nlm.nih.gov/gene/653519
|accessdate=28 September 2023 }}</ref>
Abscisic acid G-protein coupled receptor (ABA_GPCR), variant 1 represents the shortest transcript and encodes the longer isoform 1, variant 2 differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1, the encoded isoform 2 is shorter than isoform 1.<ref name=Alliance653519/>


==Consensus sequences==
==Consensus sequences==
Line 79: Line 199:
==ABRE samplings==
==ABRE samplings==


Copying 5'-ACGTG-3' in "⌘F" yields eight between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
Copying ACGTG in "⌘F" yields eight between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
 
For the Basic programs testing consensus sequence ACGTG(G/T)C (starting with SuccessablesABA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
# negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA--.bas, looking for ACGTG(G/T)C: 0.
# negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA-+.bas, looking for ACGTG(G/T)C: 0.
# positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA+-.bas, looking for ACGTG(G/T)C: 1, ACGTGGC at 4239.
# positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA++.bas, looking for ACGTG(G/T)C: 2, ACGTGGC at 4344, ACGTGTC at 1823.
# inverse complement, negative strand, negative direction is SuccessablesABAci--.bas, looking for G(A/C)CACGT: 1, GACACGT at 3429.
# inverse complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci-+.bas, looking for G(A/C)CACGT: 0.
# inverse complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAci+-.bas, looking for G(A/C)CACGT: 0.
# inverse complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci++.bas, looking for G(A/C)CACGT: 1, GACACGT at 2960.
 
===ABRE (4560-2846) UTRs===
 
# Negative strand, negative direction: GACACGT at 3429.
 
# Positive strand, negative direction: ACGTGGC at 4239.
 
===ABRE positive direction (4445-4265) core promoters===
 
# Positive strand, positive direction: ACGTGGC at 4344.
 
===ABRE positive direction (4050-1) distal promoters===
 
# Positive strand, positive direction: GACACGT at 2960, ACGTGTC at 1823.
 
==ABRE random dataset samplings==
 
# ABREr0: 0.
# ABREr1: 0.
# ABREr2: 1, ACGTGTC at 1596.
# ABREr3: 1, ACGTGGC at 1439.
# ABREr4: 0.
# ABREr5: 0.
# ABREr6: 1, ACGTGTC at 2907.
# ABREr7: 1, ACGTGGC at 3536.
# ABREr8: 1, ACGTGTC at 916.
# ABREr9: 0.
# ABREr0ci: 0.
# ABREr1ci: 3, GACACGT at 3788, GCCACGT at 3298, GCCACGT at 191.
# ABREr2ci: 0.
# ABREr3ci: 2, GCCACGT at 4080, GCCACGT at 1482.
# ABREr4ci: 1, GACACGT at 2286.
# ABREr5ci: 0.
# ABREr6ci: 0.
# ABREr7ci: 1, GACACGT at 1391.
# ABREr8ci: 1, GCCACGT at 897.
# ABREr9ci: 1, GCCACGT at 874.
 
===ABREr arbitrary (evens) (4560-2846) UTRs===
 
# ABREr6: ACGTGTC at 2907.


For the Basic programs testing consensus sequence 3'-ACGTG(G/T)C-5' (starting with SuccessablesABA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
===ABREr alternate (odds) (4560-2846) UTRs===
# negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA--.bas, looking for 3'-ACGTG(G/T)C-5', 0.
# negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA-+.bas, looking for 3'-ACGTG(G/T)C-5', 0.
# positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA+-.bas, looking for 3'-ACGTG(G/T)C-5', 1, 3'-ACGTGGC-5', 4239.
# positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA++.bas, looking for 3'-ACGTG(G/T)C-5', 2, 3'-ACGTGTC-5', 1823, 3'-ACGTGGC-5', 4344.
# complement, negative strand, negative direction is SuccessablesABAc--.bas, looking for 3'-TGCAC(A/C)G-5', 1, 3'-TGCACCG-5', 4239.
# complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAc-+.bas, looking for 3'-TGCAC(A/C)G-5', 2, 3'-TGCACAG-5', 1823, 3'-TGCACCG-5', 4344.
# complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAc+-.bas, looking for 3'-TGCAC(A/C)G-5', 0.
# complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAc++.bas, looking for 3'-TGCAC(A/C)G-5', 0.
# inverse complement, negative strand, negative direction is SuccessablesABAci--.bas, looking for 3'-G(A/C)CACGT-5', 1, 3'-GACACGT-5', 3429.
# inverse complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci-+.bas, looking for 3'-G(A/C)CACGT-5', 0.
# inverse complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAci+-.bas, looking for 3'-G(A/C)CACGT-5', 0.
# inverse complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci++.bas, looking for 3'-G(A/C)CACGT-5', 1, 3'-GACACGT-5', 2960.
# inverse negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAi--.bas, looking for 3'-C(G/T)GTGCA-5', 0.
# inverse negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAi-+.bas, looking for 3'-C(G/T)GTGCA-5', 1, 3'-CTGTGCA-5', 2960.
# inverse positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAi+-.bas, looking for 3'-C(G/T)GTGCA-5', 1, 3'-CTGTGCA-5', 3429.
# inverse positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAi++.bas, looking for 3'-C(G/T)GTGCA-5', 0.


===ABRE Core promoters===
# ABREr7: ACGTGGC at 3536.
{{main|Core promoter gene transcriptions}}
# ABREr1ci: GACACGT at 3788, GCCACGT at 3298.
Positive strand, positive direction: 5'-ACGTGGC-3' at 4344 and complement.
# ABREr3ci: GCCACGT at 4080.


===ABRE Proximal promoters===
===ABREr arbitrary positive direction (odds) (4265-4050) proximal promoters===
{{main|Proximal promoter gene transcriptions}}
Positive strand, negative direction: 5'-ACGTGGC-3' at 4239 and complement.


===ABRE Distal promoters===
# ABREr3ci: GCCACGT at 4080.
{{main|Distal promoter gene transcriptions}}
Negative strand, negative direction: 5'-GACACGT-3' at 3429 and complement.


Positive strand, positive direction: 5'-GACACGT-3' at 2960, 5'-ACGTGTC-3' at 1823 and complements.
===ABREr arbitrary negative direction (evens) (2596-1) distal promoters===
 
# ABREr2: ACGTGTC at 1596.
# ABREr8: ACGTGTC at 916.
# ABREr4ci: GACACGT at 2286.
# ABREr8ci: GCCACGT at 897.
 
===ABREr alternate negative direction (odds) (2596-1) distal promoters===
 
# ABREr3: ACGTGGC at 1439.
# ABREr1ci: GCCACGT at 191.
# ABREr3ci: GCCACGT at 1482.
# ABREr7ci: GACACGT at 1391.
# ABREr9ci: GCCACGT at 874.
 
===ABREr arbitrary positive direction (odds) (4050-1) distal promoters===
 
# ABREr3: ACGTGGC at 1439.
# ABREr7: ACGTGGC at 3536.
# ABREr1ci: GACACGT at 3788, GCCACGT at 3298, GCCACGT at 191.
# ABREr3ci: GCCACGT at 1482.
# ABREr7ci: GACACGT at 1391.
# ABREr9ci: GCCACGT at 874.
 
===ABREr alternate positive direction (evens) (4050-1) distal promoters===
 
# ABREr2: ACGTGTC at 1596.
# ABREr6: ACGTGTC at 2907.
# ABREr8: ACGTGTC at 916.
# ABREr4ci: GACACGT at 2286.
# ABREr8ci: GCCACGT at 897.
 
==ABRE analysis and results==
{{main|Complex locus A1BG and ZNF497#Abscisic acid (ABA) response elements}}
"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."<ref name=Watanabe/>
 
{|class="wikitable"
|-
! Reals or randoms !! Promoters !! direction !! Numbers !! Strands !! Occurrences !! Averages (± 0.1)
|-
| Reals || UTR || negative || 2 || 2 || 1.0 || 1.0 ± 0 (--1,+-1)
|-
| Randoms || UTR || arbitrary negative || 1 || 10 || 0.1 || 0.25 ± 0.15
|-
| Randoms || UTR || alternate negative || 4 || 10 || 0.4 || 0.25 ± 0.15
|-
| Reals || Core || negative || 0 || 2 || 0 || 0
|-
| Randoms || Core || arbitrary negative || 0 || 10 || 0 || 0
|-
| Randoms || Core || alternate negative || 0 || 10 || 0 || 0
|-
| Reals || Core || positive || 1 || 2 || 0.5 || 0.5 ± 0.5 (-+0,++1)
|-
| Randoms || Core || arbitrary positive || 0 || 10 || 0 || 0
|-
| Randoms || Core || alternate positive || 0 || 10 || 0 || 0
|-
| Reals || Proximal || negative || 0 || 2 || 0 || 0
|-
| Randoms || Proximal || arbitrary negative || 0 || 10 || 0 || 0
|-
| Randoms || Proximal || alternate negative || 0 || 10 || 0 || 0
|-
| Reals || Proximal || positive || 0 || 2 || 0 || 0
|-
| Randoms || Proximal || arbitrary positive || 1 || 10 || 0.1 || 0.05 ± 0.05
|-
| Randoms || Proximal || alternate positive || 0 || 10 || 0 || 0.05 ± 0.05
|-
| Reals || Distal || negative || 0 || 2 || 0 || 0
|-
| Randoms || Distal || arbitrary negative || 4 || 10 || 0.4 || 0.45 ± 0.05
|-
| Randoms || Distal || alternate negative || 5 || 10 || 0.5 || 0.45 ± 0.05
|-
| Reals || Distal || positive || 2 || 2 || 1 || 1 ± 1 (-+0,++2)
|-
| Randoms || Distal || arbitrary positive || 8 || 10 || 0.8 || 0.65 ± 0.15
|-
| Randoms || Distal || alternate positive || 5 || 10 || 0.5 || 0.65 ± 0.15
|}
 
Comparison:
 
The occurrences of real UTR, core and distal ABREs are greater than the randoms. This suggests that the real ABREs are likely active or activable.


==ACGTGTCC samplings==
==ACGTGTCC samplings==
Line 133: Line 369:
# inverse positive strand, positive direction is SuccessablesABAi++.bas, looking for 3'-CCTGTGCA-5', 0.
# inverse positive strand, positive direction is SuccessablesABAi++.bas, looking for 3'-CCTGTGCA-5', 0.


==Hypoxia response element samplings==
==Discussion==


"We recently discovered a strongly conserved distal 5' [hypoxia response element] HRE and suggested that it might contribute to oxygen-regulated [Erythropoietin] ''EPO'' expression.<sup>18</sup> This 5' HRE resides within a DNaseI hypersensitive site - 9.2 kb upstream of the ''EPO'' transcriptional start site, [WT CAT<u>ACGTG</u>CAGGGAGA<u>CACA</u>], contains both the 5'-ACGTG-3' core [hypoxia-inducible factor] HIF DNA binding site as well as the ancillary 5'-CACA-3' element,<sup>11</sup> and confers hypoxia-inducible exogenous reporter gene expression in Epo expressing and non-expressing cell lines.<sup>18</sup>"<ref name=Orlando>{{ cite journal
Abscisic acid (ABA) response elements (ABREs) have been identified for example in the UTR for A1BG between ZSCAN22 and A1BG. If these response elements are active then A1BG can be transcribed as a key ''cis''-regulatory element in ABA signaling. "However, for ABA responsive transcription to occur, a single copy of the ABRE is not sufficient. In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996). It was also shown that a pair of ABREs can function as an ABRC with the second ABRE playing the role of the coupling element in rice (Hobo et al. 1999), barley (Shen et al. 1996) and Arabidopsis (Nakashima et al. 2006). Coupling of two CE3s is much less active in conferring ABA response to the minimal promoter (Shen et al. 2004). Interestingly, CE3 appears to be specific to monocots. In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."<ref name=Watanabe/>
|author=Ilaria M. C. Orlando, Véronique N. Lafleur, Federica Storti, Patrick Spielmann, Lisa Crowther, Sara Santambrogio, Johannes Schödel, David Hoogewijs, David R. Mole, and Roland H. Wenger
 
|title=Distal and proximal hypoxia response elements co-operate to regulate organ-specific erythropoietin gene expression
No coupling elements occur in the negative direction between ZSCAN22 and A1BG. Two ABREs occur in both directions suggesting pairs may be available to function as an ABRC on either side of A1BG, subject to needed proximity. The random datasets have more occurrences further away from A1BG and always much fewer occurrences per dataset. These suggest that those around A1BG are not random and are likely active or activable.
|journal=Haematologica
 
|date=19 December 2019
No DRE (TACCGACAT) occurs in either direction of A1BG.
|volume=105
 
|issue=12
Testing on Google Scholar: A1BG "ABA responsive element" - did not match any articles. Testing: A1BG ABRE produced 6 articles but ABRE in the first was not Abscisic acid (ABA) response element (ABRE). One other contained the Spanish word ''abre''. The only ABRE found in the promoters of A1BG is ACGTG(G/T)C (Watanabe) with four occurrences. Coupling element (CE1) is absent but CE3 is present as GCGTGTC (Watanabe) and CACGCG (Ding). The DREB box or (CRT/DREB box) are absent.
|pages=2774–2784
 
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7716368/
An NIH Gene database search of "Homo sapiens" and "Abscisic acid" or ABRE produced no genes found.
|arxiv=
 
|bibcode=
==ABA-signaling pathway==
|doi=10.3324/haematol.2019.236406
 
|pmid=33256376
"The key cis-elements in [non-yellow coloring 1] NYC1 promoter, namely, ABA-response element (ABRE) (ACGTG), ACGT, GCCcore (GCCGCC), and ethylene-inducible 3 [EIN3-Like1] (EIN3)/EIL1-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]), can be targeted by ABA insensitive 3 (ABI3), ABI5, and ABF2, 3, 4 in the ABA-signaling pathway [60,61]."<ref name=Asad/>
|accessdate=6 May 2021 }}</ref>
 
==Ethylene signaling pathway==
 
"GCCGCC and EIN3/EIL1-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]) are induced by ethylene-inducible TF and EIN3/EIL1 in the ethylene signaling pathway [61]."<ref name=Asad/>
 
Gene ID: 1543, CYP1A1 cytochrome P450 family 1 subfamily A member 1 [ Homo sapiens (human) ]. Location: 15q24.1. "This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms."<ref name=RefSeq1543>{{ cite book
|author=RefSeq
|title=CYP1A1 cytochrome P450 family 1 subfamily A member 1 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=January 2016
|url=https://www.ncbi.nlm.nih.gov/gene/1543
|accessdate=3 May 2023 }}</ref> Traceable author statement: "involved in ethylene metabolic process"<ref name=TAS1543>{{ cite book
|author=TAS
|title=CYP1A1 cytochrome P450 family 1 subfamily A member 1 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=January 2016
|url=https://www.ncbi.nlm.nih.gov/gene/1543
|accessdate=3 May 2023 }}</ref>
 
Gene ID: 1571, CYP2E1 cytochrome P450 family 2 subfamily E member 1 [ Homo sapiens (human) ]. Location: 10q26.3. "This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer."<ref name=RefSeq1571>{{ cite book
|author=RefSeq
|title=CYP2E1 cytochrome P450 family 2 subfamily E member 1 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=July 2008
|url=https://www.ncbi.nlm.nih.gov/gene/1571
|accessdate=3 May 2023 }}</ref> Metabolism of dichloroethylene by CYP450 WikiPathways WP3666.
 
Gene ID: 219681, ARMC3 armadillo repeat containing 3 [ Homo sapiens (human) ]. Location: 10p12.2. "Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li ''et al''., 2006 [PubMed 16915934])."<ref name=OMIM219681>{{ cite book
|author=OMIM
|title=ARMC3 armadillo repeat containing 3 [ Homo sapiens (human) ]
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=March 2008
|url=https://www.ncbi.nlm.nih.gov/gene/219681
|accessdate=3 May 2023 }}</ref> Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. pfam14381 Location: 713 → 851: EDR1; Ethylene-responsive protein kinase Le-CTR1. Transcript Variant: This variant (4) lacks three exons in the 5' region and uses a downstream start codon compared to variant 1. It encodes isoform 4 which has a shorter N-terminus compared to isoform 1. pfam14381 Location: 457 → 595: EDR1; Ethylene-responsive protein kinase Le-CTR1. Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). pfam14381 Location: 720 → 858: EDR1; Ethylene-responsive protein kinase Le-CTR1.
 
cl00033: AP2 Superfamily: "DNA-binding domain found in transcription regulators in plants such as APETALA2 and EREBP (ethylene responsive element binding protein). In EREBPs the domain specifically binds to the 11bp GCC box of the ethylene response element (ERE), a promotor element essential for ethylene responsiveness. EREBPs and the C-repeat binding factor CBF1, which is involved in stress response, contain a single copy of the AP2 domain. APETALA2-like proteins, which play a role in plant development contain two copies."<ref name=NCBI444663>{{ cite book
|author=NCBI
|title=Conserved Protein Domain Family AP2
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=8 March 2022
|url=https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=444663
|accessdate=3 May 2023 }}</ref>
 
cl04813: EIN3 Superfamily: "Ethylene insensitive 3 (EIN3) proteins are a family of plant DNA-binding proteins that regulate transcription in response to the gaseous plant hormone ethylene, and are essential for ethylene-mediated responses including the triple response, cell growth inhibition, and accelerated senescence."<ref name=NCBI414191>{{ cite book
|author=NCBI
|title=Conserved Protein Domain Family EIN3
|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
|location=8600 Rockville Pike, Bethesda MD, 20894 USA
|date=24 November 2020
|url=https://www.ncbi.nlm.nih.gov/Structure/cdd/cddsrv.cgi?uid=414191
|accessdate=3 May 2023 }}</ref>
 
==GATC samplings==
 
For the Basic programs testing consensus sequence GATC (starting with SuccessablesGATC1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
# Negative strand, negative direction: 6, GATC at 3493, GATC at 3462, GATC at 3369, GATC at 2313, GATC at 2093, GATC at 1306.
# Positive strand, negative direction: 20, GATC at 4475, GATC at 4288, GATC at 4157, GATC at 4006, GATC at 3488, GATC at 3276, GATC at 3097, GATC at 2574, GATC at 2413, GATC at 2239, GATC at 1987, GATC at 1812, GATC at 1481, GATC at 1167, GATC at 972, GATC at 877, GATC at 703, GATC at 589, GATC at 525, GATC at 430.
# Negative strand, positive direction: 6, GATC at 4080, GATC at 2513, GATC at 2377, GATC at 2230, GATC at 964, GATC at 864.
# Positive strand, positive direction: 7, GATC at 4076, GATC at 4064, GATC at 3521, GATC at 3483, GATC at 2638, GATC at 2481, GATC at 2167.
# inverse complement, is the same GATC.
 
===GATC (4560-2846) UTRs===
 
# Negative strand, negative direction: GATC at 3493, GATC at 3462, GATC at 3369.
# Positive strand, negative direction: GATC at 4475, GATC at 4288, GATC at 4157, GATC at 4006, GATC at 3488, GATC at 3276, GATC at 3097.
 
===GATC positive direction (4265-4050) proximal promoters===
 
# Negative strand, positive direction: GATC at 4080.
# Positive strand, positive direction: GATC at 4076, GATC at 4064.
 
===GATC negative direction (2596-1) distal promoters===
 
# Negative strand, negative direction: GATC at 2313, GATC at 2093, GATC at 1306.
# Positive strand, negative direction: GATC at 2574, GATC at 2413, GATC at 2239, GATC at 1987, GATC at 1812, GATC at 1481, GATC at 1167, GATC at 972, GATC at 877, GATC at 703, GATC at 589, GATC at 525, GATC at 430.
 
===GATC positive direction (4050-1) distal promoters===
 
# Negative strand, positive direction: GATC at 2513, GATC at 2377, GATC at 2230, GATC at 964, GATC at 864.
# Positive strand, positive direction: GATC at 3521, GATC at 3483, GATC at 2638, GATC at 2481, GATC at 2167.
 
==GATC random dataset samplings==
 
# GATCr0: 14, GATC at 4322, GATC at 4271, GATC at 3571, GATC at 3140, GATC at 3084, GATC at 2761, GATC at 2667, GATC at 2249, GATC at 1949, GATC at 1852, GATC at 924, GATC at 817, GATC at 736, GATC at 94.
# GATCr1: 14, GATC at 4398, GATC at 4079, GATC at 3860, GATC at 2995, GATC at 2834, GATC at 2757, GATC at 2724, GATC at 2626, GATC at 2250, GATC at 2230, GATC at 1798, GATC at 1789, GATC at 1779, GATC at 1335.
# GATCr2: 9, GATC at 3761, GATC at 3436, GATC at 3336, GATC at 2360, GATC at 1749, GATC at 1418, GATC at 1192, GATC at 266, GATC at 157.
# GATCr3: 9, GATC at 4551, GATC at 4372, GATC at 3824, GATC at 2566, GATC at 2434, GATC at 1755, GATC at 1125, GATC at 968, GATC at 846.
# GATCr4: 15, GATC at 4379, GATC at 4310, GATC at 3922, GATC at 3294, GATC at 3132, GATC at 3092, GATC at 3047, GATC at 2972, GATC at 2808, GATC at 2798, GATC at 2690, GATC at 1669, GATC at 1494, GATC at 1173, GATC at 65.
# GATCr5: 15, GATC at 4518, GATC at 4463, GATC at 4288, GATC at 4119, GATC at 4030, GATC at 2884, GATC at 2829, GATC at 2428, GATC at 1812, GATC at 1782, GATC at 1746, GATC at 1705, GATC at 1119, GATC at 943, GATC at 528.
# GATCr6: 18, GATC at 4310, GATC at 4049, GATC at 4038, GATC at 3047, GATC at 3026, GATC at 2936, GATC at 2874, GATC at 2390, GATC at 2221, GATC at 2213, GATC at 1012, GATC at 879, GATC at 755, GATC at 751, GATC at 732, GATC at 701, GATC at 508, GATC at 166.
# GATCr7: 12, GATC at 4552, GATC at 3550, GATC at 3367, GATC at 2594, GATC at 2530, GATC at 2460, GATC at 1921, GATC at 1285, GATC at 1162, GATC at 1116, GATC at 1002, GATC at 501.
# GATCr8: 15, GATC at 4188, GATC at 3702, GATC at 3016, GATC at 2192, GATC at 1872, GATC at 1500, GATC at 1138, GATC at 1057, GATC at 974, GATC at 966, GATC at 864, GATC at 442, GATC at 337, GATC at 103, GATC at 26.
# GATCr9: 7, GATC at 3582, GATC at 3444, GATC at 2724, GATC at 2484, GATC at 2430, GATC at 2282, GATC at 2236.
 
===GATCr arbitrary (evens) (4560-2846) UTRs===
 
# GATCr0: GATC at 4322, GATC at 4271, GATC at 3571, GATC at 3140, GATC at 3084.
# GATCr2: GATC at 3761, GATC at 3436, GATC at 3336.
# GATCr4: GATC at 4379, GATC at 4310, GATC at 3922, GATC at 3294, GATC at 3132, GATC at 3092, GATC at 3047, GATC at 2972.
# GATCr6: GATC at 4310, GATC at 4049, GATC at 4038, GATC at 3047, GATC at 3026, GATC at 2936, GATC at 2874.
# GATCr8: GATC at 4188, GATC at 3702, GATC at 3016.
 
===GATCr alternate (odds) (4560-2846) UTRs===
 
# GATCr1: GATC at 4398, GATC at 4079, GATC at 3860, GATC at 2995.
# GATCr3: GATC at 4551, GATC at 4372, GATC at 3824.
# GATCr5: GATC at 4518, GATC at 4463, GATC at 4288, GATC at 4119, GATC at 4030, GATC at 2884.
# GATCr7: GATC at 4552, GATC at 3550, GATC at 3367.
# GATCr9: GATC at 3582, GATC at 3444.
 
===GATCr alternate negative direction (odds) (2846-2811) core promoters===
 
# GATCr1: GATC at 2834.
# GATCr5: GATC at 2829.
 
===GATCr arbitrary positive direction (odds) (4445-4265) core promoters===
 
# GATCr1: GATC at 4398.
# GATCr3: GATC at 4372.
# GATCr5: GATC at 4288.
 
===GATCr alternate positive direction (evens) (4445-4265) core promoters===
 
# GATCr0: GATC at 4322, GATC at 4271.
# GATCr4: GATC at 4379, GATC at 4310.
# GATCr6: GATC at 4310.
 
===GATCr arbitrary negative direction (evens) (2811-2596) proximal promoters===
 
# GATCr0: GATC at 2761, GATC at 2667.
# GATCr4: GATC at 2808, GATC at 2798, GATC at 2690.
 
===GATCr alternate negative direction (odds) (2811-2596) proximal promoters===
 
# GATCr1: GATC at 2757, GATC at 2724, GATC at 2626.
# GATCr9: GATC at 2724.
 
===GATCr arbitrary positive direction (odds) (4265-4050) proximal promoters===
 
# GATCr1: GATC at 4079.
# GATCr5: GATC at 4119.
 
===GATCr alternate positive direction (evens) (4265-4050) proximal promoters===
 
# GATCr8: GATC at 4188.
 
===GATCr arbitrary negative direction (evens) (2596-1) distal promoters===


"We have previously shown for ''PAG1'', another ''HIF-2'' target gene, that a single distal - 82 kb 5' HRE resides in an isolated DNA region, bound by many additional transcription factors, and forms multiple chromatin loops both locally and over a long distance with the promoter region.<sup>21</sup> While in this case HIF-2α did interact with the HRE, neither hypoxia nor the presence of HIF was needed for the long-range chromatin interaction with the promoter region. Only the presence of the core 5'-ACGTG-3' HIF binding DNA sequence was required to maintain this interaction, suggesting that preformed chromatin loops enable oxygen-regulated conditional gene regulation. This model has subsequently been confirmed for many other HIF target genes by genomewide approaches.<sup>38,39</sup> Therefore, the ''EPO'' 5' HRE might well be functionally required for hypoxia-inducible gene expression by maintaining a constitutive chromatin architecture that supports promoter activity in a cell type-specific manner. The finding that only additional large but not small 5' HRE deletions fully abrogated endogenous Epo induction and HIF:promoter interaction in 3' HRE mutant Kelly cells suggests that, like in the case of the ''PAG1'' gene, additional transcription factors bind close to the consensus HRE sequence and are involved in chromatin looping and trans-activation of the ''EPO'' promoter. We still have no explanation why a small 5' HRE deletion alone inhibited HIF-promoter interaction, but in combination with a 3' HRE mutation partially rescued the inhibitory effect of the 3' HRE mutation. Nonetheless, it is without precedent that the extended 5' HRE strongly cis-enhanced HIF binding to the promoter and 3' HRE."<ref name=Orlando/>
# GATCr0: GATC at 2249, GATC at 1949, GATC at 1852, GATC at 924, GATC at 817, GATC at 736, GATC at 94.
# GATCr2: GATC at 2360, GATC at 1749, GATC at 1418, GATC at 1192, GATC at 266, GATC at 157.
# GATCr4: GATC at 1669, GATC at 1494, GATC at 1173, GATC at 65.
# GATCr6: GATC at 2390, GATC at 2221, GATC at 2213, GATC at 1012, GATC at 879, GATC at 755, GATC at 751, GATC at 732, GATC at 701, GATC at 508, GATC at 166.
# GATCr8: GATC at 2192, GATC at 1872, GATC at 1500, GATC at 1138, GATC at 1057, GATC at 974, GATC at 966, GATC at 864, GATC at 442, GATC at 337, GATC at 103, GATC at 26.


"Putative ''EPO'' promoter HREs. Location of two conserved potential promoter HREs (pHRE1 and pHRE2; [CACGC]) close to the GATA ([GATA]) and WT1 ([GCCTCTCCCCCACCCCCACCCGCG<u>CACGC</u>AC]) sites in the ''EPO'' proximal 5' region. [For human and other vertebrates] is a UCSC Genome Browser output (version hg19), including 161 transcription factor ChIP-sequencing (ChIP-seq) tracks derived from the ENCODE database (version 3), clusters of DNaseI hypersensitivity sites (HSS) from 125 cell types, and the transcriptional start site (TSS), with a closer view of the region in 50 vertebrates extracted using the 100-MULTIZ whole-genome multiple sequence alignment algorithm."<ref name=Orlando/>
===GATCr alternate negative direction (odds) (2596-1) distal promoters===


Copying ACGTG in "⌘F" yields eight between ZSCAN22 and A1BG as can be found by the computer programs.
# GATCr1: GATC at 2250, GATC at 2230, GATC at 1798, GATC at 1789, GATC at 1779, GATC at 1335.
# GATCr3: GATC at 2566, GATC at 2434, GATC at 1755, GATC at 1125, GATC at 968, GATC at 846.
# GATCr5: GATC at 2428, GATC at 1812, GATC at 1782, GATC at 1746, GATC at 1705, GATC at 1119, GATC at 943, GATC at 528.
# GATCr7: GATC at 2594, GATC at 2530, GATC at 2460, GATC at 1921, GATC at 1285, GATC at 1162, GATC at 1116, GATC at 1002, GATC at 501.
# GATCr9: GATC at 2484, GATC at 2430, GATC at 2282, GATC at 2236.


For the Basic programs testing consensus sequence ACGTG (starting with SuccessablesHxRE.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
===GATCr arbitrary positive direction (odds) (4050-1) distal promoters===
# negative strand, negative direction, looking for ACGTG, 8, ACGTG at 4339, ACGTG at 3288, ACGTG at 2760, ACGTG at 2425, ACGTG at 1999, ACGTG at 1718, ACGTG at 1346, ACGTG at 1338.
# negative strand, positive direction, looking for ACGTG, 1, ACGTG at 570.
# positive strand, negative direction, looking for ACGTG, 1, ACGTG at 4237.
# positive strand, positive direction, looking for ACGTG, 10, ACGTG at 4342, ACGTG at 3884, ACGTG at 3342, ACGTG at 3321, ACGTG at 2961, ACGTG at 1821, ACGTG at 1471, ACGTG at 1371, ACGTG at 1219, ACGTG at 547.
# complement, negative strand, negative direction, looking for TGCAC, 1, TGCAC at 4237.
# complement, negative strand, positive direction, looking for TGCAC, 10, TGCAC at 4342, TGCAC at 3884, TGCAC at 3342, TGCAC at 3321, TGCAC at 2961, TGCAC at 1821, TGCAC at 1471, TGCAC at 1371, TGCAC at 1219, TGCAC at 547.
# complement, positive strand, negative direction, looking for TGCAC, 8, TGCAC at 4339, TGCAC at 3288, TGCAC at 2760, TGCAC at 2425, TGCAC at 1999, TGCAC at 1718, TGCAC at 1346, TGCAC at 1338.
# complement, positive strand, positive direction, looking for TGCAC, 1, TGCAC at 570.
# inverse complement, negative strand, negative direction, looking for CACGT, 5, CACGT at 3429, CACGT at 2863, CACGT at 2081, CACGT at 1535, CACGT at 1470.
# inverse complement, negative strand, positive direction, looking for CACGT, 2, CACGT at 3254, CACGT at 569.
# inverse complement, positive strand, negative direction, looking for CACGT, 3, CACGT at 1772, CACGT at 531, CACGT at 342.
# inverse complement, positive strand, positive direction, looking for CACGT, 13, CACGT at 3960, CACGT at 3883, CACGT at 3464, CACGT at 2960, CACGT at 2800, CACGT at 2681, CACGT at 2334, CACGT at 2326, CACGT at 2063, CACGT at 1786, CACGT at 1218, CACGT at 783, CACGT at 546.
# inverse negative strand, negative direction, looking for GTGCA, 3, GTGCA at 1772, GTGCA at 531, GTGCA at 342.
# inverse negative strand, positive direction, looking for GTGCA, 13, GTGCA at 3960, GTGCA at 3883, GTGCA at 3464, GTGCA at 2960, GTGCA at 2800, GTGCA at 2681, GTGCA at 2334, GTGCA at 2326, GTGCA at 2063, GTGCA at 1786, GTGCA at 1218, GTGCA at 783, GTGCA at 546.
# inverse positive strand, negative direction, looking for GTGCA, 5, GTGCA at 3429, GTGCA at 2863, GTGCA at 2081, GTGCA at 1535, GTGCA at 1470.
# inverse positive strand, positive direction, looking for GTGCA, 2, GTGCA at 3254, GTGCA at 569.


===HxRE core promoters===
# GATCr1: GATC at 3860, GATC at 2995, GATC at 2834, GATC at 2757, GATC at 2724, GATC at 2626, GATC at 2250, GATC at 2230, GATC at 1798, GATC at 1789, GATC at 1779, GATC at 1335.
{{main|Core promoter gene transcriptions}}
# GATCr3: GATC at 3824, GATC at 2566, GATC at 2434, GATC at 1755, GATC at 1125, GATC at 968, GATC at 846.
Positive strand, positive direction: ACGTG at 4342, and complement.
# GATCr5: GATC at 4030, GATC at 2884, GATC at 2829, GATC at 2428, GATC at 1812, GATC at 1782, GATC at 1746, GATC at 1705, GATC at 1119, GATC at 943, GATC at 528.
# GATCr7: GATC at 3550, GATC at 3367, GATC at 2594, GATC at 2530, GATC at 2460, GATC at 1921, GATC at 1285, GATC at 1162, GATC at 1116, GATC at 1002, GATC at 501.
# GATCr9: GATC at 3582, GATC at 3444, GATC at 2724, GATC at 2484, GATC at 2430, GATC at 2282, GATC at 2236.


===HxRE proximal promoters===
===GATCr alternate positive direction (evens) (4050-1) distal promoters===
{{main|Proximal promoter gene transcriptions}}
Negative strand, negative direction: ACGTG at 4339, and complement.


Positive strand, negative direction: ACGTG at 4237, and complement.
# GATCr0: GATC at 3571, GATC at 3140, GATC at 3084, GATC at 2761, GATC at 2667, GATC at 2249, GATC at 1949, GATC at 1852, GATC at 924, GATC at 817, GATC at 736, GATC at 94.
# GATCr2: GATC at 3761, GATC at 3436, GATC at 3336, GATC at 2360, GATC at 1749, GATC at 1418, GATC at 1192, GATC at 266, GATC at 157.
# GATCr4: GATC at 3922, GATC at 3294, GATC at 3132, GATC at 3092, GATC at 3047, GATC at 2972, GATC at 2808, GATC at 2798, GATC at 2690, GATC at 1669, GATC at 1494, GATC at 1173, GATC at 65.
# GATCr6: GATC at 4049, GATC at 4038, GATC at 3047, GATC at 3026, GATC at 2936, GATC at 2874, GATC at 2390, GATC at 2221, GATC at 2213, GATC at 1012, GATC at 879, GATC at 755, GATC at 751, GATC at 732, GATC at 701, GATC at 508, GATC at 166.
# GATCr8: GATC at 3702, GATC at 3016, GATC at 2192, GATC at 1872, GATC at 1500, GATC at 1138, GATC at 1057, GATC at 974, GATC at 966, GATC at 864, GATC at 442, GATC at 337, GATC at 103, GATC at 26.


===HxRE distal promoters===
==GATC analysis and results==
{{main|Distal promoter gene transcriptions}}
{{main|Complex locus A1BG and ZNF497#GATCs}}
Negative strand, negative direction: CACGT at 3429, ACGTG at 3288, CACGT at 2863, ACGTG at 2760, ACGTG at 2425, CACGT at 2081, ACGTG at 1999, ACGTG at 1718, CACGT at 1535, CACGT at 1470, ACGTG at 1346, ACGTG at 1338, and complements.
"The [novel ABRE] ABREN, [GATCGATC], had the highest average score and highest average sites in the 1 kb upstream of the start codon of the highly ABA‐induced genes in aleurone."<ref name=Watanabe/>


Positive strand, negative direction: CACGT at 1772, CACGT at 531, CACGT at 342, and complements.
{|class="wikitable"
|-
! Reals or randoms !! Promoters !! direction !! Numbers !! Strands !! Occurrences !! Averages (± 0.1)
|-
| Reals || UTR || negative || 10 || 2 || 5 || 5 ± 2 (--3,+-7)
|-
| Randoms || UTR || arbitrary negative || 26 || 10 || 2.6 || 2.2 ± 0.4
|-
| Randoms || UTR || alternate negative || 18 || 10 || 1.8 || 2.2 ± 0.4
|-
| Reals || Core || negative || 0 || 2 || 0 || 0
|-
| Randoms || Core || arbitrary negative || 0 || 10 || 0 || 0.1
|-
| Randoms || Core || alternate negative || 2 || 10 || 0.2 || 0.1
|-
| Reals || Core || positive || 0 || 2 || 0 || 0
|-
| Randoms || Core || arbitrary positive || 3 || 10 || 0.3 || 0.4
|-
| Randoms || Core || alternate positive || 5 || 10 || 0.5 || 0.4
|-
| Reals || Proximal || negative || 0 || 2 || 0 || 0
|-
| Randoms || Proximal || arbitrary negative || 5 || 10 || 0.5 || 0.45
|-
| Randoms || Proximal || alternate negative || 4 || 10 || 0.4 || 0.45
|-
| Reals || Proximal || positive || 2 || 2 || 1 || 1 ± 0 (-+1,++1)
|-
| Randoms || Proximal || arbitrary positive || 2 || 10 || 0.2 || 0.15
|-
| Randoms || Proximal || alternate positive || 1 || 10 || 0.1 || 0.15
|-
| Reals || Distal || negative || 16 || 2 || 8 || 8 ± 5 (--3, +-13)
|-
| Randoms || Distal || arbitrary negative || 40 || 10 || 4.0 || 3.65
|-
| Randoms || Distal || alternate negative || 33 || 10 || 3.3 || 3.65
|-
| Reals || Distal || positive || 10 || 2 || 5 || 5 ± 0 (-+5,++5)
|-
| Randoms || Distal || arbitrary positive || 48 || 10 || 4.8 || 5.65 ± 0.85
|-
| Randoms || Distal || alternate positive || 65 || 10 || 6.5 || 5.65 ± 0.85
|}


Negative strand, positive direction: CACGT at 3254, ACGTG at 570, CACGT at 569, and complements.
Comparison:


Positive strand, positive direction: CACGT at 3960, ACGTG at 3884, CACGT at 3883, CACGT at 3464, ACGTG at 3342, ACGTG at 3321, ACGTG at 2961, CACGT at 2960, CACGT at 2800, CACGT at 2681, CACGT at 2334, CACGT at 2326, CACGT at 2063, ACGTG at 1821, CACGT at 1786, ACGTG at 1471, ACGTG at 1371, ACGTG at 1219, CACGT at 1218, CACGT at 783, ACGTG at 547, CACGT at 546, and complements.
The occurrences of real GATC UTRs and proximals are greater than the randoms, negative distals overlap the high randoms, positive distals are within the randoms. This suggests that the real GATCs are likely active or activable.


==Acknowledgements==
==Acknowledgements==
Line 208: Line 636:
* [[A1BG gene transcriptions]]
* [[A1BG gene transcriptions]]
* [[Complex locus A1BG and ZNF497]]
* [[Complex locus A1BG and ZNF497]]
* [[Hypoxia response element gene transcriptions]]
{{Div col end}}
{{Div col end}}


Line 224: Line 653:


<!-- footer categories -->
<!-- footer categories -->
[[Category:Resources last modified in January 2021]]

Latest revision as of 23:26, 17 October 2023

Associate Editor(s)-in-Chief: Henry A. Hoff

"The key cis-elements in [non-yellow coloring 1] NYC1 promoter, namely, ABA-response element (ABRE) (ACGTG), ACGT, GCCcore (GCCGCC), and ethylene-inducible 3 [EIN3-Like1] (EIN3)/EIL1-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]), can be targeted by ABA insensitive 3 (ABI3), ABI5, and ABF2, 3, 4 in the ABA-signaling pathway [60,61]. GCCGCC and EIN3/EIL1-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]) are induced by ethylene-inducible TF and EIN3/EIL1 in the ethylene signaling pathway [61]. Therefore, ABA signaling is crucial for [chlorophyll] Chl b reductase activities to catalyze the Chl degradation, the first part of leaf senescence."[1]

"The hypoxia response element (HRE) and estrogen response element (ERE) were located on −154 to −150 "ACGTG", and −94 to −80 "AGGTTATTGCCTCCT" on the transcript, respectively."[2]

Gene expressions

Main article: Gene expressions

Gene ID: 6522, aka AE2, SLC4A2 solute carrier family 4 member 2, "This gene encodes a member of the anion exchanger family of membrane transport proteins. The encoded protein regulates intracellular pH, biliary bicarbonate secretion, and chloride uptake. Reduced expression of this gene may be associated with primary biliary cirrhosis (PBC) in human patients, while differential expression of this gene may be associated with malignant hepatocellular carcinoma, colon and gastric cancers."[3]

"Abscisic acid (ABA) is a hormone conserved from cyanobacteria to higher plants, where it regulates responses to environmental stimuli. ABA also plays a role in mammalian physiology, pointedly in inflammatory responses and in glycemic control. As the animal ABA receptor is on the intracellular side of the plasma membrane, a transporter is required for the hormone's action. Here we demonstrate that ABA transport in human nucleated cells occurs via the anion exchanger AE2. Together with the recent demonstration that ABA influx into human erythrocytes occurs via Band 3, this result identifies the AE family members as the mammalian ABA transporters."[4]

Gene ID: 10314, LANCL1 LanC like glutathione S-transferase 1, "This gene encodes a loosely associated peripheral membrane protein related to the LanC family of bacterial membrane-associated proteins involved in the biosynthesis of antimicrobial peptides. This protein may play a role as a peptide-modifying enzyme component in eukaryotic cells. Previously considered a member of the G-protein-coupled receptor superfamily, this protein is now in the LanC family. Multiple alternatively spliced variants, encoding the same protein, have been identified."[5]

"The abscisic acid (ABA)/LANC-like protein 1/2 (LANCL1/2) hormone/receptor system regulates glucose uptake and oxidation, mitochondrial respiration, and proton gradient dissipation in myocytes. Oral ABA increases glucose uptake and the transcription of adipocyte browning-related genes in rodent brown adipose tissue (BAT). The aim of this study was to investigate the role of the ABA/LANCL system in human white and brown adipocyte thermogenesis. Immortalized human white and brown preadipocytes, virally infected to overexpress or silence LANCL1/2, were differentiated in vitro with or without ABA, and transcriptional and metabolic targets critical for thermogenesis were explored. The overexpression of LANCL1/2 increases, and their combined silencing conversely reduces mitochondrial number, basal, and maximal respiration rates; proton gradient dissipation; and the transcription of uncoupling genes and of receptors for thyroid and adrenergic hormones, both in brown and in white adipocytes. The transcriptional enhancement of receptors for browning hormones also occurs in BAT from ABA-treated mice, lacking LANCL2 but overexpressing LANCL1. The signaling pathway downstream of the ABA/LANCL system includes AMPK, PGC-1α, Sirt1, and the transcription factor ERRα. The ABA/LANCL system controls human brown and "beige" adipocyte thermogenesis, acting upstream of a key signaling pathway regulating energy metabolism, mitochondrial function, and thermogenesis."[6]

Gene ID: 50832, aka T2R4, "This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. These apparently intronless genes encode a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is clustered with another 3 candidate taste receptor genes in chromosome 7 and is genetically linked to loci that influence bitter perception."[7]

"Bitter taste receptors (T2Rs) belong to the G protein-coupled receptor superfamily. In humans, 25 T2Rs mediate bitter taste sensation. In addition to the oral cavity, T2Rs are expressed in many extraoral tissues, including the central nervous system, respiratory system, and reproductive system. To understand the mechanistic roles of the T2Rs in oral and extraoral tissues, novel blockers or antagonists are urgently needed. Recently, we elucidated the binding pocket of T2R4 for its agonist quinine, and an antagonist and inhibitory neurotransmitter, γ-aminobutyric acid. This structure-function information about T2R4 led us to screen the plant hormone abscisic acid (ABA), its precursor (xanthoxin), and catabolite phaseic acid for their ability to bind and activate or inhibit T2R4. Molecular docking studies followed by functional assays involving calcium imaging confirmed that ABA is an antagonist with an IC50 value of 34.4 ± 1.1 μM. However, ABA precursor xanthoxin acts as an agonist on T2R4. Interestingly, molecular model-guided site-directed mutagenesis suggests that the T2R4 residues involved in quinine binding are also predominantly involved in binding to the novel antagonist, ABA. The antagonist ability of ABA was tested using another T2R4 agonist, yohimbine. Our results suggest that ABA does not inhibit yohimbine-induced T2R4 activity. The discovery of natural bitter blockers has immense nutraceutical and physiological significance and will help in dissecting the T2R molecular pathways in various tissues."[8]

Gene ID: 51463, GPR89B G protein-coupled receptor 89B, "Enables voltage-gated anion channel activity. Involved in intracellular pH reduction. Located in Golgi cisterna membrane and Golgi-associated vesicle membrane."[9]

Abscisic acid G-protein coupled receptor (ABA_GPCR), variants 1 and 2 encode the same protein (isoform 1), variants 3 and 4 encode the same protein (isoform 2), variants 4 and 5 encode the same protein (isoform 3).[9]

Gene ID: 55915, aka GPR69B, LANCL2 LanC like glutathione S-transferase 2, "Enables phosphatidylinositol-3-phosphate binding activity; phosphatidylinositol-4-phosphate binding activity; and phosphatidylinositol-5-phosphate binding activity. Involved in negative regulation of transcription, DNA-templated and positive regulation of abscisic acid-activated signaling pathway. Located in several cellular components, including cortical actin cytoskeleton; cytosol; and nucleoplasm."[10]

Gene ID: 653519, GPR89A G protein-coupled receptor 89A, "Enables voltage-gated anion channel activity. Involved in intracellular pH reduction. Located in Golgi cisterna membrane and Golgi-associated vesicle membrane."[11]

Abscisic acid G-protein coupled receptor (ABA_GPCR), variant 1 represents the shortest transcript and encodes the longer isoform 1, variant 2 differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1, the encoded isoform 2 is shorter than isoform 1.[11]

Consensus sequences

Main article: Consensus sequence gene transcriptions

"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."[12]

"Many ABA‐inducible genes in various species contain a conserved cis‐regulatory ABA responsive element (ABRE) with the consensus sequence ACGTG(G/T)C (Hattori et al. 2002; Shen et al. 2004)."[12]

"The [novel ABRE] ABREN, [GATCGATC], had the highest average score and highest average sites in the 1 kb upstream of the start codon of the highly ABA‐induced genes in aleurone. The CGATCGAT motif [...] was identified by Bioprospector more times, but the average score and number of sites were lower. This sequence is almost identical to the ABREN but with a leading cytosine. The ABRE [ACGTGTCC] was the third highest scoring motif."[12]

Using the ABREN (GATCGATC), the CGATCGAT motif, and the ABRE (ACGTGTCC)[12] suggests a general consensus sequence of 5'-(A/C/G)(A/C/G)(A/G/T)(C/T)(C/G)(A/G/T)(A/C/T)(C/T)-3' which would allow 1944 combinations including the principal three variations. As the ABREN has the repeat pattern "GATC" and the CGATCGAT motif is similar with "CGAT", looking for the smaller GATCGAT may be more productive, while the ABRE as "ACGTGTCC" can be searched separately.

The more reduced consensus sequence 5'-GATCGAT-3' may be a better choice while the ABRE 5'-ACGTGTCC-3' could be examined separately.

Hypotheses

  1. A1BG has no ABA-response elements in either promoter.
  2. A1BG is not transcribed by an ABA-response element.
  3. ABA-response elements do not participate in the transcription of A1BG.

ABREN samplings

Copying 5'-CCGTCTCC-3' in "⌘F" yields two between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.

Copying 5'-CAGCCACC-3' in "⌘F" yields none between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.

The last two above could be combined as 5'-C(A/C)G(C/T)C(A/T)CC-3' as another possible consensus sequence.

Copying 5'-GATCGAT-3' in "⌘F" yields none between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.

Copying 5'-T[TAG][GA]CGT[GA][TCA][TAG]-3' is 5'-T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)-3'.

For the Basic programs testing consensus sequence 3'-GATCGAT-5' (starting with SuccessablesABA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA--.bas, looking for 3'-GATCGAT-5', 0.
  2. negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA-+.bas, looking for 3'-GATCGAT-5', 0.
  3. positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA+-.bas, looking for 3'-GATCGAT-5', 0.
  4. positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA++.bas, looking for 3'-GATCGAT-5', 0.
  5. complement, negative strand, negative direction is SuccessablesABAc--.bas, looking for 3'-CTAGCTA-5', 0.
  6. complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAc-+.bas, looking for 3'-CTAGCTA-5', 0.
  7. complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAc+-.bas, looking for 3'-CTAGCTA-5', 0.
  8. complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAc++.bas, looking for 3'-CTAGCTA-5', 0.
  9. inverse complement, negative strand, negative direction is SuccessablesABAci--.bas, looking for 3'-ATCGATC-5', 0.
  10. inverse complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci-+.bas, looking for 3'-ATCGATC-5', 0.
  11. inverse complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAci+-.bas, looking for 3'-ATCGATC-5', 0.
  12. inverse complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci++.bas, looking for 3'-ATCGATC-5', 0.
  13. inverse negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAi--.bas, looking for 3'-TAGCTAG-5', 0.
  14. inverse negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAi-+.bas, looking for 3'-TAGCTAG-5', 0.
  15. inverse positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAi+-.bas, looking for 3'-TAGCTAG-5', 0.
  16. inverse positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAi++.bas, looking for 3'-TAGCTAG-5', 0.

ABRE samplings

Copying ACGTG in "⌘F" yields eight between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence ACGTG(G/T)C (starting with SuccessablesABA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA--.bas, looking for ACGTG(G/T)C: 0.
  2. negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA-+.bas, looking for ACGTG(G/T)C: 0.
  3. positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA+-.bas, looking for ACGTG(G/T)C: 1, ACGTGGC at 4239.
  4. positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA++.bas, looking for ACGTG(G/T)C: 2, ACGTGGC at 4344, ACGTGTC at 1823.
  5. inverse complement, negative strand, negative direction is SuccessablesABAci--.bas, looking for G(A/C)CACGT: 1, GACACGT at 3429.
  6. inverse complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci-+.bas, looking for G(A/C)CACGT: 0.
  7. inverse complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAci+-.bas, looking for G(A/C)CACGT: 0.
  8. inverse complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci++.bas, looking for G(A/C)CACGT: 1, GACACGT at 2960.

ABRE (4560-2846) UTRs

  1. Negative strand, negative direction: GACACGT at 3429.
  1. Positive strand, negative direction: ACGTGGC at 4239.

ABRE positive direction (4445-4265) core promoters

  1. Positive strand, positive direction: ACGTGGC at 4344.

ABRE positive direction (4050-1) distal promoters

  1. Positive strand, positive direction: GACACGT at 2960, ACGTGTC at 1823.

ABRE random dataset samplings

  1. ABREr0: 0.
  2. ABREr1: 0.
  3. ABREr2: 1, ACGTGTC at 1596.
  4. ABREr3: 1, ACGTGGC at 1439.
  5. ABREr4: 0.
  6. ABREr5: 0.
  7. ABREr6: 1, ACGTGTC at 2907.
  8. ABREr7: 1, ACGTGGC at 3536.
  9. ABREr8: 1, ACGTGTC at 916.
  10. ABREr9: 0.
  11. ABREr0ci: 0.
  12. ABREr1ci: 3, GACACGT at 3788, GCCACGT at 3298, GCCACGT at 191.
  13. ABREr2ci: 0.
  14. ABREr3ci: 2, GCCACGT at 4080, GCCACGT at 1482.
  15. ABREr4ci: 1, GACACGT at 2286.
  16. ABREr5ci: 0.
  17. ABREr6ci: 0.
  18. ABREr7ci: 1, GACACGT at 1391.
  19. ABREr8ci: 1, GCCACGT at 897.
  20. ABREr9ci: 1, GCCACGT at 874.

ABREr arbitrary (evens) (4560-2846) UTRs

  1. ABREr6: ACGTGTC at 2907.

ABREr alternate (odds) (4560-2846) UTRs

  1. ABREr7: ACGTGGC at 3536.
  2. ABREr1ci: GACACGT at 3788, GCCACGT at 3298.
  3. ABREr3ci: GCCACGT at 4080.

ABREr arbitrary positive direction (odds) (4265-4050) proximal promoters

  1. ABREr3ci: GCCACGT at 4080.

ABREr arbitrary negative direction (evens) (2596-1) distal promoters

  1. ABREr2: ACGTGTC at 1596.
  2. ABREr8: ACGTGTC at 916.
  3. ABREr4ci: GACACGT at 2286.
  4. ABREr8ci: GCCACGT at 897.

ABREr alternate negative direction (odds) (2596-1) distal promoters

  1. ABREr3: ACGTGGC at 1439.
  2. ABREr1ci: GCCACGT at 191.
  3. ABREr3ci: GCCACGT at 1482.
  4. ABREr7ci: GACACGT at 1391.
  5. ABREr9ci: GCCACGT at 874.

ABREr arbitrary positive direction (odds) (4050-1) distal promoters

  1. ABREr3: ACGTGGC at 1439.
  2. ABREr7: ACGTGGC at 3536.
  3. ABREr1ci: GACACGT at 3788, GCCACGT at 3298, GCCACGT at 191.
  4. ABREr3ci: GCCACGT at 1482.
  5. ABREr7ci: GACACGT at 1391.
  6. ABREr9ci: GCCACGT at 874.

ABREr alternate positive direction (evens) (4050-1) distal promoters

  1. ABREr2: ACGTGTC at 1596.
  2. ABREr6: ACGTGTC at 2907.
  3. ABREr8: ACGTGTC at 916.
  4. ABREr4ci: GACACGT at 2286.
  5. ABREr8ci: GCCACGT at 897.

ABRE analysis and results

Main article: Complex locus A1BG and ZNF497 § Abscisic acid (ABA) response elements

"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."[12]

Reals or randoms Promoters direction Numbers Strands Occurrences Averages (± 0.1)
Reals UTR negative 2 2 1.0 1.0 ± 0 (--1,+-1)
Randoms UTR arbitrary negative 1 10 0.1 0.25 ± 0.15
Randoms UTR alternate negative 4 10 0.4 0.25 ± 0.15
Reals Core negative 0 2 0 0
Randoms Core arbitrary negative 0 10 0 0
Randoms Core alternate negative 0 10 0 0
Reals Core positive 1 2 0.5 0.5 ± 0.5 (-+0,++1)
Randoms Core arbitrary positive 0 10 0 0
Randoms Core alternate positive 0 10 0 0
Reals Proximal negative 0 2 0 0
Randoms Proximal arbitrary negative 0 10 0 0
Randoms Proximal alternate negative 0 10 0 0
Reals Proximal positive 0 2 0 0
Randoms Proximal arbitrary positive 1 10 0.1 0.05 ± 0.05
Randoms Proximal alternate positive 0 10 0 0.05 ± 0.05
Reals Distal negative 0 2 0 0
Randoms Distal arbitrary negative 4 10 0.4 0.45 ± 0.05
Randoms Distal alternate negative 5 10 0.5 0.45 ± 0.05
Reals Distal positive 2 2 1 1 ± 1 (-+0,++2)
Randoms Distal arbitrary positive 8 10 0.8 0.65 ± 0.15
Randoms Distal alternate positive 5 10 0.5 0.65 ± 0.15

Comparison:

The occurrences of real UTR, core and distal ABREs are greater than the randoms. This suggests that the real ABREs are likely active or activable.

ACGTGTCC samplings

For the Basic programs testing consensus sequence 3'-ACGTGTCC-5' (starting with SuccessablesABA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction is SuccessablesABA--.bas, looking for 3'-ACGTGTCC-5', 0.
  2. negative strand, positive direction is SuccessablesABA-+.bas, looking for 3'-ACGTGTCC-5', 0.
  3. positive strand, negative direction is SuccessablesABA+-.bas, looking for 3'-ACGTGTCC-5', 0.
  4. positive strand, positive direction is SuccessablesABA++.bas, looking for 3'-ACGTGTCC-5', 0.
  5. complement, negative strand, negative direction is SuccessablesABAc--.bas, looking for 3'-TGCACAGG-5', 0.
  6. complement, negative strand, positive direction is SuccessablesABAc-+.bas, looking for 3'-TGCACAGG-5', 0.
  7. complement, positive strand, negative direction is SuccessablesABAc+-.bas, looking for 3'-TGCACAGG-5', 0.
  8. complement, positive strand, positive direction is SuccessablesABAc++.bas, looking for 3'-TGCACAGG-5', 0.
  9. inverse complement, negative strand, negative direction is SuccessablesABAci--.bas, looking for 3'-GGACACGT-5', 0.
  10. inverse complement, negative strand, positive direction is SuccessablesABAci-+.bas, looking for 3'-GGACACGT-5', 0.
  11. inverse complement, positive strand, negative direction is SuccessablesABAci+-.bas, looking for 3'-GGACACGT-5', 0.
  12. inverse complement, positive strand, positive direction is SuccessablesABAci++.bas, looking for 3'-GGACACGT-5', 0.
  13. inverse negative strand, negative direction is SuccessablesABAi--.bas, looking for 3'-CCTGTGCA-5', 0.
  14. inverse negative strand, positive direction is SuccessablesABAi-+.bas, looking for 3'-CCTGTGCA-5', 0.
  15. inverse positive strand, negative direction is SuccessablesABAi+-.bas, looking for 3'-CCTGTGCA-5', 0.
  16. inverse positive strand, positive direction is SuccessablesABAi++.bas, looking for 3'-CCTGTGCA-5', 0.

Discussion

Abscisic acid (ABA) response elements (ABREs) have been identified for example in the UTR for A1BG between ZSCAN22 and A1BG. If these response elements are active then A1BG can be transcribed as a key cis-regulatory element in ABA signaling. "However, for ABA responsive transcription to occur, a single copy of the ABRE is not sufficient. In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996). It was also shown that a pair of ABREs can function as an ABRC with the second ABRE playing the role of the coupling element in rice (Hobo et al. 1999), barley (Shen et al. 1996) and Arabidopsis (Nakashima et al. 2006). Coupling of two CE3s is much less active in conferring ABA response to the minimal promoter (Shen et al. 2004). Interestingly, CE3 appears to be specific to monocots. In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."[12]

No coupling elements occur in the negative direction between ZSCAN22 and A1BG. Two ABREs occur in both directions suggesting pairs may be available to function as an ABRC on either side of A1BG, subject to needed proximity. The random datasets have more occurrences further away from A1BG and always much fewer occurrences per dataset. These suggest that those around A1BG are not random and are likely active or activable.

No DRE (TACCGACAT) occurs in either direction of A1BG.

Testing on Google Scholar: A1BG "ABA responsive element" - did not match any articles. Testing: A1BG ABRE produced 6 articles but ABRE in the first was not Abscisic acid (ABA) response element (ABRE). One other contained the Spanish word abre. The only ABRE found in the promoters of A1BG is ACGTG(G/T)C (Watanabe) with four occurrences. Coupling element (CE1) is absent but CE3 is present as GCGTGTC (Watanabe) and CACGCG (Ding). The DREB box or (CRT/DREB box) are absent.

An NIH Gene database search of "Homo sapiens" and "Abscisic acid" or ABRE produced no genes found.

ABA-signaling pathway

"The key cis-elements in [non-yellow coloring 1] NYC1 promoter, namely, ABA-response element (ABRE) (ACGTG), ACGT, GCCcore (GCCGCC), and ethylene-inducible 3 [EIN3-Like1] (EIN3)/EIL1-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]), can be targeted by ABA insensitive 3 (ABI3), ABI5, and ABF2, 3, 4 in the ABA-signaling pathway [60,61]."[1]

Ethylene signaling pathway

"GCCGCC and EIN3/EIL1-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]) are induced by ethylene-inducible TF and EIN3/EIL1 in the ethylene signaling pathway [61]."[1]

Gene ID: 1543, CYP1A1 cytochrome P450 family 1 subfamily A member 1 [ Homo sapiens (human) ]. Location: 15q24.1. "This gene, CYP1A1, encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. A related family member, CYP1A2, is located approximately 25 kb away from CYP1A1 on chromosome 15. Alternative splicing results in multiple transcript variants encoding distinct isoforms."[13] Traceable author statement: "involved in ethylene metabolic process"[14]

Gene ID: 1571, CYP2E1 cytochrome P450 family 2 subfamily E member 1 [ Homo sapiens (human) ]. Location: 10q26.3. "This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is induced by ethanol, the diabetic state, and starvation. The enzyme metabolizes both endogenous substrates, such as ethanol, acetone, and acetal, as well as exogenous substrates including benzene, carbon tetrachloride, ethylene glycol, and nitrosamines which are premutagens found in cigarette smoke. Due to its many substrates, this enzyme may be involved in such varied processes as gluconeogenesis, hepatic cirrhosis, diabetes, and cancer."[15] Metabolism of dichloroethylene by CYP450 WikiPathways WP3666.

Gene ID: 219681, ARMC3 armadillo repeat containing 3 [ Homo sapiens (human) ]. Location: 10p12.2. "Armadillo/beta-catenin (CTNNB1; MIM 116806)-like (ARM) domains are imperfect 45-amino acid repeats involved in protein-protein interactions. ARM domain-containing proteins, such as ARMC3, function in signal transduction, development, cell adhesion and mobility, and tumor initiation and metastasis (Li et al., 2006 [PubMed 16915934])."[16] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 3' coding region, compared to variant 1. This results in a shorter protein (isoform 2), compared to isoform 1. pfam14381 Location: 713 → 851: EDR1; Ethylene-responsive protein kinase Le-CTR1. Transcript Variant: This variant (4) lacks three exons in the 5' region and uses a downstream start codon compared to variant 1. It encodes isoform 4 which has a shorter N-terminus compared to isoform 1. pfam14381 Location: 457 → 595: EDR1; Ethylene-responsive protein kinase Le-CTR1. Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). pfam14381 Location: 720 → 858: EDR1; Ethylene-responsive protein kinase Le-CTR1.

cl00033: AP2 Superfamily: "DNA-binding domain found in transcription regulators in plants such as APETALA2 and EREBP (ethylene responsive element binding protein). In EREBPs the domain specifically binds to the 11bp GCC box of the ethylene response element (ERE), a promotor element essential for ethylene responsiveness. EREBPs and the C-repeat binding factor CBF1, which is involved in stress response, contain a single copy of the AP2 domain. APETALA2-like proteins, which play a role in plant development contain two copies."[17]

cl04813: EIN3 Superfamily: "Ethylene insensitive 3 (EIN3) proteins are a family of plant DNA-binding proteins that regulate transcription in response to the gaseous plant hormone ethylene, and are essential for ethylene-mediated responses including the triple response, cell growth inhibition, and accelerated senescence."[18]

GATC samplings

For the Basic programs testing consensus sequence GATC (starting with SuccessablesGATC1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. Negative strand, negative direction: 6, GATC at 3493, GATC at 3462, GATC at 3369, GATC at 2313, GATC at 2093, GATC at 1306.
  2. Positive strand, negative direction: 20, GATC at 4475, GATC at 4288, GATC at 4157, GATC at 4006, GATC at 3488, GATC at 3276, GATC at 3097, GATC at 2574, GATC at 2413, GATC at 2239, GATC at 1987, GATC at 1812, GATC at 1481, GATC at 1167, GATC at 972, GATC at 877, GATC at 703, GATC at 589, GATC at 525, GATC at 430.
  3. Negative strand, positive direction: 6, GATC at 4080, GATC at 2513, GATC at 2377, GATC at 2230, GATC at 964, GATC at 864.
  4. Positive strand, positive direction: 7, GATC at 4076, GATC at 4064, GATC at 3521, GATC at 3483, GATC at 2638, GATC at 2481, GATC at 2167.
  5. inverse complement, is the same GATC.

GATC (4560-2846) UTRs

  1. Negative strand, negative direction: GATC at 3493, GATC at 3462, GATC at 3369.
  2. Positive strand, negative direction: GATC at 4475, GATC at 4288, GATC at 4157, GATC at 4006, GATC at 3488, GATC at 3276, GATC at 3097.

GATC positive direction (4265-4050) proximal promoters

  1. Negative strand, positive direction: GATC at 4080.
  2. Positive strand, positive direction: GATC at 4076, GATC at 4064.

GATC negative direction (2596-1) distal promoters

  1. Negative strand, negative direction: GATC at 2313, GATC at 2093, GATC at 1306.
  2. Positive strand, negative direction: GATC at 2574, GATC at 2413, GATC at 2239, GATC at 1987, GATC at 1812, GATC at 1481, GATC at 1167, GATC at 972, GATC at 877, GATC at 703, GATC at 589, GATC at 525, GATC at 430.

GATC positive direction (4050-1) distal promoters

  1. Negative strand, positive direction: GATC at 2513, GATC at 2377, GATC at 2230, GATC at 964, GATC at 864.
  2. Positive strand, positive direction: GATC at 3521, GATC at 3483, GATC at 2638, GATC at 2481, GATC at 2167.

GATC random dataset samplings

  1. GATCr0: 14, GATC at 4322, GATC at 4271, GATC at 3571, GATC at 3140, GATC at 3084, GATC at 2761, GATC at 2667, GATC at 2249, GATC at 1949, GATC at 1852, GATC at 924, GATC at 817, GATC at 736, GATC at 94.
  2. GATCr1: 14, GATC at 4398, GATC at 4079, GATC at 3860, GATC at 2995, GATC at 2834, GATC at 2757, GATC at 2724, GATC at 2626, GATC at 2250, GATC at 2230, GATC at 1798, GATC at 1789, GATC at 1779, GATC at 1335.
  3. GATCr2: 9, GATC at 3761, GATC at 3436, GATC at 3336, GATC at 2360, GATC at 1749, GATC at 1418, GATC at 1192, GATC at 266, GATC at 157.
  4. GATCr3: 9, GATC at 4551, GATC at 4372, GATC at 3824, GATC at 2566, GATC at 2434, GATC at 1755, GATC at 1125, GATC at 968, GATC at 846.
  5. GATCr4: 15, GATC at 4379, GATC at 4310, GATC at 3922, GATC at 3294, GATC at 3132, GATC at 3092, GATC at 3047, GATC at 2972, GATC at 2808, GATC at 2798, GATC at 2690, GATC at 1669, GATC at 1494, GATC at 1173, GATC at 65.
  6. GATCr5: 15, GATC at 4518, GATC at 4463, GATC at 4288, GATC at 4119, GATC at 4030, GATC at 2884, GATC at 2829, GATC at 2428, GATC at 1812, GATC at 1782, GATC at 1746, GATC at 1705, GATC at 1119, GATC at 943, GATC at 528.
  7. GATCr6: 18, GATC at 4310, GATC at 4049, GATC at 4038, GATC at 3047, GATC at 3026, GATC at 2936, GATC at 2874, GATC at 2390, GATC at 2221, GATC at 2213, GATC at 1012, GATC at 879, GATC at 755, GATC at 751, GATC at 732, GATC at 701, GATC at 508, GATC at 166.
  8. GATCr7: 12, GATC at 4552, GATC at 3550, GATC at 3367, GATC at 2594, GATC at 2530, GATC at 2460, GATC at 1921, GATC at 1285, GATC at 1162, GATC at 1116, GATC at 1002, GATC at 501.
  9. GATCr8: 15, GATC at 4188, GATC at 3702, GATC at 3016, GATC at 2192, GATC at 1872, GATC at 1500, GATC at 1138, GATC at 1057, GATC at 974, GATC at 966, GATC at 864, GATC at 442, GATC at 337, GATC at 103, GATC at 26.
  10. GATCr9: 7, GATC at 3582, GATC at 3444, GATC at 2724, GATC at 2484, GATC at 2430, GATC at 2282, GATC at 2236.

GATCr arbitrary (evens) (4560-2846) UTRs

  1. GATCr0: GATC at 4322, GATC at 4271, GATC at 3571, GATC at 3140, GATC at 3084.
  2. GATCr2: GATC at 3761, GATC at 3436, GATC at 3336.
  3. GATCr4: GATC at 4379, GATC at 4310, GATC at 3922, GATC at 3294, GATC at 3132, GATC at 3092, GATC at 3047, GATC at 2972.
  4. GATCr6: GATC at 4310, GATC at 4049, GATC at 4038, GATC at 3047, GATC at 3026, GATC at 2936, GATC at 2874.
  5. GATCr8: GATC at 4188, GATC at 3702, GATC at 3016.

GATCr alternate (odds) (4560-2846) UTRs

  1. GATCr1: GATC at 4398, GATC at 4079, GATC at 3860, GATC at 2995.
  2. GATCr3: GATC at 4551, GATC at 4372, GATC at 3824.
  3. GATCr5: GATC at 4518, GATC at 4463, GATC at 4288, GATC at 4119, GATC at 4030, GATC at 2884.
  4. GATCr7: GATC at 4552, GATC at 3550, GATC at 3367.
  5. GATCr9: GATC at 3582, GATC at 3444.

GATCr alternate negative direction (odds) (2846-2811) core promoters

  1. GATCr1: GATC at 2834.
  2. GATCr5: GATC at 2829.

GATCr arbitrary positive direction (odds) (4445-4265) core promoters

  1. GATCr1: GATC at 4398.
  2. GATCr3: GATC at 4372.
  3. GATCr5: GATC at 4288.

GATCr alternate positive direction (evens) (4445-4265) core promoters

  1. GATCr0: GATC at 4322, GATC at 4271.
  2. GATCr4: GATC at 4379, GATC at 4310.
  3. GATCr6: GATC at 4310.

GATCr arbitrary negative direction (evens) (2811-2596) proximal promoters

  1. GATCr0: GATC at 2761, GATC at 2667.
  2. GATCr4: GATC at 2808, GATC at 2798, GATC at 2690.

GATCr alternate negative direction (odds) (2811-2596) proximal promoters

  1. GATCr1: GATC at 2757, GATC at 2724, GATC at 2626.
  2. GATCr9: GATC at 2724.

GATCr arbitrary positive direction (odds) (4265-4050) proximal promoters

  1. GATCr1: GATC at 4079.
  2. GATCr5: GATC at 4119.

GATCr alternate positive direction (evens) (4265-4050) proximal promoters

  1. GATCr8: GATC at 4188.

GATCr arbitrary negative direction (evens) (2596-1) distal promoters

  1. GATCr0: GATC at 2249, GATC at 1949, GATC at 1852, GATC at 924, GATC at 817, GATC at 736, GATC at 94.
  2. GATCr2: GATC at 2360, GATC at 1749, GATC at 1418, GATC at 1192, GATC at 266, GATC at 157.
  3. GATCr4: GATC at 1669, GATC at 1494, GATC at 1173, GATC at 65.
  4. GATCr6: GATC at 2390, GATC at 2221, GATC at 2213, GATC at 1012, GATC at 879, GATC at 755, GATC at 751, GATC at 732, GATC at 701, GATC at 508, GATC at 166.
  5. GATCr8: GATC at 2192, GATC at 1872, GATC at 1500, GATC at 1138, GATC at 1057, GATC at 974, GATC at 966, GATC at 864, GATC at 442, GATC at 337, GATC at 103, GATC at 26.

GATCr alternate negative direction (odds) (2596-1) distal promoters

  1. GATCr1: GATC at 2250, GATC at 2230, GATC at 1798, GATC at 1789, GATC at 1779, GATC at 1335.
  2. GATCr3: GATC at 2566, GATC at 2434, GATC at 1755, GATC at 1125, GATC at 968, GATC at 846.
  3. GATCr5: GATC at 2428, GATC at 1812, GATC at 1782, GATC at 1746, GATC at 1705, GATC at 1119, GATC at 943, GATC at 528.
  4. GATCr7: GATC at 2594, GATC at 2530, GATC at 2460, GATC at 1921, GATC at 1285, GATC at 1162, GATC at 1116, GATC at 1002, GATC at 501.
  5. GATCr9: GATC at 2484, GATC at 2430, GATC at 2282, GATC at 2236.

GATCr arbitrary positive direction (odds) (4050-1) distal promoters

  1. GATCr1: GATC at 3860, GATC at 2995, GATC at 2834, GATC at 2757, GATC at 2724, GATC at 2626, GATC at 2250, GATC at 2230, GATC at 1798, GATC at 1789, GATC at 1779, GATC at 1335.
  2. GATCr3: GATC at 3824, GATC at 2566, GATC at 2434, GATC at 1755, GATC at 1125, GATC at 968, GATC at 846.
  3. GATCr5: GATC at 4030, GATC at 2884, GATC at 2829, GATC at 2428, GATC at 1812, GATC at 1782, GATC at 1746, GATC at 1705, GATC at 1119, GATC at 943, GATC at 528.
  4. GATCr7: GATC at 3550, GATC at 3367, GATC at 2594, GATC at 2530, GATC at 2460, GATC at 1921, GATC at 1285, GATC at 1162, GATC at 1116, GATC at 1002, GATC at 501.
  5. GATCr9: GATC at 3582, GATC at 3444, GATC at 2724, GATC at 2484, GATC at 2430, GATC at 2282, GATC at 2236.

GATCr alternate positive direction (evens) (4050-1) distal promoters

  1. GATCr0: GATC at 3571, GATC at 3140, GATC at 3084, GATC at 2761, GATC at 2667, GATC at 2249, GATC at 1949, GATC at 1852, GATC at 924, GATC at 817, GATC at 736, GATC at 94.
  2. GATCr2: GATC at 3761, GATC at 3436, GATC at 3336, GATC at 2360, GATC at 1749, GATC at 1418, GATC at 1192, GATC at 266, GATC at 157.
  3. GATCr4: GATC at 3922, GATC at 3294, GATC at 3132, GATC at 3092, GATC at 3047, GATC at 2972, GATC at 2808, GATC at 2798, GATC at 2690, GATC at 1669, GATC at 1494, GATC at 1173, GATC at 65.
  4. GATCr6: GATC at 4049, GATC at 4038, GATC at 3047, GATC at 3026, GATC at 2936, GATC at 2874, GATC at 2390, GATC at 2221, GATC at 2213, GATC at 1012, GATC at 879, GATC at 755, GATC at 751, GATC at 732, GATC at 701, GATC at 508, GATC at 166.
  5. GATCr8: GATC at 3702, GATC at 3016, GATC at 2192, GATC at 1872, GATC at 1500, GATC at 1138, GATC at 1057, GATC at 974, GATC at 966, GATC at 864, GATC at 442, GATC at 337, GATC at 103, GATC at 26.

GATC analysis and results

Main article: Complex locus A1BG and ZNF497 § GATCs

"The [novel ABRE] ABREN, [GATCGATC], had the highest average score and highest average sites in the 1 kb upstream of the start codon of the highly ABA‐induced genes in aleurone."[12]

Reals or randoms Promoters direction Numbers Strands Occurrences Averages (± 0.1)
Reals UTR negative 10 2 5 5 ± 2 (--3,+-7)
Randoms UTR arbitrary negative 26 10 2.6 2.2 ± 0.4
Randoms UTR alternate negative 18 10 1.8 2.2 ± 0.4
Reals Core negative 0 2 0 0
Randoms Core arbitrary negative 0 10 0 0.1
Randoms Core alternate negative 2 10 0.2 0.1
Reals Core positive 0 2 0 0
Randoms Core arbitrary positive 3 10 0.3 0.4
Randoms Core alternate positive 5 10 0.5 0.4
Reals Proximal negative 0 2 0 0
Randoms Proximal arbitrary negative 5 10 0.5 0.45
Randoms Proximal alternate negative 4 10 0.4 0.45
Reals Proximal positive 2 2 1 1 ± 0 (-+1,++1)
Randoms Proximal arbitrary positive 2 10 0.2 0.15
Randoms Proximal alternate positive 1 10 0.1 0.15
Reals Distal negative 16 2 8 8 ± 5 (--3, +-13)
Randoms Distal arbitrary negative 40 10 4.0 3.65
Randoms Distal alternate negative 33 10 3.3 3.65
Reals Distal positive 10 2 5 5 ± 0 (-+5,++5)
Randoms Distal arbitrary positive 48 10 4.8 5.65 ± 0.85
Randoms Distal alternate positive 65 10 6.5 5.65 ± 0.85

Comparison:

The occurrences of real GATC UTRs and proximals are greater than the randoms, negative distals overlap the high randoms, positive distals are within the randoms. This suggests that the real GATCs are likely active or activable.

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

Initial content for this page in some instances came from Wikiversity.

Initial content for this page in some instances came from Wikipedia.

Initial content for this page in some instances incorporates text from the United States National Library of Medicine.

See also

References

  1. ↑ 1.0 1.1 1.2 Muhammad Asad Ullah Asad, Shamsu Ado Zakari, Qian Zhao, Lujian Zhou, Yu Ye and Fangmin Cheng (10 January 2019). "Abiotic Stresses Intervene with ABA Signaling to Induce Destructive Metabolic Pathways Leading to Death: Premature Leaf Senescence in Plants". International Journal of Molecular Sciences. 20 (2): 256–278. doi:10.3390/ijms20020256. PMID 30634648. Retrieved 27 August 2020.
  2. ↑ Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
  3. ↑ RefSeq (November 2016). SLC4A2 solute carrier family 4 member 2 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 September 2023.
  4. ↑ Tiziana Vigliarolo, Elena Zocchi, Chiara Fresia, Valeria Booz, Lucrezia Guida (June 2016). "Abscisic acid influx into human nucleated cells occurs through the anion exchanger AE2". International Journal of Biochemistry & Cell Biology. 75: 99–103. doi:10.1016/j.biocel.2016.03.006. PMID 27015766. Retrieved 28 September 2023.
  5. ↑ RefSeq (November 2008). LANCL1 LanC like glutathione S-transferase 1 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 September 2023.
  6. ↑ Sonia Spinelli, Vanessa Cossu, Mario Passalacqua, Jacob B Hansen, Lucrezia Guida, Mirko Magnone, Gianmario Sambuceti, Cecilia Marini, Laura Sturla, Elena Zocchi (9 February 2023). "Abscisic acid influx into human nucleated cells occurs through the anion exchanger AE2". International Journal of Molecular Science. 24 (4): 3489. doi:10.3390/ijms24043489. PMID 36834900 Check |pmid= value (help). Retrieved 28 September 2023.
  7. ↑ RefSeq (November 2008). TAS2R4 taste 2 receptor member 4 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 September 2023.
  8. ↑ Sai P Pydi, Appalaraju Jaggupilli, Ken M Nelson, Suzanne R Abrams, Rajinder P Bhullar, Michele C Loewen, Prashen Chelikani (28 April 2015). "Abscisic Acid Acts as a Blocker of the Bitter Taste G Protein-Coupled Receptor T2R4". Biochemistry. 54 (16): 2622–31. doi:10.1021/acs.biochem.5b00265. PMID 25844797. Retrieved 28 September 2023.
  9. ↑ 9.0 9.1 Alliance of Genome Resources (April 2022). GPR89B G protein-coupled receptor 89B [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 September 2023.
  10. ↑ Alliance of Genome Resources (April 2022). LANCL2 LanC like glutathione S-transferase 2 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 September 2023.
  11. ↑ 11.0 11.1 Alliance of Genome Resources (April 2022). GPR89A G protein-coupled receptor 89A [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 28 September 2023.
  12. ↑ 12.0 12.1 12.2 12.3 12.4 12.5 12.6 Kenneth A. Watanabe, Arielle Homayouni, Lingkun Gu, Kuan‐Ying Huang, Tuan‐Hua David Ho, Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
  13. ↑ RefSeq (January 2016). CYP1A1 cytochrome P450 family 1 subfamily A member 1 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 3 May 2023.
  14. ↑ TAS (January 2016). CYP1A1 cytochrome P450 family 1 subfamily A member 1 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 3 May 2023.
  15. ↑ RefSeq (July 2008). CYP2E1 cytochrome P450 family 2 subfamily E member 1 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 3 May 2023.
  16. ↑ OMIM (March 2008). ARMC3 armadillo repeat containing 3 [ Homo sapiens (human) ]. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 3 May 2023.
  17. ↑ NCBI (8 March 2022). Conserved Protein Domain Family AP2. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 3 May 2023.
  18. ↑ NCBI (24 November 2020). Conserved Protein Domain Family EIN3. 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 3 May 2023.

External links


Retrieved from "https://www.wikidoc.org/index.php?title=ABA-response_element_gene_transcriptions&oldid=1736176"