A1BG response element gene transcriptions: Difference between revisions

Jump to navigation Jump to search
Line 977: Line 977:
|-
|-
|111. [[Gcn4p gene transcriptions|Gcn4ps]] || ATGACTCTT<ref name=Tang/> || N || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]]  
|111. [[Gcn4p gene transcriptions|Gcn4ps]] || ATGACTCTT<ref name=Tang/> || N || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]]  
|-
|112. [[GGC triplet gene transcriptions|GGC triplets]] || CCGNNNNCGG || Y || Negative strand, negative direction: CCGAGTACGG at 4118
|-
|-
|112. [[GARE gene transcriptions|Gibberellic acid responsive elements]]  
|112. [[GARE gene transcriptions|Gibberellic acid responsive elements]]  

Revision as of 16:46, 21 April 2021

Associate Editor(s)-in-Chief: Henry A. Hoff

Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"[1] are called response elements.

Hypotheses

  1. A1BG has no response elements in either promoter.
  2. A1BG is not transcribed by a response element.
  3. Each response element does not participate in the transcription of A1BG.

Response element testing

Response element
Name of elements Consensus sequences Testing Notes
Abbreviations variations Present (Y), Absent (N)
Authors
1. ABA responsive elements

(ABREs)

ACGTG(G/T)C Y -
2. novel ABA-response elements

(ABREN, novel ABRE)

GATCGATC, CGATCGAT, GATCGAT N ABREN, CGATCGAT motif, and core of ABREN and CGATCGAT motif.[2]
3. ABA-response element-like

(ABRE-like)

ACGTGTCC N third highest scoring motif.[2]
4. Activated B-cell Factor-1s

(ABFs)

CGTNNNNN(A/G)(C/T)GA(C/T) Y -
5. Abf1 regulatory factors CGTCCTCTACGAT N CGTNNNNNACGAT.[3]
6. A boxes TACGTA Y -
7. boxes A TGACTCT Y -
8. Abscisic acid-responsive elements (Pho4s), G boxes CACGTG.[4] Y -
9. ACGT-containing elements ACGT Y -
10. Activating protein 2

(AP2)

(Cohen)

GCCTGGCC Y -
11. Activating protein 2

(Cohen)

TCCCCCGCCC Y -
12. Activating protein 2

(Murata)

(C/G)CCN(3,4)GG(C/G) Y -
13. Activating proteins

(Murata)

GCCCACGGG N Activating protein 2.[5]
14. Activating protein 2

(Yao)

TCTTCCC Y -
15. Activating protein 2

(Yao)

CTCCCA Y -
16. Activating proteins

(AP-2)

(Yao)

GGCCAA N Activating protein 2 (AP-2).[6]
17. Activating transcription factors

(Burton)

(A/C/G)TT(A/G/T)C(A/G)TCA Y -
18. Activating transcription factors

(Kilberg)

(A/G/T)TT(A/G/T)CATCA Y -
19. Adenylate–uridylate rich elements

(Bakheet)

(A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) Y Negative strand, negative direction: TTTTATTTATTA at 4076
20. Adr1ps TTGG(A/G)G Y -
21. Aft1s (C/T)(A/G)CACCC(A/G) Y -
22. AGC boxes AGCCGCC Y -
23. AhR responsive element

(AHRE-II)

CATGN6C(A/T)TG Y -
24. AhR-responsive elements

(AHRE)

(Yao)

(G/T)NGCGTG(A/C)(C/G)A N in the promoter region of AhR responsive genes
25. Alpha-amylase conserved elements TATCCA N TATCCATCCATCC.[7]
26. Amino acid response elements

(AARE)

(Maruyama)

ATTGCATCA N AARE1 (ATTGCATCA)[8]
27. Amino acid response elements

(AARE)

(Broer)

TTTGCATCA N TTTGCATCA.[9][10]
28. Amino acid response element-like

(AARE-like)

TGGTGAAAG N AARE-like sequence (TGGTGAAAG, named AARE3).[8]
29. Androgen response elements

(AREs)

(Kouhpayeh)

GGTACANNNTGTTCT N GGTACACGGTGTTCT.[11]
30. Androgen response elements

(Kouhpayeh)

GGTACAnnnTGTTCT Y Positive strand: TGTTCT at 45, Negative strand: TGTTCT at 108

Positive strand: GGTACA at 3901, GGTACA at 3336, GGTACA at 2474

31. Androgen response elements

(Wilson)

AGAACANNNTGTTCT.[12] Y Negative strand: TGTTCT at 3759, TGTTCT at 3635, TGTTCT at 3340, TGTTCT at 3307; AGAACA at 4068, AGAACA at 3094, TGTTCT at 108, AGAACA at 281

Positive strand: AGAACA at 3668, AGAACA at 287, TGTTCT at 45

32. Androgen response elements

(AREs)

(Wilson)

TGATTCGTGAG N AGAACANNNTGTTCT.[12]
33. Antioxidant-electrophile responsive elements

(Lacher)

GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A Y -
34. Antioxidant-electrophile responsive elements

(Otsuki)

GTGAGGTCGC N GTGAGGTCGC.[13] or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A[14], an antioxidant response element (ARE)
35. ATA boxes AATAAA Y -
36. ATTTA elements

(Siegel)

ATTTA Y Positive strand, negative direction: ATTTA at 4535
37. Auxin response factors

(Ulmasov)

TGTCTC Y -
36. Auxin response factors

(Boer)

TGTCGG Y -
37. B-boxes

(Johnson)

TGGGCA Y -
38. boxes B

(Sanchez)

TGTCTCA Y -
39. B recognition elements

(BREu)

(G/C)(G/C)(G/A)CGCC Y -
40. CAAT boxes (C/T)(A/G)(A/G)CCAATC(A/G) N consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.
41. CadC binding domains TTANNNNT Y -
42. Calcineurin-responsive transcription factors TG(A/C)GCCNC Y -
43. Calcium-response elements CTATTTCGAG N CaRE1 CTATTTCGAG.[15]
44. Carbohydrate response elements

(ChREs)

CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG N ChoRE1, ChoRE2.[16]
45. Carbohydrate response elements ChoRE1 ACCGG, ChoRE2 CCCAT Y -
46. Carbon source-responsive elements

(CSREs)

CATTCATCCG N confers carbon source-dependent regulation
47. CAACTC regulatory elements

(CAREs)

CAACTC Y -
48. cAMP-responsive elements

(CREs), Aca1ps, Sko1ps

TGACGTCA Y same as Root specific elements
49. CArG boxes CCAAAAAT(G/A)G Y -
50. Cat8ps CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA Y -
51. CAT boxes CATTCCT Y -
52. Cbf1 regulatory factors TCACGTGA N strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end.
52. C-boxes

(Johnson)

GAGGCCATCT N GAGGCCATCT.[17]
53. C boxes

(Samarsky)

AGTAGT Y -
54. C-boxes

(Song)

GACGTC Y -
55. C/A hybrid boxes TGACGTAT N TGACGTAT.[18] A at the 12 position
56. hybrid C/G-boxes

(Song)

TGACGTGT Y -
57. C/T hybrid boxes TGACGTTA N TGACGTTA.[18] T at the 12 position
58. C boxes

(Voronina)

GGTGATG Y -
59. CCAAT-boxes-binding transcription factors

(Hap4p)

CCAAT Y -
60. CCCTC-binding factors

(CTCF)

NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T) N NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C).[19]
61. C/EBP boxes TTAGGACAT,[20] or TAGCATT.[6] N CCAAT-enhancer-binding site (C/EBP) is TAGCATT
62. Cell-cycle boxes

(CCBs)

CACGAAAA N "cell cycle box" is functional in either orientation, acting as an enhancer
63. Cell-cycle box variants

(CCBs)

CACGAAA, ACGAAA and C-CGAAA Y TTTCGTG at 3600, ACGAAA at 494, and TTTCGGG at 1752
62. Cell cycle regulation CCCAACGGT[7] N tomato genome-wide analysis
63. CENP-B boxes TTTCGTTGGAAGCGGGA N specifically localized at the centromere
64. CGCG boxes (A/C/G)CGCG(C/G/T) Y -
65. Circadian control elements CAANNNNATC Y -
66. Class C DNA binding sites CACGNG Y Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232
67. Coupling elements

(CE)

TGCCACCGG[2] N CE1 (Watanabe)
68. Cold-responsive elements CCGAC Y -
69. Copper response elements

(CuREs)

(Quinn)

TTTGC(T/G)C(A/G) Y Positive strand, negative direction: CGCGCAAA at 163
70. Copper response elements

(CuREs)

(Park)

TGTGCTCA Y Negative strand, positive direction: TGAGCACA at 3740
71. Coupling elements

(CE1s)

(Watanabe)

GCGTGTC Y -
72. Coupling elements

(CE3s)

(Ding)

CACGCG Y -
73. Cytoplasmic polyadenylation elements

(CPEs)

TTTTTAT Y Negative strand, negative direction: TTTTTAT at 4220, TTTTTAT at 4070
74. DAF-16 binding elements (A/G)(C/T)AAA(C/T)A Y -
75. DAF-16-associated elements

(DAE)

TGATAAG N DAF-16-associated element (DAE).[21]
76. D-boxes

(Mracek1)

GTTGTATAAC N GTTGTATAAC.[22]
77. D-boxes

(Mracek)

CTTATGTAAA (Mracek2) N CTTATGTAAA.[22]
78. D-boxes

(Johnson)

TCTCACA N TCTCACATT(A/C)AATAAGTCA is a D-box.[17]
79. D boxes

(Samarsky)

AGTCTG Y -
80. D boxes

(Voronina)

TCCTG Y -
81. D-boxes

(Motojima)

TGAGTGG Y -
82. Dioxin-responsive elements

(DREs)

TNGCGTG Y -
83. Defense and stress-responsive elements ATTTTCTTCA N ATTTTCTTCA.[7]
82. DNA damage response elements

(DREs)

(Smith)

TTTCAAT[23] N in the upstream repression sequence (URS)
84. DNA damage response elements

(DRE, core)

(Sumrada)

CCGCC Y -
85. DNA damage response elements

(DREs)

(Sumrada)

TAGCCGCCG of TAGCCGCCGRRRR.[24] N in the upstream repression sequence (URS)
86. DNA replication-related elements

(DREs)

TATCGATA N DNA replication-related element (DRE).[25]
87. Downstream B recognition elements (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) Y -
88. Downstream core elements

(DCEs)

CTTC...CTGT...AGC Y -
89. Downstream promoter elements

(DPEs)

(Juven-Gershon)

(A/G)G(A/T)(C/T)(A/C/G)T Y Negative strand, negative direction: AGGACC at 4546, AGTCCT at 4437, AGATGT at 4213, AGTTCT at 4179, GGTCCT at 4171, AGTCCT at 4139, GGACAT at 4122, AGATGT at 4063, AGTTCT at 4028, GGTTCT at 4020, GGTTGT at 3980, GGACAT at 3971, ACAACC at 3942, GGACCT at 3907, AGGACC at 3906, ACGACC at 3864, AGACCT at 3836, AGAACC at 3793, GGACCT at 3745, GGTCGT at 3732, AGGTCC at 3585, ATGACT at 3542, ATAACC at 3529, ACGTCT at 3431, GGTTCT at 3274, GGTCCT at 3250, AGTCCT at 3218, GGTTGT at 3138, AGTCCT at 3111, GGTCGT at 3071, GGACAT at 3062, AGATGT at 2989, ATATCT at 2903, GGTTAT at 2849

Positive strand, negative direction: AGACAT at 4508, AGATCC at 4476, AGAACC at 4451, AGTTCT at 4418, AGACGT at 4236, AGATGT at 3621, AGATAT at 3466, AGACAT at 3434, ATGTCT at 3833, AGGACT at 3640, ATGTCT at 2986, AGATAT at 2982, AGACAT at 2949, AGACAT at 2881

90. Downstream promoter elements

(DPEs)

(Kadonaga)

(A/G)G(A/T)CGTG Y Negative strand, negative direction: GGTCGTG at 3733, CACGTCT at 3431, GGTCGTG at 3072

Positive strand, negative direction: AGACGTG at 4237

88. Downstream promoter elements

(DPEs)

(Matsumoto)

AGTCTC Y Negative strand, negative direction: AGTCTC at 3645

Positive strand, negative direction: GAGACT at 4053

89. DREB boxes TACCGACAT N CRT/DREB box
90. E2 boxes (G/A)CAG(A/C/G/T)TG(A/C/G/T) Y -
91. EIF4E basal elements TTACCCCCCCTT N poly(C) motif
92. EIN3 binding sites A(C/T)G(A/T)A(C/T)CT Y -
93. Endoplasmic reticulum stress response elements

(ERSE)

CCAAT N CCAATGGGCTGAAAC between ZNF497 and A1BG, compare CCAAT-box and ERSE below
94. Endoplasmic reticulum stress response elements CCAAT-N9-CCACG, CCACG Y -
93. Endosperm expressions TGTGTCA Y -
94. Enhancer boxes CA(A/C/G/T)(A/C/G/T)TG Y -
95. Estrogen response elements

(EREs)

AGGTTA or GGTCAGGAT N AGGTTATTGCCTCCT or GGTCAGGATGAC
96. Ethylene responsive elements ATTTCAAA Y -
97. F boxes TGATAAG[26] N F-box overlaps the I-box
98. Forkhead boxes GTAAACAA[27] N GTAAACAA FOXO1
99. Forkhead boxes (A/G)(C/T)AAA(C/T)A Y -
100. GAAC elements GAACT Y -
101. Gal4ps CGGACCGC N CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG[28]
102. γ-interferon activated sequences

(GAS)

TTCCTAGAA N ALS-GAS1 between nt −633 and nt −625
103. Γ-interferon activated sequences

(GAS), see STAT5

TTNCNNNAA Y -
104. GATA boxes GATA Y -
105. G boxes (G/T)CCACGTG(G/T)C N no "perfect palindrome" G boxes in either promoter
106. GC boxes

(Briggs)

(G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) Y -
107. GC boxes

(Ye)

GGGCGG Y Negative strand, negative direction: CCGCCC at 4000, CCGCCC at 3091
108. GCC boxes GCCGCC Y -
109. General control nonderepressible 4 protein binding site

(GCRE, GCN4)

TGA(C/G/T)T(A/C/G)(A/T) Y -
110. GCN4 motifs TGACTCA, TGAGTCA N ACGT motif
111. Gcn4ps ATGACTCTT[28] N GCN4 motifs
112. GGC triplets CCGNNNNCGG Y Negative strand, negative direction: CCGAGTACGG at 4118
112. Gibberellic acid responsive elements

(GAREs)

TAACAAA Y -
113. Gibberellin responsive elements

(GAREs)

(Sharma)

AAACAGA[7] Y -
114. GARE-like 1

(Fan)

TAACA(A/G)A[29] Y -
115. Gibberellin responsive element-like 2

(GARE-like 2)

(Fan)

TAACGTA[29] N "in the promoters of hydrolase genes".[29]
116. GLM boxes (G/A)TGA(G/C)TCA(T/C) N GCN4-like motif
117. G-protein-coupled receptors

(GCR1s), CT boxes

CTTCC Y -
118. Glucocorticoid response elements AGAACA Y -
119. Grainy head transcription factor binding sites AACCGGTT N also GACTGGTT
120. GT boxes

(Motojima)

TGGGTGGGGCT N (-78 to -69)
121. GT boxes

(Sato)

GGGG(T/A)GGGG Y Negative strand, Positive direction: GGGGAGGGG at 2291
122. Hac1 KAR2 CAGCGTG Y Positive strand, negative direction: CAGCGTG at 740, Negative strand, positive direction: CACGCTG at 778
123. H and ACA boxes AGAGGA Y -
124. Hapless motifs CCAATCA N heterotrimeric transcription factor, HAP2/3/4.[30]
125. H-boxes

(Lindsay)

CCTACC Y -
126. H box

(Mitchell)

ANANNA Y -
127. H box

(Rozhdestvensky)

ACACCA Y -
128. Heat-responsive elements AAAAAATTTC N four nGAAn motifs
129. Heat shock elements

(HSEs)

(Eastmond)

nGAAn-(5-bp)-nGAAnnTTCn Y Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
130. Heat shock elements

(HSEs)

(Eastmond)

nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP) Y Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
131. Heat shock elements

(HSEs)

(Eastmond)

nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP) Y Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332
132. Heat shock elements

(HSEs)

(Eastmond)

nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn Y Postive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831
133. Heat shock elements

(HSE1)

(Eastmond)

nGAAnnTTCnnGAAn N HSE1
134. Heat shock elements

(HSE2)

(Eastmond)

nTTCnnGAAnnTTCn N HSE2 is the inverse complement of HSE1
135. Heat shock elements

(HSE5)

(Eastmond)

nTTCn-(5-bp)-nTTCnnGAAn N HSE5
136. Heat shock elements

(HSE6)

(Eastmond)

nTTCn-nnGAAn-(5-bp)-nGAAn N HSE6
137. Heat shock elements

(HSE7)

(Eastmond)

nGA(A/G)nnTTCnnGAAn N HSE7 PFT1
138. Heat shock elements

(HSE)

(Eastmond)

nGAAnnTTCnnGA(A/G)n N HSE7 PFT2
139. Heat shock elements

(HSE10)

(Eastmond)

nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn N HSE10
140. Hex sequences TGACGTGGC Y Positive strand, positive direction: TGACGTGGC at 4344
141. High Mobility Group boxes

(HMG boxes)

(A/T)(A/T)CAAAG Y Positive strand, negative direction: ATCAAAG at 2891
142. HNF6s (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) Y Positive strand, negative direction: TTATTAATTC at 4542, TTATTAATCG at 4229, TAGTTGATAA at 3527
143. Homeoboxes CAAG Y -
144. HY boxes TG(A/T)GGG Y Negative strand, negative direction: CCCTCA at 4498, CCCTCA at 3889, CCCACA at 3184

Positive strand, negative direction: TGAGGG at 4558, TGTGGG at 3712, TGAGGG at 3652

145. Hypoxia-inducible factors GCCCTACGTGCTGTCTCA[31] N composed of HIF-1α and HIF-1β
146. Hypoxia response elements ACGTG Y Negative strand: ACGTG at 4339, CACGT at 3429, ACGTG at 3288, CACGT at 2863

Positive strand: ACGTG at 4237

147. I boxes GATAAG N GGATGAGATAAGA
148. Initiator elements

(Inrs)

YYANWYY Y Negative strand, negative direction: TTACTCC at 4557, TCACACT at 4361, TCGGACC at 4349, CCAGTTT at 4309, TCGGACC at 4300, GGTCCGA at 4255, CTGCACC at 4238, TCGGTCT at 4233

Positive strand, negative direction: GGAATGA at 4555, TTAATTC at 4542, TCACATT at 4533, AGTCCAA at 4502, CCACTTT at 4461, CCACTCC at 4425, CCACTCC at 4425, CCAGTTC at 4417, AGTGTGA at 4361, CTGCACT at 4340, CCGGACT at 4327, AAAATAA at 4221

149. Initiator elements

(Inrs)

BBCABW Y Negative strand, negative direction: TCTGGG at 4366, GTCACA at 4359, CCCACT at 4353, TGTGAC at 4336, GTCACT at 4319, TCCAGT at 4307, TCTGCA at 4236

Positive strand, negative direction: AATGAG at 4556, TTCACA at 4531, CCCACT at 4485, TCCACT at 4459, CCCAGA at 4448, TCCACT at 4423, GCCAGT at 4415, TGCACT at 4340, TGCAGT at 4317, GCCAGA at 4233

150. Initiator-like elements TTCTCT Y Negative strand: AGAGAA at 4527, TTCTCT at 3380
151. Inositol/choline-responsive elements

(ICRE)

(Case)

CANNTGAAAT N version of Lopes, see below
152. Inositol/choline-responsive elements

(ICRE)

(Case, Lopes)

CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991) Y -
153. Inositol/choline-responsive elements

(ICRE)

(Lopes)

ATGTGAAAT N using ANNTGAAAT
154. Inositol/choline-responsive elements

(ICREs)

(Schwank)

TYTTCACATGY contains the core sequence CANNTG Y -
155. Interferon regulatory factor

(IRF3)

GCTTTCC Y -
156. Interferon-stimulated response elements

(ISREs)

AGTTTCN2TTTCN N consensus sequence AGTTTCN2TTTCN.[32]
157. IFN-stimulated response elements

(ISREs)

(Lu)

GAAANNGAAA Y Negative strand, positive direction: GAAATAGAAA at 2629
158. IRS consensus

(Fujii)

AANNGAAA Y Positive strand, negative direction: AAAAGAAA at 4394, AAAAGAAA at 4389, AAAAGAAA at 4382, AATAGAAA at 4081
159. Tryptophan residues

(Lu)

GAAA Y Negative strand, negative direction: TTTC at 4504, GAAA at 4461
160. Jasmonic acid-responsive elements

(JAREs)

TGACG Y -
161. Kozak sequences GCCGCC(A/G)CCATGG N GCCGCC(A/G)CCATGG[33]
162. Kozak sequences

(Matsumoto)

GAAAATGG N GAAAATGG[34]
163. Krüppel-like factors GGGNN(G/T)(G/T)(G/T) Y -
164. L boxes AAATTAACCAA N AAATTAACCAA[35]
164. -35 sequence TTGACA Y Negative strand: TTGACA at 4399
165. Maf recognition element

(MAREs)

TGCTGA(G/C)TCAGCA N and TGCTGA(GC/CG)TCAGCA[36]
166. M boxes GTCATGTGCT N or AGTCATGTGCT[37]
167. Mcm1 regulatory factors TT(A/T)CCNN(A/T)TNGG(A/T)AA N Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.[3]
168. Met31ps AAACTGTG[38] Y Positive strand, negative direction: AAACTGTG at 4400
169. Metal responsive elements

(MRE)

TGC(A/G)C(A/C/G/T)C Y Positive strand: TGCACTC at 4341, TGCACTC at 3290, GTGTGCA at 2863
170. Middle sporulation element

(MSE)

(Branco)

ACACAAA Y Negative strand, negative direction: TTTGTGT at 3513
171. Midsporulation element

(MSE)

(Ozsarac)

C(A/G)CAAA(A/T) Y Negative strand, negative direction: TTTTGTG at 3512

Positive strand, negative direction: CACAAAA at 3767

172. Multicopy inhibitor of the GAL1 promoter

(MIG1)

(C/G)(C/T)GGGG Y Negative strand, negative direction: GTGGGG at 4445, GTGGGG at 3058

Positive strand, negative direction: CCCCAG at 4447, CTGGGG at 3037

173. Motif ten elements C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G) N Gene ID: 6309
174. Musashi binding elements

(MBEs)

(G/A)U1–3AGU Y Positive strand, positive direction: GTAGT at 4362.
175. Myeloblastosis recognition element

(MRE)

A(A/C)C(A/T)A(A/C)C Y Negative strand: GGTAGGT at 4457, ACCAACC at 3946, ACCAACC at 3606, GGTTGTT at 3139
176. Myocyte enhancer factors

(MEFs)

(C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) Y Negative strand, negative direction: TTATTATTAA at 4226
177. Nanos/Pumilio response elements

(PREs)

TGTAAAT Y Negative strand, negative direction: TGTAAAT at 4535
178. N-boxes

(Lee)

CCGGAA Y Negative strand, positive direction: TTCCGG at 4244
179. N-boxes

(Bai)

CACGAG Y Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232
180. N-boxes

(Gao)

CACGGC or CACGAC, CACG(A/G)C Y Negative strand, negative direction: CACGAC at 3956, GTCGTG at 3733, GTCGTG at 3072
180. N-boxes

(Leal)

CACNAG Y Positive strand, negative direction: CACGAG at 4472, CACAAG at 3634, CACTAG at 3493, CACTAG at 3369, CACGAG at 3232
181. Non-DiTyrosine 80 transcription factor DNA binding domain

(Ndt80)

(A/G/T)NC(A/G)CAAA(A/T) Y Negative strand, negative direction: TTTTGTGTT at 3514

Positive strand: ACCACAAAA at 3767

182. NF‐κB/Rel family of eukaryotic transcription factors CCCCTAAGGGG N NF-κB
183. Nuclear factor 1

(NF-1)

TTGGCNNNNNGCCAA N palindromic sequence
184. Nuclear factor of activated T cells

(NFATs)

GGAAAA Y Negative strand, negative direction: TTTTCC at 3441, TTTTCC at 3345

Positive strand, negative direction: GGAAAA at 2968, GGAAAA at 2927

185. Nuclear factor Ys CCAATGG(A/C)(A/G) N NF-Y is a trimeric complex
186. Nutrient-sensing response element 1 GTTTCATCA Y -
183. Oaf1 transcription factor CGGN3TNAN9-12CCG Y -
184. ORESARA1

(ORE1)

(Matallana)

(A/C/G)(A/C)GT(A/G)N5,6(C/T)AC(A/G) Y Negative strand, negative direction: GCGTAGAAGACACA at 3558, AAGTAGTTTCTACG at 2895
185. ORESARA1

(ORE1)

(Olsen)

T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) Y Negative strand, negative direction: TGACGTGAG at 4341, TAACGTGAG at 3290

Positive strand, negative direction: ATCACGCCA at 3282

186. p53 response elements (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) Y Positive strand, negative direction: AGACAAGCTT at 4186
187. p53 response elements

(Long1)

CAGGCCC Y Positive strand, positive direction: GGGCCTG at 745
188. p53 response elements

(Long2)

GGGCGTG Y Positive strand, negative direction: GGGCGTG at 3046
189. p63 DNA binding sites (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T) N RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
190. P-box (Mena) (A/T)AAAG Y Negative strand, negative direction: CTTTT at 4395, CTTTT at 4390, CTTTT at 4383, TAAAG at 3688, TAAAG at 2884

Positive strand, negative direction: AAAAG at 4391, AAAAG at 4386, AAAAG at 4379, AAAAG at 3440, AAAAG at 3344, CTTTT at 3019, TAAAG at 2857

191. P-box

(Motojima)

TGAGTTCA Y -
192. P-box

(Yu)

GTAA(T/C) Y Negative strand, negative direction: ATTAC at 3658, GTAAT at 3436, GTAAC at 3285, GTAAT at 2951

Positive strand, negative direction: GTAAT at 3973, ATTAC at 3469, GTAAT at 3064

191. Pdr1p/Pdr3ps TCCGCGGA N Pdr1p/Pdr3p response elements (PDREs)
192. Peroxisome proliferator-activated receptor alpha CGACCCC Y Negative strand, negative direction: CGACCCC at 3037
193. Peroxisome proliferator hormone response elements

(PPREs)

AGGTCANAGGTCA N PPARs/RXRs heterodimers bind to PPRE
194. Pho4ps CAC(A/G)T(T/G) Y Negative strand, negative direction: TTACAC at 4091, AACGTG at 3288, CACGTT at 2864

Positive strand, negative direction: CACATT at 4533

195. Pollen1 elements AGAAA Y Negative strand, negative direction: TTTCT at 4505, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, TTTCT at 4083, TTTCT at 3924, TTTCT at 3665, TTTCT at 3378, TTTCT at 2892

Positive strand, negative direction: AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAA at 3591, AGAAA at 3376, AGAAA at 3342

196. Pollen1 with TCCACCATA AGAAANNNNTCCACCATA N adjacent co-dependent regulatory element TCCACCATA
197. Polycomb response elements CGCCAT(A/T)TT N CGCCATTT
198. Polycomb response elements

(PRE)

GCCAT Y Positive strand, negative direction: GCCAT at 3685, ATGGC at 3629, GCCAT at 3283, ATGGC at 3005, ATGGC at 2907
199. Pribnow boxes TATAAT Y Negative strand, negative direction: TATAAT at 3468, TATAAT at 3454
200. Prolamin boxes TG(A/T)AAAG Y Negative strand, negative direction: TGTAAAG at 2884
201. Pyrimidine boxes CCTTTT Y Negative strand, negative direction: CCTTTT at 2968, CCTTTT at 2927

Positive strand, negative direction: AAAAGG at 3441, AAAAGG at 3345

202. Q elements

See Retinoic acid response element

AGGTCA Y Positive strand, negative direction: AGGTCA at 4307
203. Quinone reductase response element

(QRDRE)

(Yao)

TCCCCT of TCCCCTTGCGTG Y -
204. Rap1 regulatory factors ACCC(A/G)N(A/G)CA N "(ACCCRnRCA), less than half of the sites were detectably bound"[3]
205. Rap1 reduced consensus (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) Y Positive strand, positive direction: GAACCCACACCTC at 1807
206. Reb1 bound and exact occurrences TTACCC(G/T) Y Negative strand, negative direction: TTACCCT at 3661
207. Extended Reb1 ATTACCCGAA N "extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."[3]
208. Retinoic acid response element AG(A/G)TCA Y Negative strand, negative direction: TGATCT at 3463
209. Glucose transporter gene repressor

(Rgt1)

CGG(A/G)(A/T)N(A/T)(A/T) Y Negative strand, negative direction: ATTTTCCG at 3442
210. Rlm1ps CTATATATAG N CTA(T/A)4TAG
211. classic RORE motif

(RORE)

A(A/T)NTAGGTCA Y -
212. variant RORE motif C(T/A)(G/A)GGNCA Y Negative strand, negative direction: CTGGGACA at 4369, CTGGGACA at 4208
213. Rox1ps RRRTAACAAGAG N Heme-dependent repressor of hypoxic genes.[28]
214. Rpn4ps GGTGGCAAA N proteasome genes
215. R response elements

(RRE)

CATCTG Y Negative strand, negative direction: CAGATG at 4212, CAGATG at 2988

Positive strand, negative direction: CAGATG at 3919, CAGATG at 3627, CAGATG at 3620

216. Seed-specific elements CATGCATG N SRE consensus: CAGCAGATTGCG is none
217. Serum response elements

(SRE)

see CArG boxes

ACAGGATGT Y Negative strand, positive direction: ACAGGATGT at 3575
218. Servenius sequences GGACCCT Y Negative strand, negative direction: GGACCCT at 4548, GGACCCT at 4496, GGACCCT at 4302
219. Shoot specific elements GATAATGATG N SRE consensus: CAGCAGATTGCG is none
220. Sip4ps CC(C/G)T(C/T)C(C/G)TCCG N CC(C/G)T(C/T)C(C/G)TCCG[28]
221. Smp1ps ACTACTA(A/T)(A/T)(A/T)(A/T)TAG N ACTACTA(T/A)4TAG[28]
222. SP1

(Zhang)

(G/T)GGGCGG(G/A)(G/A)(C/T) Y see GC boxes above
223. SP1-box 1

(Motojima)

GGGGCT Y Positive strand, negative direction: GGGGCT at 3039
224. SP1-box 2

(Motojima)

CTGCCC Y Positive strand, negative direction: CTGCCC at 3853
225. SP-1

(Sato)

CCGCCCC Y Negative strand, positive direction: GGGGCGG at 4439, GGGGCGG at 4429
226. SP1

(Long)

GGGGCGGGCC N GGGGCGGGCC[16]
227. SP1

(Yao)

GCGGC Y Negative strand, negative direction: GCCGC at 2726

Positive strand, negative direction: GCGGC at 2725

228. STAT5 TTCNNNGAA Y Positive strand, negative direction: TTCCCTGAA at 3782, TTCGTTGAA at 3506
229. Sterol response elements

(Branco)

TCGTATA N perhaps plant specific
229. Sterol response elements

(Yao)

AGCAGATTGCG N liver specific
230. Stress-response elements

(STREs)

CCCCT Y Negative strand, negative direction: CCCCT at 2924

Positive strand, negative direction: CCCCT at 3059

231. Sucrose boxes NNAATCA Y Negative strand, negative direction: TGATTCC at 3474, TGATTTT at 3163, TGATTCG at 3032, TGATTCG at 2915
232. TACTAAC boxes TACTAA(C/T) Y Positive strand, positive direction: TACTAAT at 4157, ATTAGTA at 4148
233. TAGteams CAGGTAG Y Negative strand, positive direction: CAGGTAG at 4035, CTACCTG at 1198
234. Tapetum boxes TCGTGT Y Negative strand, negative direction: ACACGA at 4402, TCGTGT at 3915
235. TATA boxes TATA(A/T)A(A/T)(A/G) Y Negative strand, negative direction: TTTATATA at 2871

Positive strand, negative direction: TATATAAA at 2874

236. TAT Boxes

(Yang)

TATAAAA Y Negative strand, negative direction: TATAAAA at 2853
237. TAT Boxes

{Fan)

TATCCAT Y Negative strand, negative direction: ATGGATA at 2996
238. TATCCAC boxes TATCCAC N GA responsive complex component
239. T boxes

(Conlon)

TCACACCT Y positive strand: TCACACCT at 3968, TCACACCT at 1129
240. T boxes

(Zhang)

AACGTT Y positive strand: AACGTT at 2691, AACGTT at 1614
241. TCCACCATA elements TCCACCATA N adjacent co-dependent regulatory element of POLLEN1
242. Tec1ps GAATGT Y Ste12p cofactor
243. Telomeric repeat DNA-binding factors

(TRFs)

TTAGGG Y Negative strand, negative direction: TTAGGG at 3976, TTAGGG at 3067
244. Tetradecanoylphorbol-13-acetate response elements

(TREs)

TGA(G/C)TCA N cis-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
245. TGF-β control elements

(TCEs)

GAGTGGGGCG N in mouse and rat, GCGTGGGGGA in humans
246. TGF-β inhibitory elements

(TIEs)

GAGTGGTGA N in the rat transin/stromelysin promoter
247. Thyroid hormone response elements

(TREs)(THRs)

AGGTCA Y See VDREs, X boxes, Positive strand, negative direction: AGGTCA at 4307
248. Transcription factor 3

(TCF3)

GTCTGGT Y Negative strand, negative direction: GTCTGGT at 2122
249. Translational control sequences

(TCSs)

AUUAUCU (Wee1 TCS1), AUUGUCU (Wee1 TCS2) and UUUGUCU (Mos and PCM-1 TCS) Y Negative strand, negative direction: TTTGTCT at 4518, ATTATCT at 4079, TTTGTCT at 2878.
250. Unfolded protein response element

(URE) (UPRE-1)

CANCNTG Y Positive strand, negative direction: CAGCCTG at 4348, CATGGTG at 4109, CAGCCTG at 4036, CATCCTG at 3905, CACCCTG at 3743, CAGCCTG at 3297, CAAGGTG at 3143, CAGCCTG at 3127
251. Unfolded protein response elements

(UPREs)

TGACGTG(G/A) Y XBP1 binds to UPRE, Negative strand, negative direction: TGACGTGA at 4340
252. Upstream stimulating factors

(USFs)

GCC(A/T)NN(C/G/T)(A/G) Y Negative strand, negative direction: CGGTCCAC at 3953

Positive strand, negative direction: CAGATGGC at 3629

252. UUA rich elements

(Siegel)

TTATTTA(A/T)(A/T) Y Negative strand, negative direction: TTATTTATT at 4075
253. V boxes (A/G)TT(A/T)(C/T) Y Negative strand, negative direction: ATAAT at 4538, AAAAT at 4512, GTTTC at 4504, GAAAC at 4462, GTTTT at 4376, GTTTT at 4310, ATTAT at 4223, GTTTT at 4216

Positive strand, negative direction: ATTTT at 4511, AAAAC at 4396, AAAAC at 4311, ATAAT at 4225, ATAAT at 4222, AAAAT at 4219

254. Vhr1ps

(VHR1)

AATCA-N8-TGA(C/T)T N Response to low biotin concentrations
255. Vitamin D response elements

(VDREs)

(A/G)G(G/T)(G/T)CA Y Negative strand, negative direction: TGAACC at 4268, TGAACT at 4012, TGACCC at 3750, TGAACT at 3242, TGAACT at 3103, TGAACC at 2921
256. Vitamin D response elements

(VDREs)

A/GGG/TTCAnnnA/GGG/TTCA N (A/G)G(G/T)TCANNN(A/G)G(G/T)TCA
257. W boxes (C/T)TGAC(C/T) Y Negative strand, negative direction: GGTCAA at 4416, GGTCAA at 4308, CTGACC at 3749
258. X boxes GTTGGCATGGCAAC[4] N X2 box is AGGTCCA not ⌘F
259. X-boxes GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC[39] N includes GTTNCCATGGNAAC
260. Xbp1ps GcCTCGA(G/A)G(C/A)g(a/g) N Transcriptional repressor
261. X core promoter elements (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) Y Negative strand, negative direction: TGGTGGGACC at 3744
262. Xenobiotic response elements

(XREs)

GCGTG Y Positive strand, negative direction: CACGC at 3280, GCGTG at 3046
263. Xenobiotic response elements

(XREs)

(T/G)NGCGTG(A/C)(G/C)A N contains the core sequence GCGTG, see AHRE above
264. Yap recognition sequences TTACTAA Y Yap1, Yap2, Yap3, and Yap5
265. Y boxes (A/G)CTAACC(A/G)(A/G)(C/T) N inverted CAAT box
266. YY1 binding sites CCATCTT Y Negative strand, negative direction: CCATCTT at 1654
267. Zap1ps ACCCTCA N ACC(C/T)(C/T)(A/C/G/T)AAGGT
268. Z boxes A(C/T)A(C/G)GT(A/G)T Y Positive strand, negative direction: ACACCTGT at 3970, ATACCTAT at 2996
269. Zinc responsive elements

(ZREs)

MHHAACCBYNMRGGT N (A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

See also

References

  1. MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.
  2. 2.0 2.1 2.2 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
  3. 3.0 3.1 3.2 3.3 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
  4. 4.0 4.1 Z G E, Zhang YP, Zhou JH, Wang L (16 April 2014). "Mini review roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: name (help)
  5. Takayuki Murata; Chieko Noda; Yohei Narita1; Takahiro Watanabe; Masahiro Yoshida; Keiji Ashio; Yoshitaka Sato; Fumi Goshima; Teru Kanda; Hironori Yoshiyama; Tatsuya Tsurumi; Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.
  6. 6.0 6.1 Yao EF; Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.
  7. 7.0 7.1 7.2 7.3 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.
  8. 8.0 8.1 Ryuto Maruyama; Makoto Shimizu; Juan Li, Jun Inoue; Ryuichiro Sato (24 March 2016). "Fibroblast growth factor 21 induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region". Bioscience, Biotechnology, and Biochemistry. 80 (5): 929–934. doi:10.1080/09168451.2015.1135045. Retrieved 4 October 2020.
  9. Angelika Bröer; Gregory Gauthier-Coles; Farid Rahimi; Michelle van Geldermalsen; Dieter Dorsch􏰀; Ansgar Wegener; Jeff Holst; Stefan Bröer (March 15, 2019). "Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells" (PDF). Journal of Biological Chemistry. 294 (11): 4012–4026. doi:10.1074/jbc.RA118.006378. Retrieved 4 October 2020.
  10. Alisa A. Garaeva; Irina E. Kovaleva; Peter M. Chumakov; Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.
  11. S Kouhpayeh; AR Einizadeh; Z Hejazi; M Boshtam; L Shariati; M Mirian; L Darzi; M Sojoudi; H Khanahmad; A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.
  12. 12.0 12.1 Stephen Wilson; Jianfei Qi; Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.
  13. Akihito Otsuki; Mikiko Suzuki; Fumiki Katsuoka; Kouhei Tsuchida; Hiromi Suda; Masanobu Morita; Ritsuko Shimizu; Masayuki Yamamoto (February 2016). "Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection". Free Radical Biology and Medicine. 91: 45–57. doi:10.1016/j.freeradbiomed.2015.12.005. PMID 26677805. Retrieved 21 August 2020.
  14. Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.
  15. Xu Tao; Anne E. West; Wen G. Chen; Gabriel Corfas; Michael E. Greenberg (2002). "A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF". Neuron. 33: 383–95. doi:10.1016/S0896-6273(01)00561-X. PMID 11832226. Retrieved 2 September 2020.
  16. 16.0 16.1 Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.
  17. 17.0 17.1 PA Johnson; D Bunick; NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.
  18. 18.0 18.1 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.
  19. Hideharu Hashimoto; Dongxue Wang; John R. Horton; Xing Zhang; Victor G. Corces; Xiaodong Cheng (1 June 2017). "Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA". Molecular Cell. 66 (5): 711–720.e3. doi:10.1016/j.molcel.2017.05.004. PMID 28529057. Retrieved 28 August 2020.
  20. Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
  21. Yan-Hui Li; Gai-Gai Zhang (12 April 2016). "Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in Caenorhabditis elegans". Oncotarget. 7 (15): 19185–19192. doi:10.18632/oncotarget.8313. PMID 2702736. Retrieved 27 August 2020.
  22. 22.0 22.1 Philipp Mracek; Cristina Santoriello; M. Laura Idda; Cristina Pagano; Zohar Ben-Moshe; Yoav Gothilf; Daniela Vallone; Nicholas S. Foulkes (December 6, 2012). "Regulation of per and cry Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression". PLoS ONE. 7 (12): e51278. doi:10.1371/journal.pone.0051278. Retrieved 10 February 2019.
  23. Joshua J. Smith, Eric S. Cole, Daniel P. Romero (15 July 2004). "Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila". Nucleic Acids Research. 32 (14): 4313–4321. doi:10.1093/nar/gkh771. PMID 15304567. Retrieved 4 September 2020.
  24. Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.
  25. Fumiko Hirose; Masamitsu Yamaguchi; Akio Matsukage (September 1999). "Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc". Molecular and Cellular Biology. 19 (9): 6020–6028. doi:10.1128/MCB.19.9.6020. PMID 10454549. Retrieved 4 September 2020.
  26. Annkatrin Rose, Iris Meier and Udo Wienand (28 October 1999). "The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins". The Plant Journal. 20 (6): 641–652. doi:10.1046/j.1365-313X.1999.00638.x. Retrieved 8 November 2018.
  27. Eiji Yoshihara (18 August 2020). "TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis". Antioxidants. 9 (8): 765–84. doi:10.3390/antiox9080765. PMID 32824669 Check |pmid= value (help). Retrieved 5 September 2020.
  28. 28.0 28.1 28.2 28.3 28.4 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.
  29. 29.0 29.1 29.2 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.
  30. Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.
  31. Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
  32. Agata Michalska, Katarzyna Blaszczyk, Joanna Wesoly and Hans A. R. Bluyssen (28 May 2018). "A Positive Feedback Amplifier Circuit That Regulates Interferon (IFN)-Stimulated Gene Expression and Controls Type I and Type II IFN Responses". Frontiers in Immunology. 9: 1135. doi:10.3389/fimmu.2018.01135. Retrieved 18 March 2021.
  33. Marilyn Kozak (October 1987). "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs". Nucleic Acids Research. 15 (20): 8125–8148. doi:10.1093/nar/15.20.8125. PMID 3313277.
  34. Takuya Matsumoto; Saemi Kitajima; Chisato Yamamoto; Mitsuru Aoyagi; Yoshiharu Mitoma; Hiroyuki Harada; Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
  35. Robert G. K. Donald and Anthony R. Cashmore (1990). "Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS‐1A promoter". The EMBO Journal. 9 (6): 1717–1726. doi:10.1002/j.1460-2075.1990.tb08295.x. Retrieved 8 November 2018.
  36. Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto (13 February 2004). "Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique". Genes to Cells. 9 (2). doi:10.1111/j.1356-9597.2004.00711.x. Retrieved 8 September 2020.
  37. Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.
  38. Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. Retrieved 4 February 2021.
  39. Eduardo Moreno, Maša Lenuzzi, Christian Rödelsperger, Neel Prabh, Hanh Witte, Waltraud Roeseler, Metta Riebesell, Ralf J. Sommer (November 2018). "DAF‐19/RFX controls ciliogenesis and influences oxygen‐induced social behaviors in Pristionchus pacificus". Evolution & Development. 20 (6): 233–243. doi:10.1111/ede.12271. Retrieved 9 March 2021.

External links

{{Phosphate biochemistry}}