A1BG response element gene transcriptions: Difference between revisions

Jump to navigation Jump to search
VisualWikitext
 
(738 intermediate revisions by the same user not shown)
Line 17: Line 17:


==Response element testing==
==Response element testing==
{{main|A1BG regulatory elements and regions}}
{| class="wikitable sortable"
{| class="wikitable sortable"
|+ Response element
|+ Response element
|-
|-
! Name of elements !! Consensus sequences !! Testing !! Notes
! Name of elements, Abbreviations, Authors !! Consensus sequences, Variations !! Testing !! Order !! Resource !! nucleotides for one occurrence or likelihood found
|-
|1. ABA-response element-like, (ABRE-like) || ACGTGTCC || Absent || 27 || [[ABA-response element gene transcriptions|ABA-response elements]] 13:07, 8 October 2020 || 4<sup>8</sup>
|-
|2. ABA-response elements, novel, (ABREN, novel ABRE)
|| GATCGATC, CGATCGAT, GATCGAT || Absent || 28 || [[ABA-response element gene transcriptions|ABA-response elements]] 13:07, 8 October 2020 || 4<sup>7</sup>-4<sup>8</sup>
|-
|-
! Abbreviations !! variations !! Present (Y), Absent (N) !!
|3. ABA responsive elements (ABREs) || ACGTG(G/T)C || Present || 29 || [[ABA-response element gene transcriptions|ABA-response elements]] 05:53, 9 October 2020 || likely active or activable
|-
|-
! Authors !! !! !!
|4. Abf1 regulatory factors || CGTNNNNNACGAT || Absent || 31 || [[Abf1 regulatory factor gene transcriptions|Abf1 regulatory factors]] 18:32, 10 October 2020 || 4<sup>13</sup>
|-
|-
|1. [[ABA-response element gene transcriptions|ABA responsive elements]]
|5. A-boxes || TACGTA || Present || 26 || [[A box gene transcriptions|A-boxes]] 21:24, 7 October 2020 || likely active or activable
 
(ABREs)
|| ACGTG(G/T)C || Y || Positive strand, negative direction: ACGTGGC at 4239; positive strand, positive direction: ACGTGGC at 4344; positive strand, negative direction: CTGTGCA at 3429; positive strand, positive direction: GACACGT at 2960
|-
|-
|2. [[ABA-response element gene transcriptions|novel ABA-response elements]]
|6. Abscisic acid-responsive elements (Pho4s), G boxes || CACGTG || Present || 126 || [[Phosphate starvation-response transcription factor gene transcriptions|Abscisic acid-responsive elements (Pho4s)]], [[G box gene transcriptions|G boxes]] 06:38, 10 May 2022 || likely active or activable
 
(ABREN, novel ABRE)  
|| GATCGATC, CGATCGAT, GATCGAT || N || ABREN, CGATCGAT motif, and core of ABREN and CGATCGAT motif.<ref name=Watanabe>{{ cite journal
|author=Kenneth A. Watanabe
|author2=Arielle Homayouni
|author3=Lingkun Gu
|author4=Kuan‐Ying Huang
|author5=Tuan‐Hua David Ho
|author6=Qingxi J. Shen
|title=Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element
|journal=Plant, Cell & Environment
|date=18 June 2017
|volume=40
|issue=9
|pages=2004-2016
|url=https://onlinelibrary.wiley.com/doi/full/10.1111/pce.13006
|arxiv=
|bibcode=
|doi=10.1111/pce.13006
|pmid=
|accessdate=5 October 2020 }}</ref>
|-
|-
|3. [[ABA-response element gene transcriptions|ABA-response element-like]]  
|7. ACGT-containing elements || ACGT || Present || 182 || [[ACGT-containing element gene transcriptions|ACGT-containing elements]] 03:02, 25 September 2022 || cores, proximals likely active or activable, few UTRs, distals may be random
 
(ABRE-like)
|| ACGTGTCC || N || third highest scoring motif.<ref name=Watanabe/>
|-
|-
|4. [[Abf1 regulatory factor gene transcriptions|Activated B-cell Factor-1s]]
|8. Activated B-cell Factor-1s (ABFs, Abfms) || CGTNNNNN(A/G)(C/T)GA(C/T) || Present || 30 || [[Abf1 regulatory factor gene transcriptions|Abf1 regulatory factors]] 17:47, 10 October 2020 || likely active or activable
 
(ABFs)  
|| CGTNNNNN(A/G)(C/T)GA(C/T) || Y || -
|-
|-
|5. [[Abf1 regulatory factor gene transcriptions|Abf1 regulatory factors]] || CGTCCTCTACGAT || N || CGTNNNNNACGAT.<ref name=Rossi>{{ cite journal
|9. Activating proteins (APs), (Murata) || GCCCACGGG || Absent || 275 || [[Activating protein gene transcriptions|Activating proteins]] 05:32, 15 December 2022‎ || 4<sup>9</sup>  
|author=Matthew J. Rossi
|-
|author2=William K.M. Lai
|10. Activating protein 2 alpha (AP2a) || GCCNNNGGC || Present || 184 || [[Activating protein gene transcriptions|Activating protein 2 alpha]] 00:57, 29 September 2022‎‎ || likely active or activable, positive strand, positive direction within randoms
|author3=B. Franklin Pugh
|-
|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
|11. Activating protein 2 (AP2), (Cohen1) || GCCTGGCC || Present || 187 || [[Activating protein gene transcriptions|Activating protein 2]] 06:54, 30 September 2022 || likely active or activable
|journal=Genome Research
|date=21 March 2018
|volume=28
|issue=
|pages=497-508
|url=https://genome.cshlp.org/content/28/4/497.full
|arxiv=
|bibcode=
|doi=10.1101/gr.229518.117
|pmid=29563167
|accessdate=31 August 2020 }}</ref>
|-
|-
|6. [[A box gene transcriptions|A boxes]] || TACGTA || Y || -
|12. Activating protein 2, (Cohen2) || TCCCCCGCCC || Present || 188 || [[Activating protein gene transcriptions|Activating protein 2]] 07:41, 30 September 2022‎‎ || likely active or activable
|-
|-
|7. [[A box gene transcriptions|boxes A]] || TGACTCT || Y || -
|13. Activating protein 2, (Murata) || (C/G)CCN(3)GG(C/G) || Present || 183 || [[Activating protein gene transcriptions|Activating protein 2]] 23:47, 28 September 2022‎ || likely active or activable
|-
|-
|8. [[Phosphate starvation-response transcription factor gene transcriptions|Abscisic acid-responsive elements (Pho4s)]], [[G box gene transcriptions|G boxes]] || CACGTG.<ref name=Zhang>{{ cite journal
|14. Activating protein 2, (Murata) || (C/G)CCN(4)GG(C/G) || Present || 186 || [[Activating protein gene transcriptions|Activating protein 2]] 19:10, 29 September 2022‎ || likely active or activable
| vauthors = Z G E, Zhang YP, Zhou JH, Wang L
| title = Mini review roles of the bZIP gene family in rice
| journal = Genetics and Molecular Research
| volume = 13
| issue = 2
| pages = 3025–36
| date =16 April 2014
| pmid = 24782137
| doi = 10.4238/2014.April.16.11 }}</ref> || Y || -
|-
|-
|9. [[ACGT-containing element gene transcriptions|ACGT-containing elements]] || ACGT || Y || -
|15. Activating protein 2, (Yao1) || TCTTCCC || Present || 189 || [[Activating protein gene transcriptions|Activating protein 2]] 08:11, 30 September 2022 || likely active or activable
|-
|-
|10. [[Activating protein gene transcriptions|Activating protein 2]]  
|16. Activating protein 2, (Yao2) || CTCCCA || Present || 190 || [[Activating protein gene transcriptions|Activating protein 2]] 19:00, 30 September 2022‎ || likely active or activable
 
(AP2)
 
(Cohen)
|| GCCTGGCC || Y || -
|-
|-
|11. [[Activating protein gene transcriptions|Activating protein 2]]  
|17. Activating protein 2, (AP-2), (Yao3) || GGCCAA || Present || 191 || [[Activating protein gene transcriptions|Activating proteins]] 22:23, 30 September 2022‎‎ || likely active or activable
 
(Cohen)
|| TCCCCCGCCC || Y || -
|-
|-
|12. [[Activating protein gene transcriptions|Activating protein 2]]
|18. Activating protein 2, (AP-2), (Roesler) || CCCCACC(A/C) || Present || 353 || [[CAT box gene transcriptions|AP-2 (Roesler) samplings]] 19:31, 21 April 2023‎ || likely active or activable
 
(Murata)  
|| (C/G)CCN(3,4)GG(C/G) || Y || -  
|-
|-
|13. [[Activating protein gene transcriptions|Activating proteins]]
|19. Activating transcription factors, (ATF), (Burton) || (A/C/G)TT(A/G/T)C(A/G)TCA || Present || 192 || [[Activating transcription factor gene transcriptions|Activating transcription factors]] 01:48, 1 October 2022‎ || likely active or activable
 
|-
(Murata)  
|20. Activating transcription factors, (ATF), (Kilberg) || (A/G/T)TT(A/G/T)CATCA || Present || 193 || [[Activating transcription factor gene transcriptions|Activating transcription factors]] 02:21, 1 October 2022 || likely active or activable
|| GCCCACGGG || N || Activating protein 2.<ref name=Murata>{{ cite journal
|author=Takayuki Murata
|author2=Chieko Noda
|author3=Yohei Narita1
|author4=Takahiro Watanabe
|author5=Masahiro Yoshida
|author6=Keiji Ashio
|author7=Yoshitaka Sato
|author8=Fumi Goshima
|author9=Teru Kanda
|author10=Hironori Yoshiyama
|author11=Tatsuya Tsurumi
|author12=Hiroshi Kimura
|title=Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)
|journal=Journal of Virology
|date=27 January 2016
|volume=
|issue=
|pages=
|url=https://jvi.asm.org/content/jvi/early/2016/01/21/JVI.03227-15.full.pdf
|arxiv=
|bibcode=
|doi=10.1128/JVI.03227-15
|pmid=
|accessdate=4 October 2020 }}</ref>
|-
|-
|14. [[Activating protein gene transcriptions|Activating protein 2]]  
|21. Adenylate–uridylate rich elements, (AUREs), (Bakheet) || (A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) || Present || 116 || [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]] 02:16, 3 October 2021 || likely active or activable
 
(Yao)
|| TCTTCCC || Y || -
|-
|-
|15. [[Activating protein gene transcriptions|Activating protein 2]]  
|22. Adenylate–uridylate rich elements, (AREs), (Chen and Shyu, Class I) || ATTTA || Present || 273 || [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]] 04:44, 15 December 2022 || likely active or activable, UTRs at the lower end of the randoms
 
(Yao)
|| CTCCCA || Y || -
|-
|-
|16. [[Activating protein gene transcriptions|Activating proteins]]  
|23. Adenylate–uridylate rich elements, (AREs), (Chen and Shyu, Class II) || TTATTTA(A/T)(A/T) || Present || 272 || [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]] 04:31, 15 December 2022‎ || likely active or activable
 
|-
(AP-2)  
|24. Adenylate–uridylate rich elements, (AREs), (Chen and Shyu, Class III) || ATTT || Present || 271 || [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]] 04:06, 15 December 2022‎ || likely active or activable, low negative direction proximals overlap randoms
 
|-
(Yao)  
|25. Adr1ps, (ADR), (Tang 2020) || TTGG(A/G)G || Present || 268 || [[Adr1p gene transcriptions|Adr1ps]] 01:36, 15 December 2022‎ || likely active or activable
|| GGCCAA || N || Activating protein 2 (AP-2).<ref name=Yao/>  
|-
|26. Aft1s, (AFT) || (C/T)(A/G)CACCC(A/G) || Present || 194 || [[Aft1p gene transcriptions|Aft1s]] 15:48, 3 October 2022‎ || likely active or activable
|-
|27. AGC boxes || AGCCGCC (Leubner-Metzger 1998) || Present || 8 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Boxes/AGCs AGC boxes] 14:40, 2 May 2014 || likely active or activable
|-
|28. AhR DNA-binding consensus sequence, (AhRY), (Yao) || GCGTGNN(A/T)NNN(C/G) || Present || 234 || [[Xenobiotic response element gene transcriptions|AhR DNA-binding consensus sequence]] 05:37, 5 November 2022‎ || likely active or activable for ZNF497
|-
|29. AhR-responsive elements (AHRE) (Yao 1992) || (G/T)NGCGTG(A/C)(C/G)A || Absent || 84 || [[Xenobiotic response element gene transcriptions|AhR/ARNT complex]] 20:45, 17 February 2021 || 2<sup>3</sup>*4<sup>6</sup>  
|-
|-
|17. [[Activating transcription factor gene transcriptions|Activating transcription factors]]  
|30. Alpha-amylase conserved elements (Sharma 2020) || TATCCATCCATCC || Absent || 36 || [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements]] 22:18, 31 October 2020 || 4<sup>13</sup>
 
(Burton)
|| (A/C/G)TT(A/G/T)C(A/G)TCA || Y || -
|-
|-
|18. [[Activating transcription factor gene transcriptions|Activating transcription factors]]  
|31. Alpha-amylase conserved elements portion || TATCCA || Present || 347 || [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements portion]] 05:39, 11 April 2023 || likely active or activable
 
(Kilberg)
|| (A/G/T)TT(A/G/T)CATCA || Y || -
|-
|-
|19. [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]]  
|32. Amino acid response elements, (AARE1), (Maruyama) || ATTGCATCA || Absent || 110 || [[Amino acid response element gene transcriptions|Amino acid response elements]] 01:32, 22 May 2021 || 4<sup>9</sup>
 
(Bakheet)
|| (A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) || Y || Negative strand, negative direction: TTTTATTTATTA at 4076
|-
|-
|20. [[Adr1p gene transcriptions|Adr1ps]] || TTGG(A/G)G || Y || -
|33. Amino acid response elements, (AARE), (Broer) || TTTGCATCA<ref name=Broer/><ref name=Garaeva/> || Absent || 38 || [[Amino acid response element gene transcriptions|Amino acid response elements]] 01:59, 1 November 2020 || 4<sup>9</sup>
|-
|-
|21. [[Aft1p gene transcriptions|Aft1s]] || (C/T)(A/G)CACCC(A/G) || Y || -  
|34. Amino acid response element-like, (AARE-like), (AARE3), (Maruyama) || TGGTGAAAG || Absent || 39 || [[Amino acid response element gene transcriptions|Amino acid response element-like]] 02:27, 2 November 2020‎ || 4<sup>9</sup>
|-
|-
|22. [[AGC box gene transcriptions|AGC boxes]] || AGCCGCC || Y || -
|35. Androgen response elements, (AREs), (Kouhpayeh) || GGTACANNNTGTTCT || Absent || 40 || [[Androgen response element gene transcriptions|Androgen response elements]] 17:01, 2 November 2020 || 4<sup>12</sup>
|-
|-
|23. [[Xenobiotic responsive element gene transcriptions|AhR responsive element]]  
|36. Androgen response element1s, (Kouhpayeh) || GGTACA of GGTACAnnnTGTTCT || Present || 196 || [[Androgen response element gene transcriptions|Androgen response element1s]] 17:22, 4 October 2022 || likely active or activable
 
(AHRE-II)
|| CATGN<sub>6</sub>C(A/T)TG || Y || -
|-
|-
|24. [[Xenobiotic response element gene transcriptions|AhR-responsive elements]]  
|37. Androgen response element2s, (Kouhpayeh) || TGTTCT of GGTACAnnnTGTTCT || Present || 197 || [[Androgen response element gene transcriptions|Androgen response element2s]] 17:01, 5 October 2022‎ || likely active or activable
 
(AHRE)
 
(Yao)
|| (G/T)NGCGTG(A/C)(C/G)A || N || in the promoter region of AhR responsive genes
|-
|-
|25. [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements]] || TATCCA || N || TATCCATCCATCC.<ref name=Sharma>{{ cite journal
|38. Androgen response elements, (AREs), (Wilson) || AGAACANNNTGTTCT || Absent || 117 || [[Androgen response element gene transcriptions|Androgen response elements]] 16:21, 11 November 2021 || 4<sup>12</sup>
|author=Bhaskar Sharma
|-
|author2=Joemar Taganna
|39. Androgen response elements, (Wilson) || AGAACANNNTGTTCT || Present || 198 || [[Androgen response element gene transcriptions|Androgen response elements]] 18:53, 5 October 2022 || the two portions AGAACA and TGTTCT occurring separately are likely active or activable
|title=Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato
|-
|journal=Scientific Reports
|40. Angiotensinogen core promoter elements (AGCE) || (A/C)T(C/T)GTG || Present || 256 || [[AGCE gene transcriptions|Angiotensinogen core promoter elements]] 20:01, 5 December 2022 || likely active or activable, positive direction distal low occurrences overlap randoms
|date=12 June 2020
|-
|volume=10
|41. Antioxidant-electrophile responsive elements, (ARE), (Otsuki) || GTGAGGTCGC<ref name=Otsuki/> or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A<ref name=Lacher/> || Absent || 41 || [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]] 06:06, 4 November 2020 || (4/3)*2*4<sup>5</sup>-4<sup>10</sup>
|issue=9581
|-
|pages=
|42. Antioxidant-electrophile responsive elements, (Lacher) || GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A || Present || 199 || [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]] 23:22, 5 October 2022‎ || likely active or activable
|url=https://www.nature.com/articles/s41598-020-66553-1
|-
|arxiv=
|43. Aryl hydrocarbon responsive element II, (AHRE-II) || CATGN<sub>6</sub>C(A/T)TG || Present || 257 || [[Xenobiotic responsive element gene transcriptions|AhR responsive element or Aryl hydrocarbon responsive element II]] 18:04, 6 December 2022‎ || likely active or activable
|bibcode=
|-
|doi=10.1038/s41598-020-66553-1
|44. ATA boxes || AATAAA || Present || 267 || [[ATA box gene transcriptions|ATA boxes]] 19:59, 14 December 2022‎ || likely active or activable
|pmid=32533036
|-
|accessdate=27 August 2020 }}</ref>
|45. ATTTA elements, (Siegel) || (A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T) || Present || 270 || [[Adenylate–uridylate rich element gene transcriptions|ATTTA elements]] 04:04, 15 December 2022‎ || likely active or activable
|-
|46. Auxin response factors, (ARF), (Stigliani) || (C/G/T)(A/C/T)(G/T)G(C/T)(C/T)(G/T)(C/G)(A/C/T)(A/G/T) || Present || 235 || [[Auxin response factor gene transcriptions|Auxin response factors]] 05:55, 5 November 2022‎ || likely active or activable, positive direction proximals overlap high randoms, positive direction cores within randoms
|-
|47. Auxin response factors, (ARF), (Ulmasov) || TGTCTC || Present || 236 || [[Auxin response factor gene transcriptions|Auxin response factors]] 06:02, 5 November 2022‎ || likely active or activable
|-
|-
|26. [[Amino acid response element gene transcriptions|Amino acid response elements]]  
|48. Auxin response factors, (ARF), (Boer) || TGTCGG || Present || 200 || [[Auxin response factor gene transcriptions|Auxin response factors]] 17:03, 7 October 2022‎ || likely active or activable
 
(AARE)
 
(Maruyama)
|| ATTGCATCA || N || AARE1 (ATTGCATCA)<ref name=Maruyama/>
|-
|-
|27. [[Amino acid response element gene transcriptions|Amino acid response elements]]  
|49. Auxin response factors, (ARF5) || (C/G/T)N(G/T)GTC(G/T) || Present || 201 || [[Auxin response factor gene transcriptions|Auxin response factors]] 04:15, 10 October 2022 || likely active or activable, negative direction proximals ≥ randoms
 
|-
(AARE)  
|50. B-boxes, (Johnson) || TGGGCA || Present || 203 || [[B box gene transcriptions|B-boxes]] 18:05, 10 October 2022 || likely active or activable, positive direction distals ≥ randoms
 
|-
(Broer)
|51. boxes A || TGACTCT || Present || 125 || [[A box gene transcriptions|Box A]] 06:50, 9 May 2022‎ || likely active or activable
|| TTTGCATCA || N || TTTGCATCA.<ref name=Broer>{{ cite journal
|-
|author=Angelika Bröer
|52. boxes B, (Sanchez) || TGTCTCA || Present || 202 || [[B box gene transcriptions|boxes B]] 15:26, 10 October 2022 || likely active or activable
|author2=Gregory Gauthier-Coles
|-
|author3=Farid Rahimi
|53. B recognition elements, (BRE<sup>u</sup>) || (G/C)(G/C)(G/A)CGCC || Present || 255 || [[Factor II B recognition element gene transcriptions|B recognition elements]] 20:39, 4 December 2022 || likely active or activable
|author4=Michelle van Geldermalsen
|-
|author5=Dieter Dorsch􏰀
|54. CAACTC regulatory elements, (CAREs), (Fan) || CAACTC || Present || 122 || [[CARE gene transcriptions|CARE (Fan)]] 17:45, 7 May 2022 || likely active or activable
|author6=Ansgar Wegener
|-
|author7=Jeff Holst
|55. CAAT boxes || (C/T)(A/G)(A/G)CCAATC(A/G) || Absent || 14 || [[CAAT box gene transcriptions|CAAT boxes]] 02:41, 22 March 2019 || 4<sup>8</sup>, consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.  
|author8=Stefan Bröer
|-
|title=Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells
|56. CACA elements (Orlando 2019) || CACA || Present || 108 || [[Hypoxia response element gene transcriptions|CACA elements]] 05:04, 7 May 2021 || likely active or activable
|journal=Journal of Biological Chemistry
|-
|date=March 15, 2019
|57. CadC binding domains || TTANNNNT || Present || 204 || [[CadC binding domain gene transcriptions|CadC binding domains]] 22:14, 12 October 2022 || likely active or activable, negative direction proximals within randoms
|volume=294
|-
|issue=11
|58. Calcineurin-responsive transcription factors || TG(A/C)GCCNC || Present || 265 || [[Calcineurin-responsive transcription factor gene transcriptions|Calcineurin-responsive transcription factors]] 19:14, 12 December 2022‎ || likely active or activable
|pages=4012-4026
|-
|url=https://www.jbc.org/content/294/11/4012.full.pdf
|59. Calcium-response elements, (CaRE1s), (Tao 2002) || CTATTTCGAG || Absent || 42 || [[Calcium-response element gene transcriptions|Calcium-response elements]] 19:43, 7 November 2020‎ || 4<sup>10</sup>
|arxiv=
|-
|bibcode=
|60. Carbohydrate response elements, (ChREs), (ChoRE1, ChoRE2), (Long 2020) || CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG || Absent || 43 || [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] 20:50, 10 November 2020 || 4<sup>17</sup>  
|doi=10.1074/jbc.RA118.006378
|-
|pmid=
|61. Carbohydrate response elements, (ChoRE1), (Carb) || ACCGG || Present || 143 || [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] 18:56, 18 June 2022 || likely active or activable
|accessdate=4 October 2020 }}</ref><ref name=Garaeva>{{ cite journal
|-
|author=Alisa A. Garaeva
|62. Carbohydrate response elements, (ChoRE2), (Carb1) || CCCAT || Present || 205 || [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] 06:01, 13 October 2022 || likely active or activable
|author2=Irina E. Kovaleva
|-
|author3=Peter M. Chumakov
|63. Carbohydrate response elements, (Carb E1) || ATCTTG || Present || 206 || [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] 18:45, 13 October 2022‎ || proximals likely active or activable
|author4=Alexandra G. Evstafieva
|-
|title=Mitochondrial dysfunction induces ''SESN2'' gene expression through Activating Transcription Factor 4
|64. Carbohydrate response elements, (Carb E2) || CACGTG || Present || 207 || [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] 21:30, 13 October 2022 || likely active or activable
|journal=Cell Cycle
|-
|date=15 January 2016
|65. Carbohydrate response elements, (Carb E3) || TCCGCC || Present || 208 || [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] 01:21, 14 October 2022‎ || likely active or activable, low positive direction distals overlap high randoms
|volume=15
|-
|issue=1
|66. Carbon source-responsive elements, (CSREs) || CATTCATCCG || Absent || 105 || [[Carbon source-responsive element gene transcriptions|Carbon source-responsive elements]] 17:08, 19 March 2021 || 4<sup>10</sup>, confers carbon source-dependent regulation
|pages=64-71
|-
|url=https://www.tandfonline.com/doi/full/10.1080/15384101.2015.1120929
|67. Carbon source-responsive elements, (TCCGs) || TCCG || Present || 209 || [[Carbon source-responsive element gene transcriptions|TCCG elements]] 02:41, 16 October 2022 || likely active or activable
|arxiv=
|-
|bibcode=
|68. Carbon source-responsive elements, (CATTs) || CATTCA || Present || 210 || [[Carbon source-responsive element gene transcriptions|CATTCA elements]] 17:05, 18 October 2022 || likely active or activable
|doi=10.1080/15384101.2015.1120929
|-
|pmid=26771712
|69. CArG boxes, (Kamada 1992), (McDonald 2006) || CC(A/T)<sub>6</sub>GG || Absent || 211 || [[CArG box gene transcriptions|CArG boxes]] 19:08, 18 October 2022 || 2<sup>6</sup>*4<sup>4</sup>
|accessdate=5 September 2020 }}</ref>  
|-
|70. CArG boxes, (Deng 2011) || CCAAAAAT(G/A)G || Absent || 212 || [[CArG box gene transcriptions|CArG boxes]] 19:08, 18 October 2022 || 2*4<sup>9</sup>  
|-
|-
|28. [[Amino acid response element gene transcriptions|Amino acid response element-like]]  
|71. CArG boxes, (suggested more general motif), (Deng 2011) || C(C/A/T)(A/T)<sub>6</sub>(A/G)G from two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream || Present || 213 || [[CArG box gene transcriptions|CArG boxes]] 19:08, 18 October 2022 || likely active or activable, positive strand, negative direction: CATTAAAAGG at 3441 and CAAAAAAAAG at 1399
 
|-
(AARE-like)  
|72. Cat8ps, (Tang 2020) || CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA || Present || 214 || [[Cat8p gene transcriptions|Cat8ps]] 22:21, 18 October 2022 || likely active or activable
|| TGGTGAAAG || N || AARE-like sequence (TGGTGAAAG, named AARE3).<ref name=Maruyama>{{ cite journal
|-
|author=Ryuto Maruyama
|73. CAT boxes, (Saitoh 1993) || CATTCCT || Present || 215 || [[CAT box gene transcriptions|CAT boxes]] 23:56, 18 October 2022‎ || likely active or activable
|author2=Makoto Shimizu
|-
|author3=Juan Li, Jun Inoue
|74. CAT-box-like elements, (Berberich 1993) || GCCATT || Present || 216 || [[CAT box gene transcriptions|CAT-box-like elements]] 19:38, 20 October 2022‎ || likely active or activable
|author4=Ryuichiro Sato
|-
|title=''Fibroblast growth factor 21'' induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region
|75. Cbf1 regulatory factors || TCACGTGA || Absent || 112 || [[Cbf1 regulatory factor gene transcriptions|Cbf1 regulatory factors]] 15:57, 11 June 2021 || 4<sup>8</sup>  
|journal=Bioscience, Biotechnology, and Biochemistry
|-
|date=24 March 2016
|76. C-boxes, (Johnson) || GAGGCCATCT || Absent || 33 || [[C box gene transcriptions|C-boxes]] 02:51, 22 October 2020 || 4<sup>10</sup> 
|volume=80
|-
|issue=5
|77. C boxes, (Samarsky) || AGTAGT || Present || 217 || [[C box gene transcriptions|C boxes]] 02:22, 21 October 2022 || likely active or activable
|pages=929-934
|-
|url=https://www.tandfonline.com/doi/pdf/10.1080/09168451.2015.1135045
|78. C-boxes, (Song) || GACGTC || Present || 218 || [[C box gene transcriptions|C-boxes]] 06:22, 21 October 2022 || likely active or activable
|arxiv=
|-
|bibcode=
|79. C/A hybrid boxes, (Song) || TGACGTAT || Absent || 32 || [[C box gene transcriptions|C/A hybrid boxes]] 16:18, 20 October 2020 || 4<sup>8</sup>  
|doi=10.1080/09168451.2015.1135045
|pmid=
|accessdate=4 October 2020 }}</ref>  
|-
|-
|29. [[Androgen response element gene transcriptions|Androgen response elements]]  
|80. C/G hybrid boxes, (Song) || TGACGTGT || Present || 244 || [[C box gene transcriptions|CG hybrid boxes]] 18:35, 15 November 2022 || likely active or activable
 
|-
(AREs)  
|81. C/T hybrid boxes, (Song) || TGACGTTA || Absent || 34 || [[C box gene transcriptions|C/T hybrid boxes]] 01:51, 24 October 2020 || 4<sup>8</sup>  
 
|-
(Kouhpayeh)
|82. C boxes, (Voronina) || GGTGATG || Present || 243 || [[C box gene transcriptions|C boxes]] 18:28, 15 November 2022‎ || likely active or activable
|| GGTACANNNTGTTCT || N || GGTACACGGTGTTCT.<ref name=Kouhpayeh>{{ cite journal
|-
|author=S Kouhpayeh
|83. CCAAT-enhancer-binding site (C/EBP) activating transcription factor (ATF), or C/EBP-ATF responsive elements, (CAREs), (Garaeva) || (A/G/T)TT(A/G/T)CATCA || Present || 123 || [[CARE gene transcriptions|CARE (Garaeva)]] 01:10, 8 May 2022 || likely active or activable
|author2=AR Einizadeh
|-
|author3=Z Hejazi
|84. CCAAT-enhancer-binding site (C/EBP), C/EBP boxes || TTAGGACAT,<ref name=Misra/> or TAGCATT.<ref name=Yao/> || Absent || 44 || [[C-EBP box gene transcriptions|C/EBP boxes]] 23:21, 18 November 2020 || 4<sup>7</sup>-4<sup>9</sup>  
|author4=M Boshtam
|author5=L Shariati
|author6=M Mirian
|author7=L Darzi
|author8=M Sojoudi
|author9=H Khanahmad
|author10=A Rezaei
|title=Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line
|journal=Cancer Gene Therapy
|date=1 July 2016
|volume=23
|issue=
|pages=254-257
|url=https://www.researchgate.net/profile/Mina_Mirian/publication/304707422_Antiproliferative_effect_of_a_synthetic_aptamer_mimicking_androgen_response_elements_in_the_LNCaP_cell_line/links/59ffed00458515d0706e4f27/Antiproliferative-effect-of-a-synthetic-aptamer-mimicking-androgen-response-elements-in-the-LNCaP-cell-line.pdf
|arxiv=
|bibcode=
|doi=10.1038/cgt.2016.26
|pmid=
|accessdate=3 October 2020 }}</ref>  
|-
|-
|30. [[Androgen response element gene transcriptions|Androgen response elements]]
|85. CCCTC-binding factors, (CTCF), (Hashimoto 2017) || NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T) || Absent || 35 || [[CCCTC-binding factor gene transcriptions|CCCTC-binding factors]] 23:02, 24 October 2020‎ || 4<sup>9</sup>
 
(Kouhpayeh)  
|| GGTACAnnnTGTTCT || Y || Positive strand: TGTTCT at 45, Negative strand: TGTTCT at 108
 
Positive strand: GGTACA at 3901, GGTACA at 3336, GGTACA at 2474
|-
|-
|31. [[Androgen response element gene transcriptions|Androgen response elements]]  
|86. CCCTC-binding factors, (CTCF), (Lobanenkov 1990) || CCCTC || Present || 370 || [[CCCTC-binding factor gene transcriptions|CCCTC-binding factors]] 23:44, 12 May 2023 || likely active or activable
 
|-
(Wilson)  
|87. C clamp, (HMG DBD), (Cadigan 2012) || (C/G)CTTTGAT(C/G) || Absent || 367 || [[HMG box gene transcriptions|C clamp]] 06:03, 10 May 2023‎ || 4<sup>8</sup>
|| AGAACANNNTGTTCT.<ref name=Wilson>{{ cite journal
|-
|author=Stephen Wilson
|88. Cell-cycle boxes, (CCBs) || CACGAAAA || Absent || 107 || [[Cell-cycle box gene transcriptions|Cell-cycle boxes]] 22:13, 19 April 2021 || 4<sup>8</sup>, "cell cycle box" is functional in either orientation, acting as an enhancer
|author2=Jianfei Qi
|-
|author3=Fabian V. Filipp
|89. Cell-cycle box variants, (CCBs) || CACGAAA, ACGAAA and C-CGAAA || Present || 219 || [[Cell-cycle box gene transcriptions|Cell-cycle box variants]] 05:54, 23 October 2022 || likely active or activable
|title=Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines
|-
|journal=Scientific Reports
|90. Cell cycle regulation, (Sharma 2020) || CCCAACGGT || Absent || 45 || [[Cell cycle regulation gene transcriptions|Cell cycle regulation]] 20:53, 25 November 2020‎ || 4<sup>9</sup>
|date=14 September 2016
|-
|volume=6
|91. CENP-B boxes || TTTCGTTGGAAGCGGGA || Absent || 16 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Boxes/CENP-Bs CENP-B boxes] 13:25, 11 May 2019 || 4<sup>17</sup>, specifically localized at the centromere
|issue=
|-
|pages=32611
|92. CGCG boxes, (Yang 2002) || (A/C/G)CGCG(C/G/T) || Present || 264 || [[CGCG box gene transcriptions|CGCG boxes]] 07:14, 12 December 2022‎ || likely active or activable, probably for zinc fingers
|url=https://www.nature.com/articles/srep32611
|-
|arxiv=
|93. Circadian control elements || CAANNNNATC || Present || 263 || [[Circadian control element gene transcriptions|Circadian control elements]] 00:33, 12 December 2022 || likely active or activable but overlaps highest randoms
|bibcode=
|doi=10.1038/srep32611
|pmid=
|accessdate=3 October 2020 }}</ref> || Y || Negative strand: TGTTCT at 3759, TGTTCT at 3635, TGTTCT at 3340, TGTTCT at 3307; AGAACA at 4068, AGAACA at 3094, TGTTCT at 108, AGAACA at 281
 
Positive strand: AGAACA at 3668, AGAACA at 287, TGTTCT at 45
|-
|-
|32. [[Androgen response element gene transcriptions|Androgen response elements]]  
|94. Class C DNA binding sites, (Leal) || CACGNG || Present || 164 || [[N box gene transcriptions|Class C DNA binding sites]] 06:16, 5 August 2022 || likely active or activable, distals may be random
 
(AREs)
 
(Wilson)
|| TGATTCGTGAG || N || AGAACANNNTGTTCT.<ref name=Wilson/>
|-
|-
|33. [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]]  
|95. Cold-responsive elements || CCGAC || Present || 220 || [[Cold-responsive element gene transcriptions|Cold-responsive elements]] 05:34, 24 October 2022 || likely active or activable
 
(Lacher)
|| GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A || Y || -
|-
|-
|34. [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]]  
|96. Constitutive decay elements, (CDEs), (Siegel) || TTC(C/T)(A/G)(C/T)GAA || Present || 269 || [[Adenylate–uridylate rich element gene transcriptions|Constitutive decay elements]] 03:50, 15 December 2022‎ || likely active or activable possibly for ZNF497
 
|-
(Otsuki)  
|97. Copper response elements, (CuREs), (Quinn) || TTTGC(T/G)C(A/G) || Present || 221 ||[[Copper response element gene transcriptions|Copper response elements]] 07:57, 24 October 2022 || likely active or activable
|| GTGAGGTCGC || N || GTGAGGTCGC.<ref name=Otsuki>{{ cite journal
|-
|author=Akihito Otsuki
|98. Copper response elements, (CuREs), (Park) || TGTGCTCA || Present || 222 || [[Copper response element gene transcriptions|Copper response elements]] 05:45, 25 October 2022 || likely active or activable
|author2=Mikiko Suzuki
|-
|author3=Fumiki Katsuoka
|99. Coupling elements, (CE1), (Watanabe) || TGCCACCGG || Absent || 46 || [[Coupling element gene transcriptions|Coupling elements]] 01:51, 1 December 2020 || 4<sup>9</sup>  
|author4=Kouhei Tsuchida
|-
|author5=Hiromi Suda
|100. Coupling elements, (CE3s), (Watanabe) || GCGTGTC || Present || 118 || [[Coupling element gene transcriptions|Coupling elements]] 15:47, 12 February 2022‎ || likely active or activable
|author6=Masanobu Morita
|-
|author7=Ritsuko Shimizu
|101. Coupling elements, (CE3s), (Ding) || CACGCG || Present || 119 || [[Coupling element gene transcriptions|Coupling elements]] 02:59, 15 February 2022 || likely active or activable
|author8=Masayuki Yamamoto
|-
|title=Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection
|102. cyclic-AMP-responsive elements, (CREs), Aca1ps, Sko1ps, (Montminy 1986) || TGACGTCA || Present || 274 || [[CRE box gene transcriptions|cAMP-responsive elements]] 05:05, 15 December 2022 || likely active or activable, same as [[Root specific element gene transcriptions|Root specific elements]]
|journal=Free Radical Biology and Medicine
|-
|date=February 2016
|103. Cytokinin response regulators, (ARR1s) || AGATT(C/T) || Present || 227 || [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]] 16:21, 31 October 2022 || likely active or activable
|volume=91
|-
|issue=
|104. Cytokinin response regulators, (ARR10s) || (A/G)GATA(A/C)G || Present || 223 || [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]] 17:47, 27 October 2022 || likely active or activable or may be random
|pages=45-57
|-
|url=https://www.sciencedirect.com/science/article/abs/pii/S0891584915011478
|105. Cytokinin response regulators, (ARR12s) || (A/G)AGATA || Present || 224 || [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]] 06:09, 28 October 2022 || likely active or activable
|arxiv=
|-
|bibcode=
|106. Cytokinin response regulators, (ARRs), (Ferreira) || (G/A)GGAT(T/C) || Present || 225 || [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]] 03:25, 31 October 2022 || likely active or activable
|doi=10.1016/j.freeradbiomed.2015.12.005
|-
|pmid=26677805
|107. Cytokinin response regulators, (ARRs), (Rashotte1) || GATCTT || Present || 226 || [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]] 16:21, 31 October 2022‎ || likely active or activable
|accessdate=21 August 2020 }}</ref> or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A<ref name=Lacher>{{ cite journal
|-
|author=Sarah E. Lacher
|108. Cytokinin response regulators, (ARRs), (Rashotte2) || (G/A)GAT(T/C) || Present || 228 || [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]] 20:24, 1 November 2022 || likely active or activable
|author2=Daniel C. Levings
|-
|author3=Samuel Freeman
|109. Cytoplasmic polyadenylation elements, (CPEs) || TTTTTAT || Present || 160 || [[Cytoplasmic polyadenylation element gene transcriptions|Cytoplasmic polyadenylation elements]] 06:10, 25 July 2022‎ || likely active or activable
|author4=Matthew Slattery
|-
|title=Identification of a functional antioxidant response element at the HIF1A locus
|110. DAF-16-associated elements, (DAE), (Li) || TGATAAG || Absent || 47 || [[DAF-16-associated element gene transcriptions|DAF-16-associated elements]] 22:51, 3 December 2020 || 4<sup>7</sup>
|journal=Redox Biology
|-
|date=October 2018
|111. DAF-16 binding elements || (A/G)(C/T)AAA(C/T)A || Present || 229 || [[DAF-16 binding element gene transcriptions|DAF-16 binding elements]] 19:54, 2 November 2022 || likely active or activable
|volume=19
|-
|issue=
|112. D-boxes, (Mracek1) || GTTGTATAAC || Absent || 49 || [[D box gene transcriptions|D-boxes]] 02:46, 10 December 2020 || 4<sup>10</sup>  
|pages=401-411
|url=https://www.sciencedirect.com/science/article/pii/S2213231718305391
|arxiv=
|bibcode=
|doi=10.1016/j.redox.2018.08.014
|pmid=
|accessdate=6 October 2020 }}</ref>, an antioxidant response element (ARE)
|-
|-
|35. [[ATA box gene transcriptions|ATA boxes]] || AATAAA || Y || -
|113. D-boxes, (Mracek2) || CTTATGTAAA || Absent || 50 || [[D box gene transcriptions|D-boxes]] 02:20, 12 December 2020 || 4<sup>10</sup>
|-
|-
|36. [[Adenylate–uridylate rich element gene transcriptions|ATTTA elements]]
|114. D-boxes, (Johnson) || TCTCACATT(A/C)AATAAGTCA || Absent || 48 || [[D box gene transcriptions|D-boxes]] 04:12, 8 December 2020 || 2*4<sup>18</sup>
 
(Siegel)  
|| ATTTA || Y || Positive strand, negative direction: ATTTA at 4535
|-
|-
|37. [[Auxin response factor gene transcriptions|Auxin response factors]]  
|115. D boxes, (Samarsky) || AGTCTG || Present || 262 || [[D box gene transcriptions|D boxes]] 00:16, 12 December 2022 || likely active or activable
 
(Ulmasov)
|| TGTCTC || Y || -
|-
|-
|36. [[Auxin response factor gene transcriptions|Auxin response factors]]  
|116. D boxes, (Voronina) || TCCTG || Present || 230 || [[D box gene transcriptions|D boxes]] 02:28, 4 November 2022 || likely active or activable
 
(Boer)
|| TGTCGG || Y || -
|-
|-
|37. [[B box gene transcriptions|B-boxes]]  
|117. D-boxes, (Motojima) || TGAGTGG || Present || 261 || [[D box gene transcriptions|D-boxes]] 00:11, 12 December 2022 || likely active or activable
 
(Johnson)
|| TGGGCA || Y || -
|-
|-
|38. [[B box gene transcriptions|boxes B]]  
|118. Defense and stress-responsive elements, (Sharma) || ATTTTCTTCA || Absent || 51 || [[Defense and stress-responsive element gene transcriptions|Defense and stress-responsive elements]] 21:02, 13 December 2020 || 4<sup>10</sup>
 
|-
(Sanchez)  
|119. Destruction box, (D box), (Pfleger and Kirschner 2000) || CGN(C/T)TNAAN || Present || 371 || [[D box gene transcriptions|Destruction boxes]] 17:39, 15 May 2023 || likely active or activable
|| TGTCTCA || Y || -
|-
|120. Dioxin-responsive elements, (DREs) || TNGCGTG || Present || 231 || [[Xenobiotic response element gene transcriptions|Dioxin-responsive elements]] 20:43, 4 November 2022 || likely active or activable
|-
|121. DNA damage response elements, (DREs), (Smith) || TTTCAAT || Absent || 52 || [[DNA damage response element gene transcriptions|DNA damage response elements]] 12:25, 17 December 2020 || 4<sup>7</sup>
|-
|-
|39. [[Factor II B recognition element gene transcriptions|B recognition elements]]  
|122. DNA damage response elements, (DREs), (Sumrada) || TAGCCGCCG of TAGCCGCCGRRRR || Absent || 276 || [[DNA damage response element gene transcriptions|DNA damage response elements]] 06:31, 17 December 2022‎ || 4<sup>9</sup>-2<sup>4</sup>*4<sup>9</sup>
 
(BRE<sup>u</sup>)
|| (G/C)(G/C)(G/A)CGCC || Y || -
|-
|-
|40. [[CAAT box gene transcriptions|CAAT boxes]] || (C/T)(A/G)(A/G)CCAATC(A/G) || N || consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.
|123. DNA replication-related elements, (DREs), (Hirose) || TATCGATA || Absent || 53 || [[DNA replication-related element gene transcriptions|DNA replication-related elements]] 02:56, 20 December 2020‎ || 4<sup>8</sup>
|-
|-
|41. [[CadC binding domain gene transcriptions|CadC binding domains]] || TTANNNNT || Y || -
|124. Downstream B recognition elements || (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) || Present || 278 || [[Downstream TFIIB recognition element gene transcriptions|Downstream B recognition elements]] 22:45, 20 December 2022 || likely active or activable, negatives > randoms, positives overlap or outside randoms
|-
|-
|42. [[Calcineurin-responsive transcription factor gene transcriptions|Calcineurin-responsive transcription factors]] || TG(A/C)GCCNC || Y || -
|125. Downstream core elements, (DCESIs) || CTTC of CTTC...CTGT...AGC || Present || 279 || [[Downstream core element gene transcriptions|Downstream core elements]] 21:36, 22 December 2022 || likely active or activable, depending on overlaps
|-
|-
|43. [[Calcium-response element gene transcriptions|Calcium-response elements]] || CTATTTCGAG || N || CaRE1 CTATTTCGAG.<ref name=Tao>{{ cite journal
|126. Downstream core elements, (DCESIIs) || CTGT of CTTC...CTGT...AGC || Present || 280 || [[Downstream core element gene transcriptions|Downstream core elements]] 06:59, 26 December 2022 || likely active or activable, depending on overlaps
|author=Xu Tao
|author2=Anne E. West
|author3=Wen G. Chen
|author4=Gabriel Corfas
|author5=Michael E. Greenberg
|title=A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF
|journal=Neuron
|date=2002
|volume=33
|issue=
|pages=383-95
|url=https://www.cell.com/neuron/fulltext/S0896-6273(01)00561-X?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS089662730100561X%3Fshowall%3Dtrue
|arxiv=
|bibcode=
|doi=10.1016/S0896-6273(01)00561-X
|pmid=11832226
|accessdate=2 September 2020 }}</ref>
|-
|-
|44. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]]  
|127. Downstream core elements, (DCESIIIs) || AGC of CTTC...CTGT...AGC || Present || 281 || [[Downstream core element gene transcriptions|Downstream core elements]] 02:54, 28 December 2022 || likely active or activable, depending on overlaps
 
|-
(ChREs)  
|128. Downstream promoter elements, (DPEs), (Juven-Gershon 2010) || RGWYVT, (A/G)G(A/T)(C/T)(A/C/G)T || Present || 157 || [[Downstream promoter element gene transcriptions|Downstream promoter elements]] 05:18, 17 July 2022 || most or all of the real DPE (Juven-Gershon)s are likely active or activable
|| CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG || N || ChoRE1, ChoRE2.<ref name=Long>{{ cite journal
|-
|author=Jianyin Long
|129. Downstream promoter elements, (DPEs), (Butler 2002) || RGWYV or (A/G)G(A/T)(C/T)(A/C/G) || Present || 3 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Elements/Initiators Initiator elements] 21:32, 20 May 2012‎ || likely active or activable
|author2=Daniel L. Galvan
|author3=Koki Mise
|author4=Yashpal S. Kanwar
|author5=Li Li
|author6=Naravat Poungavrin
|author7=Paul A. Overbeek
|author8=Benny H. Chang
|author9=Farhad R. Danesh
|title=Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1
|journal=Journal of Biological Chemistry
|date=28 May 2020
|volume=5
|issue=28
|pages=
|url=https://www.jbc.org/content/early/2020/05/28/jbc.RA120.013228.full.pdf
|arxiv=
|bibcode=
|doi=10.1074/jbc.RA120.013228
|pmid=
|accessdate=6 October 2020 }}</ref>
|-
|-
|45. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] || ChoRE1 ACCGG, ChoRE2 CCCAT || Y
|130. Downstream promoter elements, (DPEs) (Butler 2002) || RGWYV or (A/G)G(A/T)(C/T)(A/C/G) || Present || 376 ||  [[Downstream promoter element gene transcriptions|Downstream promoter elements]] 19:59, 15 June 2023‎ || likely active or activable
|| -
|-
|-
|46. [[Carbon source-responsive element gene transcriptions|Carbon source-responsive elements]]  
|131. Downstream promoter elements, (DPEs), (Kadonaga) || (A/G)G(A/T)CGTG || Present || 155 || [[Downstream promoter element gene transcriptions|Downstream promoter elements]] 20:16, 16 July 2022‎ || likely active or activable
 
(CSREs)
|| CATTCATCCG || N || confers carbon source-dependent regulation
|-
|-
|47. [[CARE gene transcriptions|CAACTC regulatory elements]]  
|132. Downstream promoter elements, (DPEs), (Matsumoto) || AGTCTC || Present || 156 || [[Downstream promoter element gene transcriptions|Downstream promoter elements]] 21:32, 16 July 2022‎ || likely active or activable
 
(CAREs)
|| CAACTC || Y || -
|-
|-
|48. [[CRE box gene transcriptions|cAMP-responsive elements]]
|133. Downstream TFIIB recognition elements (BRE<sup>d</sup>, dBRE) (Deng 2005) || (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) || Present || 6 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Elements/Downstream_TFIIB_recognitions Downstream TFIIB recognition elements] 21:32, 11 February 2013 || likely active or activable
 
(CREs), Aca1ps, Sko1ps
|| TGACGTCA || Y || same as [[Root specific element gene transcriptions|Root specific elements]]
|-
|-
|49. [[CArG box gene transcriptions|CArG boxes]] || CCAAAAAT(G/A)G || Y || -
|134. DREB boxes (CRT/DREB box) || TACCGACAT || Absent || 21 || [[DREB box gene transcriptions|DREB boxes]] 17:03, 28 December 2019 || 4<sup>9</sup>
|-
|-
|50. [[Cat8p gene transcriptions|Cat8ps]] || CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA || Y || -
|135. E2 boxes || (A/G)CAGNTGN || Present || 195 || [[E2 box gene transcriptions|E2 boxes]] 17:04, 3 October 2022‎ || likely active or activable
|-
|-
|51. [[CAT box gene transcriptions|CAT boxes]] || CATTCCT || Y || -
|136. EIF4E basal elements (poly(C) motif) || TTACCCCCCCTT || Absent || 15 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Elements/EIF4E_basals EIF4E basal elements] 20:24, 30 March 2019 || 4<sup>12</sup>
|-
|-
|52. [[Cbf1 regulatory factor gene transcriptions|Cbf1 regulatory factors]] || TCACGTGA || N || strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end.
|137. EIN3 binding sites || A(C/T)G(A/T)A(C/T)CT || Present || 282 || [[EIN3 binding site gene transcriptions|EIN3 binding sites]] 01:44, 29 December 2022 || likely active or activable
|-
|-
|52. [[C box gene transcriptions|C-boxes]]  
|138. Endoplasmic reticulum stress response elements, (ERSE) || CCAAT-N9-CCACG || Absent || 284 || [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]] 01:58, 31 December 2022 || 4<sup>10</sup>
 
|-
(Johnson)  
|139. Endoplasmic reticulum stress response elements, (ESRE2) || CCACG, for part 1 (CCAAT) see Hap motif || Present || 283 || [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]] 01:57, 31 December 2022‎ || likely active or activable
|| GAGGCCATCT || N || GAGGCCATCT.<ref name=Johnson>{{ cite journal
|-
|author=PA Johnson
|140. Endosperm expressions || TGTGTCA || Present || 285 || [[Endosperm expression gene transcriptions|Endosperm expressions]] 03:16, 31 December 2022‎ || likely active or activable
|author2=D Bunick
|-
|author3=NB Hecht
|141. Enhancer boxes (E-box), (Massari 2000) || CANNTG || Present || 7 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Boxes/Enhancers Enhancer boxes] 22:01, 17 April 2013 || likely active or activable
|title=Protein Binding Regions in the Mouse and Rat Protamine-2 Genes
|-
|journal=Biology of Reproduction
|142. Estrogen response elements, (EREs), (Matsumoto) || AGGTTA or GGTCAGGAT of AGGTTATTGCCTCCT or GGTCAGGATGAC || Absent || 335 || [[Estrogen response element gene transcriptions|Estrogen response elements]] 05:34, 9 March 2023 || 4<sup>6</sup>-4<sup>12</sup>
|date=1991
|-
|volume=44
|143. Estrogen response elements, (EREs), (Yasar) || GGTCAGGATGAC || Absent || 336 || [[Estrogen response element gene transcriptions|Estrogen response elements]] 05:37, 9 March 2023 || 4<sup>12</sup>  
|issue=1
|pages=127-134
|url=https://academic.oup.com/biolreprod/article-pdf/44/1/127/10536199/biolreprod0127.pdf
|arxiv=
|bibcode=
|doi=10.1095/biolreprod44.1.127
|pmid=2015343
|accessdate=6 April 2019 }}</ref>  
|-
|-
|53. [[C box gene transcriptions|C boxes]]  
|144. Estrogen response elements, (ERE1s), (Driscoll) || GGTCA || Present || 338 || [[Estrogen response element gene transcriptions|Estrogen response elements]] 03:27, 14 March 2023‎ || likely active or activable
 
(Samarsky)
|| AGTAGT || Y || -
|-
|-
|54. [[C box gene transcriptions|C-boxes]]  
|145. Estrogen response elements, (ERE2s), (Driscoll) || TGACC || Present || 339 || [[Estrogen response element gene transcriptions|Estrogen response elements]] 03:37, 14 March 2023 || likely active or activable
 
(Song)
|| GACGTC || Y || -
|-
|-
|55. [[C box gene transcriptions|C/A hybrid boxes]] || TGACGTAT || N || TGACGTAT.<ref name=Song>{{ cite journal
|146. Ethylene responsive elements, (EtREs) || ATTTCAAA || Present || 237 || [[Ethylene responsive element gene transcriptions|Ethylene responsive elements]] 18:06, 5 November 2022‎ || likely active or activable
|author=Young Hun Song
|-
|author2=Cheol Min Yoo
|147. F boxes, (Rose) || TGATAAG || Absent || 67 || [[I box gene transcriptions|F boxes]] 05:52, 28 January 2021 || 4<sup>7</sup>, F-box overlaps the I-box
|author3=An Pio Hong
|author4=Seong Hee Kim
|author5=Hee Jeong Jeong
|author6=Su Young Shin
|author7=Hye Jin Kim
|author8=Dae-Jin Yun
|author9=Chae Oh Lim
|author10=Jeong Dong Bahk
|author11=Sang Yeol Lee
|author12=Ron T. Nagao
|author13=Joe L. Key
|author14=Jong Chan Hong
|title=DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins
|journal=Plant Physiology
|date=April 2008
|volume=146
|issue=4
|pages=1862–1877
|url=http://www.plantphysiol.org/content/plantphysiol/146/4/1862.full.pdf
|arxiv=
|bibcode=
|doi=10.1104/pp.107.113217
|pmid=18287490
|accessdate=26 March 2019 }}</ref> A at the 12 position
|-
|-
|56. [[C box gene transcriptions|hybrid C/G-boxes]]  
|148. Forkhead boxes, (FOXO1), (Yoshihara) || GTAAACAA || Absent || 351 || [[Forkhead box gene transcriptions|Forkhead boxes]] 04:33, 20 April 2023 || 4<sup>8</sup>
 
(Song)
|| TGACGTGT || Y || -
|-
|-
|57. [[C box gene transcriptions|C/T hybrid boxes]] || TGACGTTA || N || TGACGTTA.<ref name=Song/> T at the 12 position
|149. Forkhead boxes, (FOXA2), (Li 2017) || (A/G)(C/T)AAA(C/T)A || Present || 286 || [[Forkhead box gene transcriptions|Forkhead boxes]] 03:54, 1 January 2023 || likely active or activable
|-
|-
|58. [[C box gene transcriptions|C boxes]]  
|150. GAAC elements || GAACT || Present || 287 || [[GAAC element gene transcriptions|GAAC elements]] 22:49, 1 January 2023 || likely active or activable
 
(Voronina)
|| GGTGATG || Y || -
|-
|-
|59. [[CAAT box gene transcriptions|CCAAT-boxes-binding transcription factors]]
|151. Galactose-inducible transcription activator 4s, (Gal4s), (Tang) || CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG || Absent || 54 || [[Gal4p gene transcriptions|Gal4ps]] 22:28, 31 December 2020‎ || 4<sup>10</sup>
 
(Hap4p)  
|| CCAAT || Y || -
|-
|-
|60. [[CCCTC-binding factor gene transcriptions|CCCTC-binding factors]]  
|152. γ-interferon activated sequences, (GAS) || TTCCTAGAA || Absent || 352 || [[Γ-interferon activated sequence gene transcriptions|γ-interferon activated sequences]] 18:24, 20 April 2023 || 4<sup>9</sup>
 
|-
(CTCF)  
|153. Γ-interferon activated sequences, (GAS) || TTNCNNNAA || Present || 288 || [[Γ-interferon activated sequence gene transcriptions|Γ-interferon activated sequences]] 01:56, 3 January 2023, see STAT5 || likely active or activable
|| NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T) || N || NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C).<ref name=Hashimoto>{{ cite journal
|-
|author=Hideharu Hashimoto
|154. GATA boxes || GATA || Present || 258 || [[GATA gene transcriptions|GATA boxes]] 06:29, 8 December 2022 || likely active or activable, may be random in proximals
|author2=Dongxue Wang
|-
|author3=John R. Horton
|155. GATA (GATAAG, GATAAH, GATTA) motifs, (Staschke) || GAT(A/T)A || Present || 259 || [[GATA gene transcriptions|GATA (GATAAG, GATAAH, GATTA) motifs]] 20:11, 9 December 2022‎ || likely active or activable
|author4=Xing Zhang
|-
|author5=Victor G. Corces
|156. GATC repeats, (ABREN), (Watanabe ''et al''. 2017)  
|author6=Xiaodong Cheng
|| GATC || Present || 369 || [[ABA-response element gene transcriptions|GATC samplings]] 20:08, 11 May 2023‎ || GATC UTRs, proximals and positive strand, negative direction distals greater than randoms, negative strand, negative direction distals, positive direction distals likely randoms. GATCs are likely active or activable
|title=Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA
|-
|journal=Molecular Cell
|157. G boxes, (Song) || (G/T)CCACGTG(G/T)C || Absent || 115 || [[G box gene transcriptions|G boxes]] 03:20, 25 July 2021‎ || 4<sup>9</sup>  
|date=1 June 2017
|volume=66
|issue=5
|pages=711-720.e3
|url=https://www.sciencedirect.com/science/article/pii/S1097276517303179
|arxiv=
|bibcode=
|doi=10.1016/j.molcel.2017.05.004
|pmid=28529057
|accessdate=28 August 2020 }}</ref>  
|-
|-
|61. [[C-EBP box gene transcriptions|C/EBP boxes]] || TTAGGACAT,<ref name=Misra>{{ cite journal
|158. G-box motif, (Oeda) || GCCACGTGGC || Absent || 114 || [[G box gene transcriptions|G boxes]] 04:25, 20 July 2021 || 4<sup>10</sup>, no "perfect palindrome" G boxes in either promoter
|author=Ravi P. Misra
|-
|author2=Azad Bonni
|159. GC boxes, (Briggs 1986), (Rroji 2021) || (G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) || Present || 289 || [[GC box gene transcriptions|GC boxes]] 16:57, 3 January 2023 || likely active or activable
|author3=Cindy K. Miranti
|author4=Victor M. Rivera
|author5=Morgan Sheng
|author6=Michael E.Greenberg
|title=L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway
|journal=The Journal of Biological Chemistry
|date=14 October 1994
|volume=269
|issue=41
|pages=25483-25493
|url=http://www.jbc.org/content/269/41/25483.full.pdf
|arxiv=
|bibcode=
|doi=
|pmid=7929249
|accessdate=7 December 2019 }}</ref> or TAGCATT.<ref name=Yao>{{ cite journal
| author = Yao EF
|author2=Denison MS
| title = DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer
| journal = Biochemistry
| volume = 31
| issue = 21
| pages = 5060–7
| date = June 1992
| pmid = 1318077
| doi = 10.1021/bi00136a019 }}</ref> || N || CCAAT-enhancer-binding site (C/EBP) is TAGCATT
|-
|-
|62. [[Cell-cycle box gene transcriptions|Cell-cycle boxes]]  
|160. GC boxes, (Ye 2019) || GGGCGG || Present || 290 || [[GC box gene transcriptions|GC boxes]] 08:28, 4 January 2023‎ || likely active or activable
 
(CCBs)
|| CACGAAAA || N || "cell cycle box" is functional in either orientation, acting as an enhancer
|-
|-
|63. [[Cell-cycle box gene transcriptions|Cell-cycle box variants]]  
|161. GCC boxes, (Sato 1996) || GCCGCC || Present || 291 || [[AGC box gene transcriptions|GCC boxes]] 06:52, 5 January 2023 || likely active or activable
 
(CCBs)
|| CACGAAA, ACGAAA and C-CGAAA || Y || TTTCGTG at 3600, ACGAAA at 494, and TTTCG<u>G</u>G at 1752
|-
|-
|62. [[Cell cycle regulation gene transcriptions|Cell cycle regulation]] || CCCAACGGT<ref name=Sharma/> || N || tomato genome-wide analysis
|162. GCN4 motifs, (Zhang 2014) || TGA(C/G)TCA || Absent || 185 || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]] 05:52, 30 September 2022 || 4<sup>7</sup>  
|-
|-
|63. [[CENP-B box gene transcriptions|CENP-B boxes]] || TTTCGTTGGAAGCGGGA || N || specifically localized at the centromere
|163. General control nonderepressible 4 protein binding sites, (Staschke 2010), (GCRE, GCN4) || TGA(C/G/T)T(A/C/G)(A/T) || Present || 292 || [[Gcn4p gene transcriptions|General control nonderepressible 4 protein binding site]] 07:05, 5 January 2023‎ || likely active or activable
|-
|-
|64. [[CGCG box gene transcriptions|CGCG boxes]] || (A/C/G)CGCG(C/G/T) || Y || -
|164. Gcn4ps, (Tang) || ATGACTCTT || Absent || 245 || [[Gcn4p gene transcriptions|Gcn4ps]] 22:17, 15 November 2022 || 4<sup>9</sup>
|-
|-
|65. [[Circadian control element gene transcriptions|Circadian control elements]] || CAANNNNATC || Y || -
|165. GGCGGC triplet || GGCGGC || Present || 293 || [[GGC triplet gene transcriptions|GGCGGC triplet]] 00:32, 7 January 2023 || likely active or activable
|-
|-
|66. [[N box gene transcriptions|Class C DNA binding sites]] || CACGNG || Y || Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232
|166. GGC triplets || GGC || Present || 295 || [[GGC triplet gene transcriptions|GGC triplets]] 19:40, 7 January 2023 || likely active or activable
|-
|-
|68. [[Cold-responsive element gene transcriptions|Cold-responsive elements]] || CCGAC || Y || -
|167. Gibberellic acid responsive elements-like 1, (GAREL1s) || TAACA(A/G)A || Present || 238 || [[GARE gene transcriptions|Gibberellic acid responsive elements-like 1]] 19:12, 5 November 2022 || likely active or activable
|-
|-
|69. [[Copper response element gene transcriptions|Copper response elements]]
|168. Gibberellin responsive element-like 2, (GARE-like 2), (Fan) || TAACGTA || Absent || 55 || [[GARE gene transcriptions|Gibberellin responsive element-like 2]] 06:39, 2 January 2021 || 4<sup>7</sup>
 
(CuREs)  
 
(Quinn)  
|| TTTGC(T/G)C(A/G) || Y || Positive strand, negative direction: CGCGCAAA at 163
|-
|-
|70. [[Copper response element gene transcriptions|Copper response elements]]
|169. Gibberellin responsive elements, (GREs), (Sharma) || AAACAGA || Present || 296 || [[Gibberellin responsive element gene transcriptions|Gibberellin responsive elements]] 01:19, 8 January 2023‎ || likely active or activable
 
(CuREs)  
 
(Park)  
|| TGTGCTCA || Y || Negative strand, positive direction: TGAGCACA at 3740
|-
|-
|71. [[Coupling element gene transcriptions|Coupling elements]]  
|170. GLM boxes, (GCN4-like motif) || (G/A)TGA(G/C)TCA(T/C) || Absent || 20 || [[GLM box gene transcriptions|GLM boxes]] 04:17, 13 October 2019 || 2<sup>3</sup>*4<sup>6</sup>  
 
(CE1)
|| TGCCACCGG<ref name=Watanabe/> || N || CE1 (Watanabe)
|-
|-
|72. [[Coupling element gene transcriptions|Coupling elements]]
|171. Glucocorticoid response elements, (GlRE), (Parsonnet 2019) || AGAACA || Present || 260 || [[Glucocorticoid response element gene transcriptions|Glucocorticoid response elements]] 05:34, 10 December 2022 || likely active or activable
 
(CE3s)  
 
(Watanabe)  
|| GCGTGTC || Y || Positive strand, positive direction: GCGTGTC at 1053, only one
|-
|-
|73. [[Coupling element gene transcriptions|Coupling elements]]
|172. Glucose transporter gene repressor, (Rgt1), (Kim 2019) || CGG(A/G)(A/T)N(A/T)(A/T) || Present || 311 ||[[Rgt1p gene transcriptions|Glucose transporter gene repressor]] 20:06, 21 January 2023‎ || likely active or activable
 
(CE3s)  
 
(Ding)  
|| CACGCG || Y || No CE3s in negative direction; positive strand, positive direction: CACGCG at 1726
|-
|-
|74. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]  
|173. G-protein-coupled receptors,(GCR1s), CT boxes || CTTCC || Present || 297 || [[Gcr1p gene transcriptions|G-protein-coupled receptors]] 03:36, 8 January 2023 || likely active or activable
 
(ARR1s)
|| AGATT(C/T) || Y || Positive strand, negative direction: AGATTC at 2452
|-
|-
|75. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]  
|174. Grainy head transcription factor binding sites || AACCGGTT || Absent || 56 || [[Grainy head transcription factor gene transcriptions|Grainy head transcription factor binding sites]] 23:33, 6 January 2021 || 4<sup>8</sup>
 
(ARR10s)
|| (A/G)GATA(A/C)G || Y || Negative strand, negative direction: CGTATCC at 3447
|-
|-
|76. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]  
|175. Grainy head transcription factor binding sites || GACTGGTT || Absent || 354 || [[Grainy head transcription factor gene transcriptions|Grainy head transcription factor binding sites]] 07:13, 22 April 2023 || 4<sup>8</sup>
 
(ARR12s)
|| (A/G)AGATA || Y || Negative strand, negative direction: TATCTT at 4080
|-
|-
|77. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]  
|176. GT boxes, (Motojima) || TGGGTGGGGCT || Absent || 57 || [[TC element gene transcriptions|GT boxes]] 00:39, 11 January 2021 || (-78 to -69) 4<sup>11</sup>
 
(ARRs)
 
(Ferreira)
|| (G/A)GGAT(T/C) || Y || Positive strand, negative direction: GATCCC at 4477, AGGATC at 4288, AGGATC at 4157, AGGATC at 4006, AATCCC at 3976, AATCCC at 3067
|-
|-
|78. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]  
|177. GT boxes, (Sato) || GGGG(T/A)GGGG || Present || 298 || [[TC element gene transcriptions|GT boxes]] 04:33, 8 January 2023 || likely active or activable
 
|-
(ARRs)
|178. Hac1, ''KAR2'' || CAGCGTG || Present || 299 || [[Hac1p gene transcriptions|Hac1]] 05:27, 8 January 2023‎ || likely active or activable
 
|-
(Rashotte1)
|179. H and ACA boxes || AGAGGA || Present || 301 || [[H and ACA box gene transcriptions|H and ACA boxes]] 04:33, 9 January 2023‎ || likely active or activable, negative distals likely random
|| GATCTT || Y || Positive strand, negative direction: AAGATC at 3276
|-
|-
|79. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]  
|180. Hapless motifs (Ozsarac 1997) || CCAATCA || Absent || 150 || [[Middle sporulation element gene transcriptions|Hapless motifs]] 02:33, 30 June 2022‎ || heterotrimeric transcription factor, HAP2/3/4 4<sup>7</sup>
 
(ARRs)
 
(Rashotte2)
|| (G/A)GAT(T/C) || Y || Positive strand, negative direction: GATCC at 4476, AGATC at 4475
|-
|-
|80. [[Cytoplasmic polyadenylation element gene transcriptions|Cytoplasmic polyadenylation elements]]  
|181. Hap motif (Hap4p) || CCAAT || Present || 302 || [[CAAT box gene transcriptions|Hap motif]] 20:38, 9 January 2023 and [[Endoplasmic reticulum stress response element gene transcriptions#CCAAT samplings|ESRE CCAAT]] || likely active or activable
 
(CPEs)
|| TTTTTAT || Y || Negative strand, negative direction: TTTTTAT at 4220, TTTTTAT at 4070
|-
|-
|81. [[DAF-16 binding element gene transcriptions|DAF-16 binding elements]] || (A/G)(C/T)AAA(C/T)A || Y || -  
|182. H-boxes, (Grandbastien) || CC(A/T)ACCNNNNNNN(A/C)T || Present || 121 || [[H box gene transcriptions|H-boxes]] 16:34, 7 May 2022‎ || likely active or activable
|-
|-
|82. [[DAF-16-associated element gene transcriptions|DAF-16-associated elements]]
|183. H-boxes, (Lindsay) || CCTACC || Present || 124 ||[[H box gene transcriptions|H-boxes]] 14:39, 8 May 2022‎ || likely active or activable, equal to or greater than the randoms for the negative direction distals
 
(DAE)  
|| TGATAAG || N || DAF-16-associated element (DAE).<ref name=Li>{{ cite journal
|author=Yan-Hui Li
|author2=Gai-Gai Zhang
|title=Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in ''Caenorhabditis elegans''
|journal=Oncotarget
|date=12 April 2016
|volume=7
|issue=15
|pages=19185-19192
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4991374/
|arxiv=
|bibcode=
|doi=10.18632/oncotarget.8313
|pmid=2702736
|accessdate=27 August 2020 }}</ref>
|-
|-
|83. [[D box gene transcriptions|D-boxes]]
|184. H box, (Mitchell) || ANANNA || Present || 266 || [[H box gene transcriptions|H box]] 20:03, 12 December 2022‎ || likely active or activable
 
(Mracek1)  
|| GTTGTATAAC || N || GTTGTATAAC.<ref name=Mracek>{{ cite journal
|author=Philipp Mracek
|author2=Cristina Santoriello
|author3=M. Laura Idda
|author4=Cristina Pagano
|author5=Zohar Ben-Moshe
|author6=Yoav Gothilf
|author7=Daniela Vallone
|author8=Nicholas S. Foulkes
|title=Regulation of ''per'' and ''cry'' Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression
|journal=PLoS ONE
|date=December 6, 2012
|volume=7
|issue=12
|pages=e51278
|url=https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0051278
|arxiv=
|bibcode=
|doi=10.1371/journal.pone.0051278
|pmid=
|accessdate=10 February 2019 }}</ref>
|-
|-
|77. [[D box gene transcriptions|D-boxes]]  
|185. H box, (Rozhdestvensky) || ACACCA || Present || 120 || [[H box gene transcriptions|H box]] 05:46, 5 May 2022 || likely active or activable
 
(Mracek)
|| CTTATGTAAA (Mracek2) || N || CTTATGTAAA.<ref name=Mracek/>
|-
|-
|78. [[D box gene transcriptions|D-boxes]]  
|186. Heat-responsive elements || AAAAAATTTC || Absent || 58 || [[Heat-responsive element gene transcriptions|Heat-responsive elements]] 02:10, 14 January 2021 || four nGAAn motifs 4<sup>10</sup>  
(Johnson)
|| TCTCACA || N || TCTCACATT(A/C)AATAAGTCA is a D-box.<ref name=Johnson/>  
|-
|-
|79. [[D box gene transcriptions|D boxes]]  
|187. Heat shock elements, (HSE1), (Eastmond) || nGAAnnTTCnnGAAn || Absent || 59 || [[Hsf1p gene transcriptions|Heat shock elements]] 04:13, 20 January 2021 || HSE1 4<sup>9</sup>
 
(Samarsky)
|| AGTCTG || Y || -
|-
|-
|80. [[D box gene transcriptions|D boxes]]  
|188. Heat shock elements, (HSE2), (Eastmond) || nTTCnnGAAnnTTCn || Absent || 127 || [[Hsf1p gene transcriptions|Heat shock elements]] 16:30, 10 May 2022‎ || HSE2 is the inverse complement of HSE1 4<sup>9</sup>
 
(Voronina)
|| TCCTG || Y || -
|-
|-
|81. [[D box gene transcriptions|D-boxes]]  
|189. Heat shock elements, (HSE3s), (Eastmond) || nGAAn-(5-bp)-nGAAnnTTCn || Present || 130 || [[Hsf1p gene transcriptions|Heat shock elements]] 17:47, 13 May 2022 || likely active or activable
 
|-
(Motojima)  
|190. Heat shock elements, (HSEs), (Eastmond) || nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP1) || Present || 132 || [[Hsf1p gene transcriptions|Heat shock elements]] 16:28, 16 May 2022 || same result as HSE3, likely active or activable
|| TGAGTGG || Y || -
|-
|191. Heat shock elements, (HSEs), (Eastmond) || nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP2) || Present || 133 || [[Hsf1p gene transcriptions|Heat shock elements]] 06:36, 17 May 2022 || same result as HSE3, likely active or activable
|-
|192. Heat shock elements, (HSE4s), (Eastmond) || nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn || Present || 131 || [[Hsf1p gene transcriptions|Heat shock elements]] 05:14, 14 May 2022‎ || likely active or activable
|-
|-
|82. [[Xenobiotic response element gene transcriptions|Dioxin-responsive elements]]  
|193. Heat shock elements, (HSE5), (Eastmond) || nTTCn-(5-bp)-nTTCnnGAAn || Absent || 60 || [[Hsf1p gene transcriptions|Heat shock elements]] 02:49, 23 January 2021 || HSE5 4<sup>9</sup>
 
(DREs)
|| TNGCGTG || Y || -
|-
|-
|83. [[Defense and stress-responsive element gene transcriptions|Defense and stress-responsive elements]] || ATTTTCTTCA || N || ATTTTCTTCA.<ref name=Sharma/>  
|194. Heat shock elements, (HSE6), (Eastmond) || nTTCn-nnGAAn-(5-bp)-nGAAn || Absent || 61 || [[Hsf1p gene transcriptions|Heat shock elements]] 18:05, 23 January 2021 || HSE6 4<sup>9</sup>  
|-
|-
|82. [[DNA damage response element gene transcriptions|DNA damage response elements]]
|195. Heat shock elements, (HSE7), (Eastmond) || nGA(A/G)nnTTCnnGAAn || Absent || 62 || [[Hsf1p gene transcriptions|Heat shock elements]] 22:36, 23 January 2021‎ || HSE7 PFT1 2*4<sup>8</sup>  
 
(DREs)  
 
(Smith)  
|| TTTCAAT<ref name=Smith>{{ cite journal
|author=Joshua J. Smith, Eric S. Cole, Daniel P. Romero
|title=Transcriptional control of RAD51 expression in the ciliate ''Tetrahymena thermophila''
|journal=Nucleic Acids Research
|date=15 July 2004
|volume=32
|issue=14
|pages=4313-4321
|url=https://academic.oup.com/nar/article/32/14/4313/1279821
|arxiv=
|bibcode=
|doi=10.1093/nar/gkh771
|pmid=15304567
|accessdate=4 September 2020 }}</ref> || N || in the upstream repression sequence (URS)
|-
|-
|84. [[DNA damage response element gene transcriptions|DNA damage response elements]]
|196. Heat shock elements, (HSE), (Eastmond) || nGAAnnTTCnnGA(A/G)n || Absent || 63 || [[Hsf1p gene transcriptions|Heat shock elements]] 05:45, 24 January 2021 || HSE7 PFT2 2*4<sup>8</sup>
 
(DRE, core)  
 
(Sumrada)  
|| CCGCC || Y || -
|-
|-
|85. [[DNA damage response element gene transcriptions|DNA damage response elements]]  
|197. Heat shock elements, (HSE10), (Eastmond) || nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn || Absent || 64 || [[Hsf1p gene transcriptions|Heat shock elements]] 22:33, 26 January 2021 || HSE10 4<sup>9</sup>
 
|-
(DREs)  
|198. Heat shock factors, (Hsfs), (Tang) || NGAAN || Present || 128 || [[Hsf1p gene transcriptions|Heat shock factors]] 06:01, 11 May 2022‎ || likely active or activable
 
|-
(Sumrada)  
|199. Helper site, (Atcha et al. 2007), (Cadigan and Waterman 2012) || (C/G)C(C/G)G(C/G) || Present || 368 || [[HMG box gene transcriptions|Helper site]] 10:54, 10 May 2023 || likely active or activable
|| TAGCCGCCG of TAGCCGCCGRRRR.<ref name=Sumrada>{{ cite journal
|-
|author=Roberta A. Sumrada and Terrance G. Cooper
|200. Hepatic nuclear factors (HNFs) || (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) || Present || 135 || [[HNF gene transcriptions|HNF6s]] 17:53, 20 May 2022 || likely active or activable, although the negative direction distals are at or less than randoms
|title=Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast
|-
|journal=Proceedings of the National Academy of Sciences USA
|201. Hex sequences || TGACGTGGC || Present || 134 || [[Hex sequence gene transcriptions|Hex sequences]] 19:57, 17 May 2022‎ || likely active or activable
|date=June 1987
|-
|volume=84
|202. High Mobility Group boxes, (HMG boxes) || (A/T)(A/T)CAAAG || Present || 358 || [[HMG box gene transcriptions|High Mobility Group boxes]] 22:01, 30 April 2023‎ || likely active or activable
|issue=
|-
|pages=3997-4001
|203. Homeoboxes || CAAG || Present || 253 || [[Homeobox gene transcriptions|Homeoboxes]] 04:28, 4 December 2022 || likely active or activable, occurs in Rox1ps
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC305008/pdf/pnas00277-0054.pdf
|-
|arxiv=
|204. Homeodomains || TAAT || Present || 254 || [[Homeobox gene transcriptions|Homeodomains]] 19:46, 4 December 2022‎ || likely active or activable, low occurrence UTRs and negative direction distals overlap high randoms, occurs in CArG boxes and Pribnow boxes
|bibcode=
|doi=10.1073/pnas.84.12.3997
|pmid=3295874
|accessdate=6 September 2020 }}</ref> || N || in the upstream repression sequence (URS)
|-
|-
|86. [[DNA replication-related element gene transcriptions|DNA replication-related elements]]
|205. HY boxes || TG(A/T)GGG || Present || 136 || [[HY box gene transcriptions|HY boxes]] 12:43, 25 May 2022‎ || likely active or activable
 
(DREs)
|| TATCGATA || N || DNA replication-related element (DRE).<ref name=Hirose>{{ cite journal
|author=Fumiko Hirose
|author2=Masamitsu Yamaguchi
|author3=Akio Matsukage
|title=Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a ''Drosophila'' Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc
|journal=Molecular and Cellular Biology
|date=September 1999
|volume=19
|issue=9
|pages=6020-6028
|url=https://mcb.asm.org/content/19/9/6020.full
|arxiv=
|bibcode=
|doi=10.1128/MCB.19.9.6020
|pmid=10454549
|accessdate=4 September 2020 }}</ref>
|-
|-
|87. [[Downstream TFIIB recognition element gene transcriptions|Downstream B recognition elements]] || (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) || Y || -
|206. Hypoxia-inducible factors, (HIF-1), (Li 2020) || GCCCTACGTGCTGTCTCA || Absent || 65 || [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]] 16:43, 27 January 2021 || composed of HIF-1α and HIF-1β 4<sup>18</sup>
|-
|-
|88. [[Downstream core element gene transcriptions|Downstream core elements]]  
|207. Hypoxia-inducible factors (HIF) (Orlando 2019), ABA-response element (ABRE) (Asad 2019) || ACGTG || Present || 37 || [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]] 06:03, 7 May 2021, [[ABA-response element gene transcriptions|ABA-response element (ABRE)]] 03:06, 8 October 2020 || likely active or activable
 
(DCEs)  
|| CTTC...CTGT...AGC || Y || -
|-
|-
|89. [[Downstream promoter element gene transcriptions|Downstream promoter elements]]
|208. Hypoxia response elements (HRE) (Orlando 2019) || CACGC || Present || 109 || [[Hypoxia response element gene transcriptions|Hypoxia response elements]] 05:04, 7 May 2021 || likely active or activable
 
(DPEs)  
 
(Juven-Gershon)  
|| (A/G)G(A/T)(C/T)(A/C/G)T || Y || Negative strand, negative direction: AGGACC at 4546, AGTCCT at 4437, AGATGT at 4213, AGTTCT at 4179, GGTCCT at 4171, AGTCCT at 4139, GGACAT at 4122, AGATGT at 4063, AGTTCT at 4028, GGTTCT at 4020, GGTTGT at 3980, GGACAT at 3971, ACAACC at 3942, GGACCT at 3907, AGGACC at 3906, ACGACC at 3864, AGACCT at 3836, AGAACC at 3793, GGACCT at 3745, GGTCGT at 3732, AGGTCC at 3585, ATGACT at 3542, ATAACC at 3529, ACGTCT at 3431, GGTTCT at 3274, GGTCCT at 3250, AGTCCT at 3218, GGTTGT at 3138, AGTCCT at 3111, GGTCGT at 3071, GGACAT at 3062, AGATGT at 2989, ATATCT at 2903, GGTTAT at 2849
 
Positive strand, negative direction: AGACAT at 4508, AGATCC at 4476, AGAACC at 4451, AGTTCT at 4418, AGACGT at 4236, AGATGT at 3621, AGATAT at 3466, AGACAT at 3434, ATGTCT at 3833, AGGACT at 3640, ATGTCT at 2986, AGATAT at 2982, AGACAT at 2949, AGACAT at 2881
|-
|-
|90. [[Downstream promoter element gene transcriptions|Downstream promoter elements]]  
|209. I boxes || GATAAG of GGATGAGATAAGA || Absent || 66 || [[I box gene transcriptions|I boxes]] 05:49, 28 January 2021 || 4<sup>13</sup>
 
(DPEs)
 
(Kadonaga)
|| (A/G)G(A/T)CGTG || Y || Negative strand, negative direction: GGTCGTG at 3733, CACGTCT at 3431, GGTCGTG at 3072
 
Positive strand, negative direction: AGACGTG at 4237
|-
|-
|88. [[Downstream promoter element gene transcriptions|Downstream promoter elements]]
|210. Initiator element (Inr) (Liston 1999) || YYA<sub>+1</sub>NWYY || Present || 2 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Elements/Initiators Initiator elements] 17:02, 17 April 2012 || likely active or activable
 
(DPEs)  
 
(Matsumoto)  
|| AGTCTC || Y || Negative strand, negative direction: AGTCTC at 3645
 
Positive strand, negative direction: GAGACT at 4053
|-
|-
|89. [[DREB box gene transcriptions|DREB boxes]] || TACCGACAT || N || CRT/DREB box
|211. Initiator element (Inr) (Juven-Gershon 2008) || YYR<sub>+1</sub>NWYY || Present || 24 || [[Initiator element gene transcriptions|Initiator elements]] 17:44, 27 September 2020 || likely active or activable
|-
|-
|90. [[E2 box gene transcriptions|E2 boxes]] || (G/A)CAG(A/C/G/T)TG(A/C/G/T) || Y || -
|212. Initiator element (Inr) (Ngoc 2017) || BBCA<sub>+1</sub>BW || Present || 13 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Elements/Initiators Initiator elements] 13:24, 22 December 2018 || likely active or activable
|-
|-
|91. [[EIF4E basal element gene transcriptions|EIF4E basal elements]] || TTACCCCCCCTT || N || poly(C) motif
|213. Initiator element (Inr), ''Drosophila melanogaster'' (Butler 2002) || TCA<sub>+1</sub>(G/T)T(C/T) || Present || 375 || [[Initiator element gene transcriptions|Initiator elements]] 06:40, 21 June 2023 || likely active or activable, UTRs are likely random
|-
|-
|92. [[EIN3 binding site gene transcriptions|EIN3 binding sites]] || A(C/T)G(A/T)A(C/T)CT || Y || -  
|214. Initiator element-like (Inr-like) (Matsumoto 2020) || TTCTCT || Present || 25 || [[Initiator-like element gene transcriptions]] 01:25, 29 September 2020 || likely active or activable
|-
|-
|93. [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]]
|215. Initiator element-like (TCT) (Parry 2010) || (C/T)CT(C/T)T(C/T)(C/T) || Present || 346 || [[Initiator-like element gene transcriptions|TCT (Parry 2010)]] 22:06, 10 April 2023 || likely active or activable
 
(ERSE)  
|| CCAAT || N || CCAATGGGCTGAAAC between ZNF497 and A1BG, compare CCAAT-box and ERSE below
|-
|-
|94. [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]] || CCAAT-N9-CCACG, CCACG || Y || -
|216. Inositol/choline-responsive elements, (ICRE), (Case) || CANNTGAAAT || Absent || 68 || [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]] 21:43, 29 January 2021 || version of Lopes, see below 4<sup>8</sup>
|-
|-
|93. [[Endosperm expression gene transcriptions|Endosperm expressions]] || TGTGTCA || Y || -
|217. Inositol/choline-responsive elements, (ICRE), (Case, Lopes) || CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG || Present || 139 || [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]] 23:14, 9 June 2022‎ || likely active or activable
|-
|-
|94. [[Enhancer box gene transcriptions|Enhancer boxes]] || CA(A/C/G/T)(A/C/G/T)TG || Y || -
|218. Inositol/choline-responsive elements, (ICRE), (Lopes) || ATGTGAAAT || Absent || 137 || [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]] 23:01, 7 June 2022 || 4<sup>9</sup>, using ANNTGAAAT, likely active or activable
|-
|-
|95. [[Estrogen response element gene transcriptions|Estrogen response elements]]  
|219. Inositol/choline-responsive elements, (ICREs), (Schwank) || TYTTCACATGY contains the core sequence CANNTG || Present || 138 || [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]] 05:39, 9 June 2022 || likely active or activable
 
|-
(EREs)  
|220. Interferon regulatory factor, (IRF3) || GCTTTCC || Present || 359 || [[Interferon regulatory factor gene transcriptions|Interferon regulatory factor]] 03:07, 2 May 2023‎ || likely active or activable
|| AGGTTA or GGTCAGGAT || N || AGGTTATTGCCTCCT or GGTCAGGATGAC
|-
|-
|96. [[Ethylene responsive element gene transcriptions|Ethylene responsive elements]] || ATTTCAAA || Y || -
|221. Interferon-stimulated response elements, (ISREs), (Michalska) || AGTTTCN<sub>2</sub>TTTCN || Absent || 106 || [[Interferon regulatory factor gene transcriptions|Interferon-stimulated response elements]] 15:43, 28 March 2021 || 4<sup>10</sup>
|-
|-
|97. [[I box gene transcriptions|F boxes]] || TGATAAG<ref name=Rose>{{ cite journal
|222. Interferon-stimulated response elements, (ISREs), (Lu) || GAAANNGAAA || Present || 140 || [[Interferon regulatory factor gene transcriptions|IFN-stimulated response elements]] 06:41, 12 June 2022‎ || likely active or activable
|author=Annkatrin Rose, Iris Meier and Udo Wienand
|title=The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins
|journal=The Plant Journal
|date=28 October 1999
|volume=20
|issue=6
|pages=641-652
|url=https://onlinelibrary.wiley.com/doi/pdf/10.1046/j.1365-313X.1999.00638.x
|arxiv=
|bibcode=
|doi=10.1046/j.1365-313X.1999.00638.x
|pmid=
|accessdate=8 November 2018 }}</ref> || N || F-box overlaps the I-box
|-
|-
|98. [[Forkhead box gene transcriptions|Forkhead boxes]] || GTAAACAA<ref name=Yoshihara>{{ cite journal
|223. IRS consensus, (Fujii) || AANNGAAA || Present || 141 || [[Interferon regulatory factor gene transcriptions|IRS consensus]] 03:16, 14 June 2022‎ || likely active or activable
|author=Eiji Yoshihara
|title=TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis
|journal=Antioxidants
|date=18 August 2020
|volume=9
|issue=8
|pages=765-84
|url=https://www.mdpi.com/2076-3921/9/8/765/pdf
|arxiv=
|bibcode=
|doi=10.3390/antiox9080765
|pmid=32824669
|accessdate=5 September 2020 }}</ref> || N || GTAAACAA FOXO1
|-
|-
|99. [[Forkhead box gene transcriptions|Forkhead boxes]] || (A/G)(C/T)AAA(C/T)A || Y || -
|224. Jasmonic acid-responsive elements, (JAREs) || TGACG || Present || 144 || [[Jasmonic acid-responsive element gene transcriptions|Jasmonic acid-responsive elements]] 23:12, 20 June 2022‎ || likely active or activable
|-
|-
|100. [[GAAC element gene transcriptions|GAAC elements]] || GAACT || Y || -
|225. K-boxes, (Saito 2020) || GTTCGG-NNAN-CCNNAC || Absent || 104 || [[K-box gene transcriptions|K-boxes]] 22:22, 17 March 2021‎ || 4<sup>11</sup>
|-
|-
|101. [[Gal4p gene transcriptions|Gal4ps]] || CGGACCGC || N || CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG<ref name=Tang>{{ cite journal
|226. K-box1s, (Saito 2020) || GTTCGG || Present || 366 || [[K-box gene transcriptions|K-boxes]] 20:59, 4 May 2023‎ || likely active or activable
|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
|-
|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
|227. KEN box, (Pfleger and Kirschner 2000) || AA(A/G)GA(A/G)AA(C/T) || Present || 372 || [[D box gene transcriptions|KEN boxes]] 20:13, 15 May 2023‎ || likely active or activable
|journal=Metabolites
|-
|date=6 August 2020
|228. Kozak sequences, (Kozak 1987) || GCCGCC(A/G)CCATGG || Absent || 103 || [[Kozak sequence gene transcriptions|Kozak sequences]] 18:12, 17 March 2021 || 2*4<sup>12</sup>
|volume=10
|-
|issue=8
|229. Kozak sequences, (Matsumoto) || GAAAATGG || Absent || 69 || [[Kozak sequence gene transcriptions|Kozak sequences]] 01:16, 2 February 2021 || 4<sup>8</sup>  
|pages=320-39
|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
|arxiv=
|bibcode=
|doi=10.3390/metabo10080320
|pmid=32781665
|accessdate=18 September 2020 }}</ref>  
|-
|-
|102. [[Γ-interferon activated sequence gene transcriptions|γ-interferon activated sequences]]  
|230. Krüppel-like factors || GGGNN(G/T)(G/T)(G/T) || Present || 145 || [[Krüppel-like factor gene transcriptions|Krüppel-like factors]] 18:25, 23 June 2022‎ || likely active or activable
 
(GAS)
|| TTCCTAGAA || N || ALS-GAS1 between nt −633 and nt −625
|-
|-
|103. [[Γ-interferon activated sequence gene transcriptions|Γ-interferon activated sequences]]  
|231. L boxes (Donald) || AAATTAACCAA || Absent || 70 || [[L box gene transcriptions|L boxes]] 04:21, 2 February 2021 || 4<sup>11</sup>
 
(GAS), see STAT5
|| TTNCNNNAA || Y || -
|-
|-
|104. [[GATA gene transcriptions|GATA boxes]] || GATA || Y || -
|232. Leu3 transcription factors, (Leu3), (Reddy 2020) || (C/G)C(G/T)NNNN(A/C)G(C/G) || Present || 294 || [[Leu3 gene transcriptions|Leu3 transcription factors]] 04:52, 7 January 2023 || likely active or activable
|-
|-
|105. [[G box gene transcriptions|G boxes]] || (G/T)CCACGTG(G/T)C || N || no "perfect palindrome" G boxes in either promoter
|233. M3 motif || (C/G)CGGAAG(C/T) or SCGGAAGY || Present || 373 || [[TATA box gene transcriptions|M3 motif]] 05:47, 6 June 2023‎ || likely active or activable
|-
|-
|106. [[GC box gene transcriptions|GC boxes]]
|234. M22 || TGCGCAN(G/T) or TGCGCANK || Present || 374 || [[TATA box gene transcriptions|M22 samplings]] 00:52, 11 June 2023 || likely active or activable
 
(Briggs)
|| (G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) || Y || -
|-
|-
|107. [[GC box gene transcriptions|GC boxes]]  
|235. M35 or -35 sequence || TTGACA || Present || 146 || [[M35 box gene transcriptions|-35 sequence]] 16:16, 25 June 2022‎ || likely active or activable, the UTR does overlap the randoms at the random's upper end
 
(Ye)
|| GGGCGG || Y || Negative strand, negative direction: CCGCCC at 4000, CCGCCC at 3091
|-
|-
|108. [[AGC box gene transcriptions|GCC boxes]] || GCCGCC || Y || -
|236. Maf recognition element, (MAREs), (Kyo) || TGCTGA(G/C)TCAGCA || Absent || 71 || [[Maf recognition element gene transcriptions|Maf recognition element]] 03:29, 3 February 2021 || 2*4<sup>12</sup>
|-
|-
|109. [[Gcn4p gene transcriptions|General control nonderepressible 4 protein binding site]]  
|237. M boxes, (Bertolotto) || GTCATGTGCT or AGTCATGTGCT || Absent || 72 || [[M box gene transcriptions|M boxes]] 16:05, 3 February 2021 || 4<sup>10</sup>-4<sup>11</sup>
 
(GCRE, GCN4)
|| TGA(C/G/T)T(A/C/G)(A/T) || Y || -
|-
|-
|110. [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]] || TGACTCA, TGAGTCA || N || ACGT motif
|238. M-CAT boxes, (Berberich 1993) || GCGGCCTC || Absent || 349 || [[CAT box gene transcriptions|M-CAT boxes]] 18:06, 18 April 2023 || 4<sup>8</sup>
|-
|-
|111. [[Gcn4p gene transcriptions|Gcn4ps]] || ATGACTCTT<ref name=Tang/> || N || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]]  
|239. Mcm1 regulatory factors, (Rossi) || TT(A/T)CCNN(A/T)TNGG(A/T)AA || Absent || 73 || [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]] 03:17, 4 February 2021 || 2<sup>3</sup>*4<sup>9</sup>
|-
|-
|112. [[GGC triplet gene transcriptions|GGC triplets]] || CCGNNNNCGG || Y || Negative strand, negative direction: CCGAGTACGG at 4118
|240. Mcm1 regulatory factors, (Rossi) || TTNCCNNNTNNGGNAA || Absent || 111 || [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]] 04:32, 9 June 2021 || 4<sup>9</sup>
|-
|-
|112. [[GARE gene transcriptions|Gibberellic acid responsive elements]]  
|241. Met3s, (Blaiseau) || TCACGTG || Absent || 148 || [[Met31p box gene transcriptions|Met3s]] 08:09, 27 June 2022‎ || 4<sup>7</sup>
 
(GAREs)
|| TAACAAA || Y || -
|-
|-
|113. [[Gibberellin responsive element gene transcriptions|Gibberellin responsive elements]]  
|242. Met31ps, (Blaiseau) || AAACTGTG || Present || 147 || [[Met31p box gene transcriptions|Met31ps]] 07:26, 27 June 2022‎ || likely active or activable
 
|-
(GAREs)  
|243. Metal responsive elements, (MRE) || TGC(A/G)C(A/C/G/T)C || Present || 149 || [[Metal responsive element gene transcriptions|Metal responsive elements]] 02:25, 30 June 2022‎ || likely active or activable
 
|-
(Sharma)  
|244. Middle sporulation element, (MSE), (Branco) || ACACAAA || Present || 151 || [[Middle sporulation element gene transcriptions|Middle sporulation element]] 05:04, 2 July 2022‎ || likely active or activable
|| AAACAGA<ref name=Sharma>{{ cite journal
|-
|author=Bhaskar Sharma
|245. Midsporulation element, (MSE), (Ozsarac) || C(A/G)CAAA(A/T) || Present || 169 || [[Middle sporulation element gene transcriptions|Midsporulation element]] 15:07, 14 August 2022 || likely active or activable
|author2=Joemar Taganna
|-
|title=Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato
|246. MITF E-box, (''MITF'') || CA(C/T)(A/G)TG, (CAYRTG) || Present || 360 || [[Enhancer box gene transcriptions|MITF E-box (CAYRTG)]] 16:09, 2 May 2023‎ || likely active or activable, negative distals overlap randoms at low end
|journal=Scientific Reports
|-
|date=12 June 2020
|247. Motif ten elements (MTE) (Lim 2004) || C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G), CSARCSSAACGS || Absent || 5 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Elements/Motif_tens Motif ten elements] 15:28, 10 February 2013 || 2<sup>5</sup>*4<sup>7</sup>
|volume=10
|-
|issue=9581
|248. Multicopy inhibitor of the ''GAL1'' promoter, (''MIG1''), (Gancedo 1998) || (C/G)(C/T)GGGG || Present || 361 || [[Mig1p gene transcriptions|Multicopy inhibitor of the ''GAL1'' promoter]] 16:09, 2 May 2023 || likely active or activable, UTRs may be random
|pages=
|-
|url=https://www.nature.com/articles/s41598-020-66553-1
|249. Musashi binding elements, (MBE1s) || (G/A)U<sub>1</sub>AGU || Present || 152 || [[Musashi binding element gene transcriptions|Musashi binding elements]] 15:31, 10 July 2022‎ || likely active or activable
|arxiv=
|bibcode=
|doi=10.1038/s41598-020-66553-1
|pmid=32533036
|accessdate=27 August 2020 }}</ref> || Y || -
|-
|-
|114. [[GARE gene transcriptions|GARE-like 1]]
|250. Musashi binding elements, (MBE2s) || (G/A)U<sub>2</sub>AGU || Present || 153 || [[Musashi binding element gene transcriptions|Musashi binding elements]] 06:37, 14 July 2022‎ || likely active or activable, negative direction distals may be random
 
(Fan)  
|| TAACA(A/G)A<ref name=Fan>{{ cite journal
|author=Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng
|title=Gibberellin Signal Transduction in Rice
|journal=Journal of Integrative Plant Biology
|date=2007
|volume=49
|issue=6
|pages=731−741
|url=https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1744-7909.2007.00511.x
|arxiv=
|bibcode=
|doi=10.1111/j.1744-7909.2007.00511.x
|pmid=
|accessdate=16 October 2018 }}</ref> || Y || -
|-
|-
|115. [[GARE gene transcriptions|Gibberellin responsive element-like 2]]
|251. Musashi binding elements, (MBE3s) || (G/A)U<sub>3</sub>AGU || Present || 154 || [[Musashi binding element gene transcriptions|Musashi binding elements]] 19:37, 16 July 2022‎ || likely active or activable
 
(GARE-like 2)  
 
(Fan)  
|| TAACGTA<ref name=Fan>{{ cite journal
|author=Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng
|title=Gibberellin Signal Transduction in Rice
|journal=Journal of Integrative Plant Biology
|date=2007
|volume=49
|issue=6
|pages=731−741
|url=https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1744-7909.2007.00511.x
|arxiv=
|bibcode=
|doi=10.1111/j.1744-7909.2007.00511.x
|pmid=
|accessdate=16 October 2018 }}</ref> || N || "in the promoters of hydrolase genes".<ref name=Fan/>
|-
|-
|116. [[GLM box gene transcriptions|GLM boxes]] || (G/A)TGA(G/C)TCA(T/C) || N || GCN4-like motif
|252. Myeloblastosis (MYB) ACGT-containing elements, (ACEs) || CACGT || Present || 159 || [[MYB recognition element gene transcriptions|MYB ACGT-containing elements]] 17:07, 22 July 2022 || likely active or activable, positive strand UTR is likely random, negative strand, positive direction distals are likely random
|-
|-
|117. [[Gcr1p gene transcriptions|G-protein-coupled receptors]]  
|253. Myeloblastosis recognition element, (MRE) || A(A/C)C(A/T)A(A/C)C || Present || 161 || [[MYB recognition element gene transcriptions|Myeloblastosis recognition element]] 15:36, 25 July 2022‎ || likely active or activable
 
(GCR1s), CT boxes
|| CTTCC || Y || -
|-
|-
|118. [[Glucocorticoid response element gene transcriptions|Glucocorticoid response elements]] || AGAACA || Y || -
|254. Myocyte enhancer factors, (MEFs) || (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) || Present || 162 || [[Myocyte enhancer factor gene transcriptions|Myocyte enhancer factors]] 05:44, 28 July 2022 || likely active or activable
|-
|-
|119. [[Grainy head transcription factor gene transcriptions|Grainy head transcription factor binding sites]] || AACCGGTT || N || also GACTGGTT
|255. Nanos/Pumilio response elements, (PREs) || TGTAAAT || Present || 163 || [[UTR promoter gene transcriptions|Nanos/Pumilio response elements]] 15:29, 31 July 2022‎ || likely active or activable
|-
|-
|120. [[TC element gene transcriptions|GT boxes]]  
|256. N-boxes, (Lee) || CCGGAA || Present || 168 || [[N box gene transcriptions|N-boxes]] 05:07, 14 August 2022 ||likely active or activable
 
(Motojima)
|| TGGGTGGGGCT || N || (-78 to -69)
|-
|-
|121. [[TC element gene transcriptions|GT boxes]]  
|257. N-boxes, (Bai) || CACGAG || Present || 167 || [[N box gene transcriptions|N-boxes]] 17:10, 10 August 2022‎ || likely active or activable
 
|-
(Sato)  
|258. N-boxes, (Gao) || CACGGC or CACGAC, CACG(A/G)C || Present || 166 || [[N box gene transcriptions|N-boxes]] 05:54, 7 August 2022‎ || likely active or activable
|| GGGG(T/A)GGGG || Y || Negative strand, Positive direction: GGGGAGGGG at 2291
|-
|259. N-boxes, (Leal) || CACNAG || Present || 165 || [[N box gene transcriptions|N-boxes]] 06:16, 5 August 2022 || likely active or activable
|-
|-
|122. [[Hac1p gene transcriptions|Hac1]] ''KAR2'' || CAGCGTG || Y || Positive strand, negative direction: CAGCGTG at 740, Negative strand, positive direction: CACGCTG at 778
|260. Non-DiTyrosine 80 transcription factor DNA binding domain, (Ndt80) || (A/G/T)NC(A/G)CAAA(A/T) || Present || 170 || [[Ndt80p gene transcriptions|Non-DiTyrosine 80 transcription factor DNA binding domain]] 20:36, 17 August 2022 || likely active or activable
|-
|-
|123. [[H and ACA box gene transcriptions|H and ACA boxes]] || AGAGGA || Y || -
|261. Nuclear factor of activated T cells, (NFATs) || GGAAAA || Present || 171 || [[Nuclear factor of activated T cell gene transcriptions (NFAT)|Nuclear factor of activated T cells]] 22:08, 19 August 2022 || likely active or activable, negative direction distals likely random, complement and inverse of the [[Pyrimidine box gene transcriptions|Pyrimidine boxes]]  
|-
|-
|124. [[Middle sporulation element gene transcriptions|Hapless motifs]] || CCAATCA || N || heterotrimeric transcription factor, HAP2/3/4.<ref name=Ozsarac>{{ cite journal
|262. NF‐κB/Rel family of eukaryotic transcription factors, (NF-κB) || CCCCTAAGGGG || Absent || 74 || [[Nuclear factor gene transcriptions|NF‐κB/Rel family of eukaryotic transcription factors]] 02:53, 9 February 2021 || 4<sup>11</sup>  
| author = Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes
| title = Regulation of Gene Expression during Meiosis in ''Saccharomyces cerevisiae'': ''SPR3'' Is Controlled by both ABFI and a New Sporulation Control Element
| journal = Molecular and Cellular Biology
| volume = 17
| issue = 3
| pages = 1152–9
| date = March 1997
| pmid = 9032242
| pmc = 231840
| doi = 10.1128/MCB.17.3.1152 }}</ref>  
|-
|-
|125. [[H box gene transcriptions|H-boxes]]  
|263. NF𝜿B (Sato)(NF𝜿BSs) || GAATTC || Present || 323 || [[Nuclear factor gene transcriptions|NF𝜿B (Sato)]] 07:30, 8 February 2023‎ || likely active or activable
 
(Lindsay)
|| CCTACC || Y || -
|-
|-
|126. [[H box gene transcriptions|H box]]  
|264. Nuclear factor 1, (NF-1) || TTGGCNNNNNGCCAA || Absent || 75 || [[Nuclear factor gene transcriptions|Nuclear factor 1]] 03:51, 9 February 2021 || palindromic sequence 4<sup>10</sup>
 
(Mitchell)
|| ANANNA || Y || -
|-
|-
|127. [[H box gene transcriptions|H box]]
|265. Nuclear factor Ys || CCAATGG(A/C)(A/G) || Absent || 76 || [[Nuclear factor Y gene transcriptions|Nuclear factor Ys]] 04:48, 9 February 2021 || NF-Y is a trimeric complex 4<sup>8</sup>
 
(Rozhdestvensky)  
|| ACACCA || Y || -  
|-
|-
|128. [[Heat-responsive element gene transcriptions|Heat-responsive elements]] || AAAAAATTTC || N || four nGAAn motifs
|266. Nutrient-sensing response element 1, (NSRE) || GTTTCATCA || Present || 172 || [[Nutrient-sensing response element gene transcriptions|Nutrient-sensing response element 1]] 04:29, 21 August 2022 || likely active or activable
|-
|-
|129. [[Hsf1p gene transcriptions|Heat shock elements]]  
|267. Oaf1 transcription factor || CGGN<sub>3</sub>TNAN<sub>9-12</sub>CCG || Present || 173 || [[Oaf1p gene transcriptions|Oaf1 transcription factor]] 05:57, 31 August 2022 || likely active or activable
 
(HSEs)
 
(Eastmond)
|| nGAAn-(5-bp)-nGAAnnTTCn || Y || Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
|-
|-
|130. [[Hsf1p gene transcriptions|Heat shock elements]]
|268. Oresara1, (ORE1), (Matallana) || (A/C/G)(A/C)GT(A/G)N<sub>5,6</sub>(C/T)AC(A/G) || Present || 174 || [[ORE1 binding site gene transcriptions|ORESARA1]] 05:42, 4 September 2022 || likely active or activable
 
(HSEs)  
 
(Eastmond)  
|| nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP) || Y || Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
|-
|-
|131. [[Hsf1p gene transcriptions|Heat shock elements]]  
|269. Oresara1, (ORE1), (Olsen) || T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) || Present || 175 || [[ORE1 binding site gene transcriptions|ORESARA1]] 23:53, 7 September 2022‎ || likely active or activable
 
|-
(HSEs)  
|270. p53 response elements || (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) || Present || 176 ||[[P53 response element gene transcriptions|p53 response elements]] 18:30, 8 September 2022 || likely active or activable
 
(Eastmond)  
|| nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP) || Y || Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332
|-
|-
|132. [[Hsf1p gene transcriptions|Heat shock elements]]  
|271. p53 response elements, (Long1) || CAGGCCC || Present || 177 || [[P53 response element gene transcriptions|p53 response elements]] 03:26, 11 September 2022 || likely active or activable
 
(HSEs)
 
(Eastmond)
|| nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn || Y || Postive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831
|-
|-
|133. [[Hsf1p gene transcriptions|Heat shock elements]]  
|272. p53 response elements, (Long2) || GGGCGTG || Present || 178 || [[P53 response element gene transcriptions|p53 response elements]] 20:10, 13 September 2022‎ || likely active or activable
 
(HSE1)
 
(Eastmond)
|| nGAAnnTTCnnGAAn || N || HSE1
|-
|-
|134. [[Hsf1p gene transcriptions|Heat shock elements]]
|273. p63 DNA binding sites, (Perez 2007) || (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T), RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY || Absent || 78 || [[P63 DNA-binding site gene transcriptions|p63 DNA binding sites]] 04:14, 14 February 2021 || 4<sup>12</sup>
 
(HSE2)  
 
(Eastmond)  
|| nTTCnnGAAnnTTCn || N || HSE2 is the inverse complement of HSE1
|-
|-
|135. [[Hsf1p gene transcriptions|Heat shock elements]]
|274. P-box (Mena) || (A/T)AAAG || Present || 180 || [[P box gene transcriptions|P-box (Mena)]] 22:30, 21 September 2022‎ || likely active or activable, the positive direction proximals overlap the randoms
 
(HSE5)  
 
(Eastmond)  
|| nTTCn-(5-bp)-nTTCnnGAAn || N || HSE5
|-
|-
|136. [[Hsf1p gene transcriptions|Heat shock elements]]  
|275. P-box, (Motojima) ||  TGAGTTCA || Present || 181 || [[P box gene transcriptions|P-box]] 18:27, 24 September 2022‎ || likely active or activable
 
(HSE6)
 
(Eastmond)
|| nTTCn-nnGAAn-(5-bp)-nGAAn || N || HSE6
|-
|-
|137. [[Hsf1p gene transcriptions|Heat shock elements]]
|276. P-box, (Yu) || GTAA(T/C) || Present || 179 || [[P box gene transcriptions|P-box]] 02:46, 18 September 2022‎ || likely active or activable with some overlapping the randoms
 
(HSE7)  
 
(Eastmond)
|| nGA(A/G)nnTTCnnGAAn || N || HSE7 PFT1
|-
|-
|138. [[Hsf1p gene transcriptions|Heat shock elements]]  
|277. Pleiotropic drug resistance 1p (Pdr1p), (Tang 2020) || TCCGCGGA || Absent || 79 || [[Pdr1,3p gene transcriptions|Pdr1p/Pdr3ps]] 04:07, 15 February 2021 || Pdr1p/Pdr3p response elements (PDREs) 4<sup>8</sup>
 
(HSE)
 
(Eastmond)
|| nGAAnnTTCnnGA(A/G)n || N || HSE7 PFT2
|-
|-
|139. [[Hsf1p gene transcriptions|Heat shock elements]]
|278. Pleiotropic drug resistance 1p (Pdr1p), (Salin 2008) || TCCG(C/T)GG(A/G) || Present || 363 || [[Pdr1,3p gene transcriptions|Pdr1p/Pdr3ps]] 03:11, 4 May 2023 || likely active or activable
 
(HSE10)  
 
(Eastmond)  
|| nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn || N || HSE10
|-
|-
|140. [[Hex sequence gene transcriptions|Hex sequences]] || TGACGTGGC || Y || Positive strand, positive direction: TGACGTGGC at 4344
|279. Peroxisome proliferator-activated receptor alpha || CGACCCC || Present || 80 || [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator-activated receptor alpha]] 18:37, 15 February 2021 || likely active or activable, positive direction distal overlaps upper end of randoms
|-
|-
|141. [[HMG box gene transcriptions|High Mobility Group boxes]]  
|280. Peroxisome proliferator hormone response elements, (PPREs) || AGGTCANAGGTCA || Absent || 81 || [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator hormone response elements]] 18:37, 15 February 2021 || PPARs/RXRs heterodimers bind to PPRE 4<sup>12</sup>
 
(HMG boxes)
|| (A/T)(A/T)CAAAG || Y || Positive strand, negative direction: ATCAAAG at 2891
|-
|-
|142. [[HNF gene transcriptions|HNF6s]] || (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) || Y || Positive strand, negative direction: TTATTAATTC at 4542, TTATTAATCG at 4229, TAGTTGATAA at 3527
|281. Phosphate starvation-response transcription factor (Pho4) || CAC(A/G)T(T/G) || Present || 129 || [[Phosphate starvation-response transcription factor gene transcriptions|Pho4ps]] 16:20, 12 May 2022 || likely active or activable, positive strand of the UTRs is in the random range but the negative direction distals are outside the randoms
|-
|-
|143. [[Homeobox gene transcriptions|Homeoboxes]] || CAAG || Y || -  
|282. Pollen1 element with TCCACCATA || AGAAANNNNTCCACCATA || Absent || 303 || [[Pollen1 element gene transcriptions|Pollen1 with TCCACCATA]] 23:24, 9 January 2023 || adjacent co-dependent regulatory element TCCACCATA 4<sup>9</sup>-4<sup>14</sup>
|-
|-
|144. [[HY box gene transcription laboratory|HY boxes]] || TG(A/T)GGG || Y || Negative strand, negative direction: CCCTCA at 4498, CCCTCA at 3889, CCCACA at 3184
|283. Pollen1 elements || AGAAA || Present || 304 || [[Pollen1 element gene transcriptions|Pollen1 elements]] 21:40, 10 January 2023 || likely active or activable
 
Positive strand, negative direction: TGAGGG at 4558, TGTGGG at 3712, TGAGGG at 3652
|-
|-
|145. [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]]
|284. Pollen1 element || TCCACCATA || Absent || 305 || [[Pollen1 element gene transcriptions|TCCACCATA]] 08:30, 11 January 2023 || no regulatory element TCCACCATA was found, nor its ci. 4<sup>9</sup>  
 
(HIF-1)
|| GCCCTACGTGCTGTCTCA<ref name=Li2020>{{ cite journal
|author=Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen
|title=Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity
|journal=Oncogene
|date=July 2020
|volume=39
|issue=29
|pages=5187-5200
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7398576/
|arxiv=
|bibcode=
|doi=10.1038/s41388-020-1344-y
|pmid=32555331
|accessdate=29 August 2020 }}</ref> || N || composed of HIF-1α and HIF-1β
|-
|-
|146. [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]] || ACGTG || Y || Negative strand: ACGTG at 4339, CACGT at 3429, ACGTG at 3288, CACGT at 2863
|285. Polycomb response elements || CGCCAT(A/T)TT || Absent || 82 || [[Polycomb response element gene transcriptions|Polycomb response elements]] 06:52, 16 February 2021 || 2*4<sup>8</sup>-4<sup>9</sup>
 
Positive strand: ACGTG at 4237
|-
|-
|147. [[Hypoxia response element gene transcriptions|Hypoxia response elements]] || CACGC || Y || Negative strand, negative direction: CACGC at 2196, CACGC at 447, CACGC at 379
|286. Polycomb response elements, (PRE) || GCCAT || Present || 306 || [[Polycomb response element gene transcriptions|Polycomb response elements]] 22:28, 13 January 2023 || likely active or activable
|-
|-
|148. [[I box gene transcriptions|I boxes]] || GATAAG || N || GGATGAGATAAGA
|287. Pribnow boxes || TATAAT || Present || 307 || [[Pribnow box gene transcriptions|Pribnow boxes]] 03:43, 15 January 2023 || likely active or activable
|-
|-
|149. [[Initiator element gene transcriptions|Initiator elements]]
|288. Prolamin boxes || TG(A/T)AAAG, TGTAAAG || Present || 308 || [[Prolamin box gene transcriptions|Prolamin boxes]] 06:14, 18 January 2023 || likely active or activable
 
(Inrs)  
|| YYANWYY || Y || Negative strand, negative direction: TTACTCC at 4557, TCACACT at 4361, TCGGACC at 4349, CCAGTTT at 4309, TCGGACC at 4300, GGTCCGA at 4255, CTGCACC at 4238, TCGGTCT at 4233
 
Positive strand, negative direction: GGAATGA at 4555, TTAATTC at 4542, TCACATT at 4533, AGTCCAA at 4502, CCACTTT at 4461, CCACTCC at 4425, CCACTCC at 4425, CCAGTTC at 4417, AGTGTGA at 4361, CTGCACT at 4340, CCGGACT at 4327, AAAATAA at 4221
|-
|-
|150. [[Initiator element gene transcriptions|Initiator elements]]  
|289. Q elements || AGGTCA || Present || 309 || [[Q element gene transcriptions|Q elements]] 20:23, 18 January 2023‎ See [[Retinoic acid response element gene transcriptions|Retinoic acid response element]] || likely active or activable
 
|-
(Inrs)  
|290. Quinone reductase response element, (QRDRE), (Yao) || TCCCCT of TCCCCTTGCGTG || Present || 232 || [[Xenobiotic response element gene transcriptions|Quinone reductase response element]] 05:08, 5 November 2022‎ || likely active or activable
|| BBCABW || Y || Negative strand, negative direction: TCTGGG at 4366, GTCACA at 4359, CCCACT at 4353, TGTGAC at 4336, GTCACT at 4319, TCCAGT at 4307, TCTGCA at 4236
|-
 
|291. Rap1 regulatory factors || ACCC(A/G)N(A/G)CA || Absent || 85 || [[Rap1 regulatory factor gene transcriptions|Rap1 regulatory factors]] 05:04, 20 February 2021 || "(ACCCRnRCA), less than half of the sites were detectably bound"<ref name=Rossi/> 4<sup>7</sup>
Positive strand, negative direction: AATGAG at 4556, TTCACA at 4531, CCCACT at 4485, TCCACT at 4459, CCCAGA at 4448, TCCACT at 4423, GCCAGT at 4415, TGCACT at 4340, TGCAGT at 4317, GCCAGA at 4233
|-
|292. Rap1 reduced consensus || (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) || Present || 240 || [[Rap1 regulatory factor gene transcriptions|Rap1 reduced consensus]] 03:47, 15 November 2022‎ || likely active or activable
|-
|293. Reb1 extended, (Rossi) || ATTACCCGAA || Absent || 113 || [[Reb1 general regulatory factor gene transcriptions|Extended Reb1]] 00:07, 20 June 2021 || 4<sup>10</sup>
|-
|-
|150. [[Initiator element gene transcriptions|Initiator-like elements]] || TTCTCT || Y || Negative strand: AGAGAA at 4527, TTCTCT at 3380
|294. Reb1 bound and exact occurrences || TTACCC(G/T) || Present || 241 || [[Reb1 general regulatory factor gene transcriptions|Reb1 bound and exact occurrences]] 16:38, 15 November 2022 || likely active or activable
|-
|-
|151. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]  
|295. Retinoic acid response element || AG(A/G)TCA || Present || 310 || [[Retinoic acid response element gene transcriptions|Retinoic acid response element]] 19:56, 19 January 2023 || likely active or activable, positive direction distals appear random
 
(ICRE)
 
(Case)
|| CANNTGAAAT || N || version of Lopes, see below
|-
|-
|152. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
|296. Ribophorin (RPN) (Rpn4), PACE (proteasome associated control element) || GGTGGCAAA || Absent || 88 || [[Rpn4p gene transcriptions|Rpn4ps]] 03:15, 23 February 2021‎ || 4<sup>9</sup>
 
(ICRE)  
 
(Case, Lopes)  
|| CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991) || Y || -
|-
|-
|153. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
|297. Rlm1ps || CTA(A/T)(A/T)(A/T)(A/T)TAG || Absent || 86 || [[Rlm1p gene transcriptions|Rlm1ps]] 05:55, 22 February 2021‎ || <sub>4</sub>TAG 2<sup>4</sup>*4<sup>6</sup>
 
(ICRE)  
 
(Lopes)  
|| ATGTGAAAT || N || using ANNTGAAAT
|-
|-
|154. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
|298. RORE motif, (RORE) || A(A/T)NTAGGTCA || Present || 312 || [[ROR-response element gene transcriptions|classic RORE motif]] 05:51, 22 January 2023 || likely active or activable
 
(ICREs)  
 
(Schwank)  
|| TYTTCACATGY contains the core sequence CANNTG || Y || -  
|-
|-
|155. [[Interferon regulatory factor gene transcriptions|Interferon regulatory factor]]
|299. RORE motif, variant || C(T/A)(G/A)GGNCA || Present || 313 || [[ROR-response element gene transcriptions|variant RORE motif]] 03:04, 24 January 2023‎ || likely active or activable
 
(IRF3)  
|| GCTTTCC || Y || -  
|-
|-
|156. [[Interferon regulatory factor gene transcriptions|Interferon-stimulated response elements]]  
|300. Rox1ps (Tang 2020) || RRRTAACAAGAG || Absent || 87 || [[Rox1p gene transcriptions|Rox1ps]] Heme-dependent repressor of hypoxic genes 21:50, 22 February 2021 || 2<sup>3</sup>*4<sup>9</sup>
 
|-
(ISREs)  
|301. R response elements (RRE) || CATCTG || Present || 158 || [[MYB recognition element gene transcriptions|R response elements]] 16:04, 19 July 2022‎ || likely active or activable
|| AGTTTCN<sub>2</sub>TTTCN || N || consensus sequence AGTTTCN<sub>2</sub>TTTCN.<ref name=Michalska>{{ cite journal
|-
|author=Agata Michalska, Katarzyna Blaszczyk, Joanna Wesoly and Hans A. R. Bluyssen
|302. Seed-specific elements (SRE) || CATGCATG || Absent || 89 || [[Seed-specific element gene transcriptions|Seed-specific elements]] 20:18, 23 February 2021 || 4<sup>8</sup>-4<sup>12</sup>  
|title=A Positive Feedback Amplifier Circuit That Regulates Interferon (IFN)-Stimulated Gene Expression and Controls Type I and Type II IFN Responses
|-
|journal=Frontiers in Immunology
|303. Serum response elements, (SRE) || ACAGGATGT || Present || 314 || [[Serum response element gene transcriptions|Serum response elements]] 16:38, 25 January 2023 || likely active or activable
|date=28 May 2018
|-
|volume=9
|304. Servenius sequences || GGACCCT || Present || 315 || [[Servenius sequence gene transcriptions|Servenius sequences]] 03:07, 28 January 2023‎ || likely active or activable
|issue=
|-
|pages=1135
|305. Shoot specific elements, (SREs) || GATAATGATG || Absent || 90 || [[Shoot specific element gene transcriptions|Shoot specific elements]] 15:13, 24 February 2021‎ || 4<sup>10</sup>  
|url=https://www.frontiersin.org/articles/10.3389/fimmu.2018.01135/full
|arxiv=
|bibcode=
|doi=10.3389/fimmu.2018.01135
|pmid=
|accessdate=18 March 2021 }}</ref>
|-
|-
|157. [[Interferon regulatory factor gene transcriptions|IFN-stimulated response elements]]
|306. Shue box element, (Crowder 1988) || CCCTG(C/G) || Present || 348 || [[CAT box gene transcriptions|Shue box elements]] 05:24, 18 April 2023‎ || likely active or activable
 
(ISREs)  
 
(Lu)  
|| GAAANNGAAA || Y || Negative strand, positive direction: GAAATAGAAA at 2629
|-
|-
|158. [[Interferon regulatory factor gene transcriptions|IRS consensus]]
|307. Sip4ps (Tang) || CC(C/G)T(C/T)C(C/G)TCCG || Absent || 91 || [[Sip4p gene transcriptions|Sip4ps]] 02:55, 25 February 2021 || 2<sup>3</sup>*4<sup>8</sup>
 
(Fujii)  
|| AANNGAAA || Y || Positive strand, negative direction: AAAAGAAA at 4394, AAAAGAAA at 4389, AAAAGAAA at 4382, AATAGAAA at 4081
|-
|-
|159. [[Interferon regulatory factor gene transcriptions|Tryptophan residues]]
|308. Smp1ps (Tang) || ACTACTA(T/A)<sub>4</sub>TAG || Absent || 92 || [[Smp1p gene transcriptions|Smp1ps]] 23:43, 25 February 2021 || 2*4<sup>10</sup>
 
(Lu)
|| GAAA || Y || Negative strand, negative direction: TTTC at 4504, GAAA at 4461
|-
|-
|160. [[Jasmonic acid-responsive element gene transcriptions|Jasmonic acid-responsive elements]]  
|309. SP1, (Long) || GGGGCGGGCC || Absent || 355 || [[Sp1 gene transcriptions|SP1]] 19:43, 25 April 2023 || 4<sup>10</sup>
(JAREs)
|| TGACG || Y || -
|-
|-
|161. [[Kozak sequence gene transcriptions|Kozak sequences]] || GCCGCC(A/G)CCATGG || N || GCCGCC(A/G)CCATGG<ref name=Kozak1987>{{ cite journal
|310. Sp1 element, (Berberich 1993) || GGGGCGGGT || Absent || 350 || [[CAT box gene transcriptions|Sp1 elements]] 21:03, 18 April 2023 || 4<sup>9</sup>
|author=Marilyn Kozak
|-
|date=October 1987
|311. SP1, (Zhang) || (G/T)GGGCGG(G/A)(G/A)(C/T) || Present || 319 || [[Specificity protein gene transcriptions|SP1]] 05:57, 2 February 2023‎ || likely active or activable
|title=An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs
|url=http://nar.oxfordjournals.org/cgi/pmidlookup?view=long&pmid=3313277
|journal=Nucleic Acids Research
|volume=15
|issue=20
|pages=8125–8148
|doi=10.1093/nar/15.20.8125
|pmid=3313277 }}</ref>
|-
|-
|162. [[Kozak sequence gene transcriptions|Kozak sequences]]
|312. SP-1, (Sato) || CCGCCCC || Present || 318 || [[Specificity protein gene transcriptions|SP-1]] 05:54, 2 February 2023‎ || likely active or activable 
 
(Matsumoto)  
|| GAAAATGG || N || GAAAATGG<ref name=Matsumoto>{{ cite journal
|author=Takuya Matsumoto
|author2=Saemi Kitajima
|author3=Chisato Yamamoto
|author4=Mitsuru Aoyagi
|author5=Yoshiharu Mitoma
|author6=Hiroyuki Harada
|author7=Yuji Nagashima
|title=Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes''
|journal=Fisheries Science
|date=9 August 2020
|volume=86
|issue=
|pages=873-887
|url=https://researchmap.jp/hiroyukiharada/published_papers/29953426/attachment_file.pdf
|arxiv=
|bibcode=
|doi=10.1007/s12562-020-01451-z
|pmid=
|accessdate=27 September 2020 }}</ref>
|-
|-
|163. [[Krüppel-like factor gene transcriptions|Krüppel-like factors]] || GGGNN(G/T)(G/T)(G/T) || Y || -
|313. SP1, (Yao) || GCGGC || Present || 320 || [[Specificity protein gene transcriptions|SP1]] 05:57, 4 February 2023 || likely active or activable
|-
|-
|164. [[L box gene transcriptions|L boxes]] || AAATTAACCAA || N || AAATTAACCAA<ref name=Donald>{{ cite journal
|314. SP1-box 1, (Motojima) || GGGGCT || Present || 316 || [[Specificity protein gene transcriptions|SP1-box 1]] 05:46, 29 January 2023‎|| likely active or activable
|author=Robert G. K. Donald and Anthony R. Cashmore
|-
|title=Mutation of either G box or I box sequences profoundly affects expression from the ''Arabidopsis rbcS‐1A'' promoter
|315. SP1-box 2, (Motojima) || CTGCCC || Present || 317 || [[Specificity protein gene transcriptions|SP1-box 2]] 19:30, 30 January 2023‎|| likely active or activable
|journal=The EMBO Journal
|date=1990
|volume=9
|issue=6
|pages=1717-1726
|url=https://onlinelibrary.wiley.com/doi/pdf/10.1002/j.1460-2075.1990.tb08295.x
|arxiv=
|bibcode=
|doi=10.1002/j.1460-2075.1990.tb08295.x
|pmid=
|accessdate=8 November 2018 }}</ref>
|-
|-
|165. [[Leu3 gene transcriptions|Leu3 transcription factors]] || (C/G)C(G/T)NNNN(A/C)G(C/G) || Y || Negative strand, negative direction: GCGAACTCGG at 4297, CCGAGTACGG at 4118, CCGACTCCGC at 3998, CCGTCGTAGG at 3903, CCTGGTCCGG at 3873, CCGACTCCGC at 3089
|316. STAT5 || TTCNNNGAA || Present || 321 || [[STAT5 gene transcription laboratory|STAT5]] 03:41, 5 February 2023‎ || likely active or activable, positive distal likely random
|-
|-
|166. [[M35 box gene transcriptions|-35 sequence]] || TTGACA || Y || Negative strand: TTGACA at 4399
|317. Sterile12, (STE12), (Tang 2020) || TGAAAC || Present || 356 || [[Ste12p gene transcriptions|Sterile12 encodes a transcription factor (Ste12)]] 05:53, 27 April 2023‎‎ || likely active or activable
|-
|-
|167. [[Maf recognition element gene transcriptions|Maf recognition element]]
|318. Sterol response elements, (Branco) || TCGTATA || Absent || 93 || [[Sterol response element gene transcriptions|Sterol response elements]] 19:00, 28 February 2021‎ || perhaps plant specific 4<sup>7</sup>  
 
(MAREs)  
|| TGCTGA(G/C)TCAGCA || N || and TGCTGA(GC/CG)TCAGCA<ref name=Kyo>{{ cite journal
|author=Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto
|title=Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique
|journal=Genes to Cells
|date=13 February 2004
|volume=9
|issue=2
|pages=
|url=https://onlinelibrary.wiley.com/doi/full/10.1111/j.1356-9597.2004.00711.x
|arxiv=
|bibcode=
|doi=10.1111/j.1356-9597.2004.00711.x
|pmid=
|accessdate=8 September 2020 }}</ref>  
|-
|-
|168. [[M box gene transcriptions|M boxes]] || GTCATGTGCT || N || or AGTCATGTGCT<ref name=Bertolotto>{{ cite journal
|319. Sterol response elements, (Yao) || AGCAGATTGCG || Absent || 94 || [[Sterol response element gene transcriptions|Sterol response elements]] 03:22, 1 March 2021 || liver specific 4<sup>11</sup>  
|author=Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti
|-
|title=Different ''cis''-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia
|320. Stress-response elements, (STREs) || CCCCT || Present || 322 || [[Msn2,4p gene transcriptions|Stress-response elements]] 07:49, 7 February 2023‎ || likely active or activable, positive cores overlap randoms
|journal=Molecular and Cellular Biology
|-
|date=February 1998
|321. Sucrose boxes || NNAATCA || Present || 324 || [[Sucrose box gene transcriptions|Sucrose boxes]] 08:03, 10 February 2023‎ || likely active or activable
|volume=18
|issue=2
|pages=694–702
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC108780/
|arxiv=
|bibcode=
|doi=
|pmid=9447965
|accessdate=8 December 2018 }}</ref>
|-
|-
|169. [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]] || TT(A/T)CCNN(A/T)TNGG(A/T)AA || N || Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.<ref name=Rossi/>
|322. TACTAAC boxes || TACTAA(C/T) || Present || 325 || [[TACTAAC box gene transcriptions|TACTAAC boxes]] 06:05, 12 February 2023‎ || likely active or activable
|-
|-
|170. [[Met31p box gene transcriptions|Met31ps]] || AAACTGTG<ref name=Blaiseau>{{ cite journal
|323. TAGteams || CAGGTAG || Present || 326 || [[TAGteam gene transcriptions|TAGteams]] 04:15, 14 February 2023‎ || likely active or activable
|author=Pierre‐Louis Blaiseau and Dominique Thomas
|title=Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA
|journal=The EMBO Journal
|date=2 November 1998
|volume=17
|issue=
|pages=6327-6336
|url=https://www.embopress.org/doi/full/10.1093/emboj/17.21.6327
|arxiv=
|bibcode=
|doi=10.1093/emboj/17.21.6327
|pmid=
|accessdate=4 February 2021 }}</ref> || Y || Positive strand, negative direction: AAACTGTG at 4400
|-
|-
|169. [[Metal responsive element gene transcriptions|Metal responsive elements]]  
|324. Tapetum boxes || TCGTGT || Present || 327 || [[Tapetum box gene transcriptions|Tapetum boxes]] 08:10, 16 February 2023‎ || likely active or activable
 
(MRE)
|| TGC(A/G)C(A/C/G/T)C || Y || Positive strand: TGCACTC at 4341, TGCACTC at 3290, GTGTGCA at 2863
|-
|-
|170. [[Middle sporulation element gene transcriptions|Middle sporulation element]]
|325. TATA boxes || TATAAAA (Carninci 2006) TAT box (Yang 2006) || Present || 1 || [[Wikipedia:TATA box]] 02:36, 10 January 2011 || likely active or activable
 
(MSE)  
 
(Branco)  
|| ACACAAA || Y || Negative strand, negative direction: TTTGTGT at 3513
|-
|-
|171. [[Middle sporulation element gene transcriptions|Midsporulation element]]
|326. TATA boxes || TATAAA (Butler 2002) || Present || 4 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Elements/Downstream_promoters Downstream promoter elements] 21:32, 20 May 2012 || likely active or activable
 
(MSE)
 
(Ozsarac)  
|| C(A/G)CAAA(A/T) || Y ||Negative strand, negative direction: TTTTGTG at 3512
 
Positive strand, negative direction: CACAAAA at 3767
|-
|-
|172. [[Mig1p gene transcriptions|Multicopy inhibitor of the ''GAL1'' promoter]]
|327. TATA boxes (RGWYV(T)) (Burke 1996) || TATA(A/T)A(A/T) (Watson 2014) || Present || 10 || [[Wikipedia:TATA box]] 04:32, 4 December 2017‎ || likely active or activable
 
(''MIG1'')  
|| (C/G)(C/T)GGGG || Y || Negative strand, negative direction: GTGGGG at 4445, GTGGGG at 3058
 
Positive strand, negative direction: CCCCAG at 4447, CTGGGG at 3037
|-
|-
|173. [[Motif ten element gene transcriptions|Motif ten elements]] || C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G) || N || Gene ID: 6309
|328. TATA boxes (Yang 2007) || TATA(A/T)AA(A/G) (Juven-Gershon 2010) || Present || 17 || [[TATA box gene transcriptions|metazoan TATA box]] 01:05, 13 October 2019 || likely active or activable
|-
|-
|174. [[Musashi binding element gene transcriptions|Musashi binding elements]]
|329. TATA boxes (Yang 2007) || TATA(A/T)A(A/T)(A/G) (Basehoar 2004) || Present || 9 || [[Wikipedia:TATA box]] 18:28, 21 November 2017 || likely active or activable
 
(MBEs)  
|| (G/A)U<sub>1–3</sub>AGU || Y || Positive strand, positive direction: GTAGT at 4362.
|-
|-
|175. [[MYB recognition element gene transcriptions|Myeloblastosis recognition element]]
|330. TAT boxes (Fan 2007) || TATCCAT || Present || 239 || [[TAT box gene transcriptions|TAT box (Fan) samplings]] 06:17, 13 November 2022 || likely active or activable
 
(MRE)  
|| A(A/C)C(A/T)A(A/C)C || Y || Negative strand: GGTAGGT at 4457, ACCAACC at 3946, ACCAACC at 3606, GGTTGTT at 3139
|-
|-
|176. [[Myocyte enhancer factor gene transcriptions|Myocyte enhancer factors]]  
|331. TATCCAC boxes || TATCCAC || Absent || 18 || [[TATC box gene transcriptions|TATCCAC boxes]] 03:59, 13 October 2019 || GA responsive complex component 4<sup>7</sup>
 
(MEFs)
|| (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) || Y || Negative strand, negative direction: TTATTATTAA at 4226
|-
|-
|177. [[UTR promoter gene transcriptions|Nanos/Pumilio response elements]]
|332. TATCCAC boxes (Yang 2007) || TATCCAC || Absent || 19 || [[TATC box gene transcriptions]] 03:59, 13 October 2019 || 4<sup>7</sup>
 
(PREs)  
|| TGTAAAT || Y || Negative strand, negative direction: TGTAAAT at 4535
|-
|-
|178. [[N box gene transcriptions|N-boxes]]  
|333. Tbf1 regulatory factors || A(A/G)CCCTAA || Present || 242 || [[Tbf1 regulatory factor gene transcriptions|Tbf1 regulatory factors]] 17:38, 15 November 2022 || ''Saccharomyces cerevisiae'', likely active or activable
 
(Lee)
|| CCGGAA || Y || Negative strand, positive direction: TTCCGG at 4244
|-
|-
|179. [[N box gene transcriptions|N-boxes]]  
|334. T boxes, (Conlon) || TCACACCT || Present || 246 || [[T box gene transcriptions|T boxes]] 23:28, 18 November 2022 || likely active or activable
 
(Bai)
|| CACGAG || Y || Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232
|-
|-
|180. [[N box gene transcriptions|N-boxes]]  
|335. T boxes, (Zhang) || AACGTT || Present || 247 || [[T box gene transcriptions|T boxes]] 17:21, 20 November 2022‎ || likely active or activable
 
(Gao)
|| CACGGC or CACGAC, CACG(A/G)C || Y || Negative strand, negative direction: CACGAC at 3956, GTCGTG at 3733, GTCGTG at 3072
|-
|-
|180. [[N box gene transcriptions|N-boxes]]  
|336. TCCACCATA elements || TCCACCATA || Absent || 77 || [[TCCACCATA element gene transcriptions|TCCACCATA elements]] 05:10, 13 February 2021 || adjacent co-dependent regulatory element of POLLEN1 4<sup>9</sup>
 
(Leal)
|| CACNAG || Y || Positive strand, negative direction: CACGAG at 4472, CACAAG at 3634, CACTAG at 3493, CACTAG at 3369, CACGAG at 3232
|-
|-
|181. [[Ndt80p gene transcriptions|Non-DiTyrosine 80 transcription factor DNA binding domain]]  
|337. TEA consensus sequences || CATTCY || Present || 328 || [[TEA consensus sequence gene transcriptions|TEA consensus sequences]] 06:35, 24 February 2023‎ || likely active or activable
 
(Ndt80)
|| (A/G/T)NC(A/G)CAAA(A/T) || Y || Negative strand, negative direction: TTTTGTGTT at 3514
 
Positive strand: ACCACAAAA at 3767
|-
|-
|182. [[Nuclear factor gene transcriptions|NF‐κB/Rel family of eukaryotic transcription factors]] || CCCCTAAGGGG || N || [[NF-κB]]  
|338. Telomeric repeat DNA-binding factors, (TRFs) || TTAGGG || Present || 330 || [[Telomeric repeat DNA-binding factor gene transcriptions|Telomeric repeat DNA-binding factors]] 06:35, 2 March 2023 || likely active or activable
|-
|-
|183. [[Nuclear factor gene transcriptions|Nuclear factor 1]]  
|339. Tetradecanoylphorbol-13-acetate response elements, (TREs) || TGA(G/C)TCA || Absent || 23 || [[Tetradecanoylphorbol-13-acetate response element gene transcriptions|Tetradecanoylphorbol-13-acetate response elements]] 15:07, 24 August 2020‎ || ''cis''-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40 2*4<sup>6</sup>
 
|-
(NF-1)  
|340. TGF-β control elements, (TCEs) || GCGTGGGGGA || Absent || 95 || [[TC element gene transcriptions|TGF-β control elements]] 17:38, 5 March 2021 || GCGTGGGGGA in humans 4<sup>10</sup>
|| TTGGCNNNNNGCCAA || N || palindromic sequence
|-
|-
|184. [[Nuclear factor of activated T cell gene transcriptions (NFAT)|Nuclear factor of activated T cells]]
|341. TGF-β inhibitory elements, (TIEs) || GAGTGGTGA || Absent || 22 || [[TC element gene transcriptions|TGF-β inhibitory elements]] 01:57, 23 August 2020 || in the rat transin/stromelysin promoter 4<sup>9</sup>
 
(NFATs)
|| GGAAAA || Y || Negative strand, negative direction: TTTTCC at 3441, TTTTCC at 3345
 
Positive strand, negative direction: GGAAAA at 2968, GGAAAA at 2927
|-
|-
|185. [[Nuclear factor Y gene transcriptions|Nuclear factor Ys]] || CCAATGG(A/C)(A/G) || N || NF-Y is a trimeric complex
|342. Thyroid hormone response elements, (TREs)(THRs) || AGGTCA || Present || 331 || [[Thyroid hormone response element gene transcriptions|Thyroid hormone response elements]] 23:06, 3 March 2023‎ || likely active or activable
|-
|-
|186. [[Nutrient-sensing response element gene transcriptions|Nutrient-sensing response element 1]] || GTTTCATCA || Y || -
|343. Transcription factor 3, (TCF3) || GTCTGGT || Present || 332 || [[Transcription factor 3 gene transcriptions|Transcription factor 3]] 19:21, 5 March 2023‎ || likely active or activable
|-
|-
|183. [[Oaf1p gene transcriptions|Oaf1 transcription factor]] || CGGN<sub>3</sub>TNAN<sub>9-12</sub>CCG || Y || -
|344. Translational control sequences, (TCSs) || (A/T)TT(A/G)TCT || Present || 333 || [[Translational control sequence gene transcriptions|Translational control sequences]] 20:33, 7 March 2023‎ || likely active or activable
|-
|-
|184. [[ORE1 binding site gene transcriptions|ORESARA1]]  
|345. Transposon enhancement control (TEC) or Tec1 || GAATGT || Present || 329 || [[Tec1p gene transcriptions|Tec1ps]] 22:49, 26 February 2023 || likely random, Ste12p cofactor
 
(ORE1)
 
(Matallana)
|| (A/C/G)(A/C)GT(A/G)N<sub>5,6</sub>(C/T)AC(A/G) || Y || Negative strand, negative direction: GCGTAGAAGACACA at 3558, AAGTAGTTTCTACG at 2895
|-
|-
|185. [[ORE1 binding site gene transcriptions|ORESARA1]]  
|346. Tryptophan residues, (Lu) || GAAA || Present || 142 || [[Interferon regulatory factor gene transcriptions|Tryptophan residues]] 03:55, 18 June 2022‎ || likely active or activable, the tryptophan residues occur in the IRS, IFN, ICRE, Cell-cycle box variants, V-box, Pollen1, and β-Scaffold response elements
 
(ORE1)
 
(Olsen)
|| T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) || Y || Negative strand, negative direction: TGACGTGAG at 4341, TAACGTGAG at 3290
 
Positive strand, negative direction: ATCACGCCA at 3282
|-
|-
|186. [[P53 response element gene transcriptions|p53 response elements]] || (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) || Y || Positive strand, negative direction: AGACAAGCTT at 4186
|347. Unfolded protein response element, (URE), (UPRE-1) || CANCNTG || Present || 300 || [[Hac1p gene transcriptions|Unfolded protein response element]] 18:24, 8 January 2023 || likely active or activable
|-
|-
|187. [[P53 response element gene transcriptions|p53 response elements]]  
|348. Unfolded protein response elements, (UPREs) || TGACGTG(G/A) || Present || 334 || [[Unfolded protein response element gene transcriptions|Unfolded protein response elements]] 21:02, 7 March 2023 || likely active or activable
 
(Long1)
|| CAGGCCC || Y || Positive strand, positive direction: GGGCCTG at 745
|-
|-
|188. [[P53 response element gene transcriptions|p53 response elements]]  
|349. Upstream repressor site 1, (URS1, core), (Sumrada) || CCGCC || Present || 277 || [[DNA damage response element gene transcriptions|Upstream repressor site 1]] 06:31, 17 December 2022 || likely active or activable
 
(Long2)
|| GGGCGTG || Y || Positive strand, negative direction: GGGCGTG at 3046
|-
|-
|189. [[P63 DNA-binding site gene transcriptions|p63 DNA binding sites]] || (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T) || N || RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
|350. Upstream stimulating factors, (USFs) || GCC(A/T)NN(C/G/T)(A/G) || Present || 337 || [[Upstream stimulatory factor gene transcriptions|Upstream stimulating factors]] 05:51, 11 March 2023‎ || likely active or activable
|-
|-
|190. [[P box gene transcriptions|P-box (Mena)]] || (A/T)AAAG || Y || Negative strand, negative direction: CTTTT at 4395, CTTTT at 4390, CTTTT at 4383, TAAAG at 3688, TAAAG at 2884
|351. V boxes || (A/G)TT(A/T)(C/T) || Present || 340 || [[V box gene transcriptions|V boxes]] 20:50, 16 March 2023‎ || likely active or activable
 
Positive strand, negative direction: AAAAG at 4391, AAAAG at 4386, AAAAG at 4379, AAAAG at 3440, AAAAG at 3344, CTTTT at 3019, TAAAG at 2857
|-
|-
|191. [[P box gene transcriptions|P-box]]
|352. Vhr1ps, (VHR1), (Weider 2016), (Tang 2020) || AATCA-N<sub>8</sub>-TGA(C/T)T || Absent || 96 || [[Vhr1p gene transcriptions|Vhr1ps]] 01:26, 9 March 2021 || Response to low biotin concentrations 2*4<sup>9</sup>
 
(Motojima)  
|| TGAGTTCA || Y || -
|-
|-
|192. [[P box gene transcriptions|P-box]]
|353. Vitamin D response elements, (VDRE2s) || A/GGG/TTCAnnnA/GGG/TTCA || Absent || 97 || [[Vitamin D response element gene transcriptions|Vitamin D response elements]] 03:48, 10 March 2021 || 4<sup>10</sup>
 
(Yu)  
|| GTAA(T/C) || Y || Negative strand, negative direction: ATTAC at 3658, GTAAT at 3436, GTAAC at 3285, GTAAT at 2951
 
Positive strand, negative direction: GTAAT at 3973, ATTAC at 3469, GTAAT at 3064
|-
|-
|191. [[Pdr1,3p gene transcriptions|Pdr1p/Pdr3ps]] || TCCGCGGA || N || Pdr1p/Pdr3p response elements (PDREs)
|354. Vitamin D response elements (VDRE) (Kakhki 2018) || (A/G)G(G/T)TCA, RGKTCA || Present || 341 || [[Vitamin D response element gene transcriptions|Vitamin D response elements]] 04:37, 19 March 2023 || likely active or activable
|-
|-
|192. [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator-activated receptor alpha]] || CGACCCC || Y || Negative strand, negative direction: CGACCCC at 3037
|355. W boxes (W-boxes) (WRKY) || (C/T)TGAC(C/T) || Present || 342 || [[W box gene transcriptions|W boxes]] 20:46, 20 March 2023 || likely active or activable
|-
|-
|193. [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator hormone response elements]]  
|356. X1a boxes (Ferstl 2004) || TCTGCC || Present || 364 || [[X box gene transcriptions|X-boxes]] 04:29, 4 May 2023‎ || likely active or activable
 
(PPREs)
|| AGGTCANAGGTCA || N || PPARs/RXRs heterodimers bind to PPRE
|-
|-
|194. [[Phosphate starvation-response transcription factor gene transcriptions|Pho4ps]] || CAC(A/G)T(T/G) || Y || Negative strand, negative direction: TTACAC at 4091, AACGTG at 3288, CACGTT at 2864
|357. X1b boxes (Ferstl 2004) || AGAGACAGAT || Absent || 357 || [[X box gene transcriptions|X-boxes]] 17:57, 30 April 2023‎ || 4<sup>10</sup>
 
Positive strand, negative direction: CACATT at 4533
|-
|-
|195. [[Pollen1 element gene transcriptions|Pollen1 elements]] || AGAAA || Y || Negative strand, negative direction: TTTCT at 4505, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, TTTCT at 4083, TTTCT at 3924, TTTCT at 3665, TTTCT at 3378, TTTCT at 2892
|358. X2 boxes (Ferstl 2004) || AGGTCCA || Present || 362 || [[X box gene transcriptions|X-boxes]] 01:41, 4 May 2023‎‎ || likely active or activable
 
Positive strand, negative direction: AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAA at 3591, AGAAA at 3376, AGAAA at 3342
|-
|-
|196. [[Pollen1 element gene transcriptions|Pollen1 with TCCACCATA]] || AGAAANNNNTCCACCATA || N || adjacent co-dependent regulatory element TCCACCATA
|359. X boxes (Zhang 1993) || GTTGGCATGGCAAC || Absent || 12 ||[https://en.wikiversity.org/wiki/Gene_transcriptions/Boxes/Xs X boxes] 02:35, 20 November 2018 || X2 box is AGGTCCA 4<sup>14</sup>
|-
|-
|197. [[Polycomb response element gene transcriptions|Polycomb response elements]] || CGCCAT(A/T)TT || N || CGCCATTT
|360. X-boxes (Moreno) || GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC || Absent || 98 || [[X box gene transcriptions|X-boxes]] 16:43, 10 March 2021‎ || includes GTTNCCATGGNAAC (4/3)*2<sup>4</sup>*4<sup>7</sup>-4<sup>12</sup>
|-
|-
|198. [[Polycomb response element gene transcriptions|Polycomb response elements]]  
|361. X core promoter elements (XCPE1) || (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) || Present || 343 || [[X core promoter element gene transcriptions|X core promoter elements]] 19:37, 22 March 2023‎ || likely active or activable
 
(PRE)
|| GCCAT || Y || Positive strand, negative direction: GCCAT at 3685, ATGGC at 3629, GCCAT at 3283, ATGGC at 3005, ATGGC at 2907
|-
|-
|199. [[Pribnow box gene transcriptions|Pribnow boxes]] || TATAAT || Y || Negative strand, negative direction: TATAAT at 3468, TATAAT at 3454
|362. Xenobiotic response elements, (XREs) || (T/G)NGCGTG(A/C)(G/C)A || Absent || 83 || [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]] 20:45, 17 February 2021 || contains the core sequence GCGTG, see AHRE above 2*4<sup>7</sup>
|-
|-
|200. [[Prolamin box gene transcriptions|Prolamin boxes]] || TG(A/T)AAAG || Y || Negative strand, negative direction: TGTAAAG at 2884
|363. Xenobiotic response elements (XREs) (Shen 1992) || GCGTG || Present || 233 || [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]] 05:22, 5 November 2022 || likely active or activable
|-
|-
|201. [[Pyrimidine box gene transcriptions|Pyrimidine boxes]] || CCTTTT || Y || Negative strand, negative direction: CCTTTT at 2968, CCTTTT at 2927
|364. XhoI site-binding protein 1 protein (Xbp1p), (Mai 1997), (Tang 2020) || GcCTCGA(G/A)G(C/A)g(a/g) || Absent || 99 || [[Xbp1p gene transcriptions|Xbp1ps]] 14:40, 11 March 2021 || Transcriptional repressor 2*4<sup>10</sup>
 
Positive strand, negative direction: AAAAGG at 3441, AAAAGG at 3345
|-
|-
|202. [[Q element gene transcriptions|Q elements]]
|365. Yap response elements (Salin 2008) || T(G/T)ACT(A/C)A || Present || 365 || [[Yap1p,2p gene transcriptions|Yap response elements]] 05:18, 4 May 2023 || likely active or activable
 
See [[Retinoic acid response element gene transcriptions|Retinoic acid response element]]  
|| AGGTCA || Y || Positive strand, negative direction: AGGTCA at 4307
|-
|-
|203. [[Xenobiotic response element gene transcriptions|Quinone reductase response element]]  
|366. Yap recognition sequences (Tang 2020) || TTACTAA || Present || 344 || [[Yap1p,2p gene transcriptions|Yap recognition sequences]] 19:57, 24 March 2023 || likely active or activable
 
(QRDRE)
 
(Yao)
|| TCCCCT of TCCCCTTGCGTG || Y || -
|-
|-
|204. [[Rap1 regulatory factor gene transcriptions|Rap1 regulatory factors]] || ACCC(A/G)N(A/G)CA || N || "(ACCCRnRCA), less than half of the sites were detectably bound"<ref name=Rossi/>  
|367. Y boxes, (Koike 1997) || (A/G)CTAACC(A/G)(A/G)(C/T) || Absent || 11 || [https://en.wikiversity.org/wiki/Gene_transcriptions/Boxes/Ys Y boxes] 01:31, 20 November 2018 || inverted CAAT box, 4<sup>8</sup>  
|-
|-
|205. [[Rap1 regulatory factor gene transcriptions|Rap1 reduced consensus]] || (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) || Y || Positive strand, positive direction: GAACCCACACCTC at 1807
|368. YY1 binding sites || CCATTTA || Absent || 100 || [[YY1 gene transcriptions|YY1 binding sites]] 06:23, 12 March 2021 || 4<sup>7</sup>
|-
|-
|206. [[Reb1 general regulatory factor gene transcriptions|Reb1 bound and exact occurrences]] || TTACCC(G/T) || Y || Negative strand, negative direction: TTACCCT at 3661
|369. YY1 binding sites || CCATCTT || Present || 345 || [[YY1 gene transcriptions|YY1 binding sites]] 22:07, 25 March 2023 || likely active or activable
|-
|-
|207. [[Reb1 general regulatory factor gene transcriptions|Extended Reb1]] || ATTACCCGAA || N || "extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."<ref name=Rossi/>
|370. Z-box (ZboxN) samplings, (ZboxNs) || ATACGGT || Absent || 251 || [[Z box gene transcriptions|Z-box (ZboxN) samplings]] 19:47, 2 December 2022‎ || 4<sup>7</sup>  
|-
|-
|208. [[Retinoic acid response element gene transcriptions|Retinoic acid response element]] || AG(A/G)TCA || Y || Negative strand, negative direction: TGATCT at 3463
|371. Z-box (ZboxSo) samplings, (ZboxNs) || ATACGTGT || Absent || 252 || [[Z box gene transcriptions|Z-box (ZboxSo) samplings]] 20:21, 3 December 2022‎ || 4<sup>8</sup>
|-
|-
|209. [[Rgt1p gene transcriptions|Glucose transporter gene repressor]]
|372. Z boxes, NSoSp form || A(C/T)A(C/G)G(G/T)(A/G/T)T || Present || 249 || [[Z box gene transcriptions|Z boxes]] 17:23, 28 November 2022‎ || likely active or activable, negative direction distals within randoms
 
(Rgt1)  
|| CGG(A/G)(A/T)N(A/T)(A/T) || Y || Negative strand, negative direction: ATTTTCCG at 3442
|-
|-
|210. [[Rlm1p gene transcriptions|Rlm1ps]] || CTATATATAG || N || CTA(T/A)<sub>4</sub>TAG
|373. Z boxes, ZboxG || A(C/T)A(C/G)GT(A/G)T || Present || 250 || [[Z box gene transcriptions|Z boxes]] 03:00, 1 December 2022 || likely active or activable
|-
|-
|211. [[ROR-response element gene transcriptions|classic RORE motif]]
|374. Z boxes, ZboxSp || CAGGT(A/G) || Present || 248 || [[Z box gene transcriptions|Z boxes]] 05:10, 24 November 2022‎ || likely active or activable
(RORE)
|| A(A/T)NTAGGTCA || Y || -
|-
|-
|212. [[ROR-response element gene transcriptions|variant RORE motif]] || C(T/A)(G/A)GGNCA || Y || Negative strand, negative direction: CTGGGACA at 4369, CTGGGACA at 4208
|375. Zinc-responsive elements, (Zhao 1998), (Tang 2020) (ZREs) || ACCYYNAAGGT or ACC(C/T)(C/T)NAAGGT || Absent || 101 || [[Zap1p gene transcriptions|Zap1ps]] 15:52, 15 March 2021 || 4<sup>9</sup>
|-
|-
|213. [[Rox1p gene transcriptions|Rox1ps]] || RRRTAACAAGAG || N || Heme-dependent repressor of hypoxic genes.<ref name=Tang/>
|376. Zinc responsive elements, (ZREs), (Nicola 2007) || MHHAACCBYNMRGGT or (A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT || Absent || 102 || [[Zinc responsive element gene transcriptions|Zinc responsive elements]] 19:02, 15 March 2021 || (4/3)<sup>3</sup>*4<sup>9</sup>
|-
|}
|214. [[Rpn4p gene transcriptions|Rpn4ps]] || GGTGGCAAA || N || proteasome genes
|-
|215. [[MYB recognition element gene transcriptions|R response elements]]


(RRE)  
==Response element testing (Absent)==
|| CATCTG || Y || Negative strand, negative direction: CAGATG at 4212, CAGATG at 2988
{{main|A1BG regulatory elements and regions}}
 
{| class="wikitable sortable"
Positive strand, negative direction: CAGATG at 3919, CAGATG at 3627, CAGATG at 3620
|+ Response element
|-
|216. [[Seed-specific element gene transcriptions|Seed-specific elements]] || CATGCATG || N || SRE consensus: CAGCAGATTGCG is none
|-
|217. [[Serum response element gene transcriptions|Serum response elements]]
 
(SRE)
 
see [[CArG box gene transcriptions|CArG boxes]]
|| ACAGGATGT || Y || Negative strand, positive direction: ACAGGATGT at 3575
|-
|-
|218. [[Servenius sequence gene transcriptions|Servenius sequences]] || GGACCCT || Y || Negative strand, negative direction: GGACCCT at 4548, GGACCCT at 4496, GGACCCT at 4302
! Name of elements !! Consensus sequences !! Response element class !! Testing !! Activity
|-
|-
|219. [[Shoot specific element gene transcriptions|Shoot specific elements]] || GATAATGATG || N || SRE consensus: CAGCAGATTGCG is none
! Abbreviations !! Variations !! !! Absent (N) !! Notes
|-
|-
|220. [[Sip4p gene transcriptions|Sip4ps]] || CC(C/G)T(C/T)C(C/G)TCCG || N || CC(C/G)T(C/T)C(C/G)TCCG<ref name=Tang/>
! Authors !! !! !! !!
|-
|-
|221. [[Smp1p gene transcriptions|Smp1ps]] || ACTACTA(A/T)(A/T)(A/T)(A/T)TAG || N || ACTACTA(T/A)<sub>4</sub>TAG<ref name=Tang/>
|1. [[ABA-response element gene transcriptions|novel ABA-response elements]]  
|-
|222. [[Specificity protein gene transcriptions|SP1]]  


(Zhang)  
(ABREN, novel ABRE)  
|| (G/T)GGGCGG(G/A)(G/A)(C/T)
|| GATCGATC, CGATCGAT, GATCGAT || WD40 repeat family || N || ABREN, CGATCGAT motif, and core of ABREN and CGATCGAT motif.<ref name=Watanabe>{{ cite journal
|| Y || see GC boxes above
|author=Kenneth A. Watanabe
|author2=Arielle Homayouni
|author3=Lingkun Gu
|author4=Kuan‐Ying Huang
|author5=Tuan‐Hua David Ho
|author6=Qingxi J. Shen
|title=Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element
|journal=Plant, Cell & Environment
|date=18 June 2017
|volume=40
|issue=9
|pages=2004-2016
|url=https://onlinelibrary.wiley.com/doi/full/10.1111/pce.13006
|arxiv=
|bibcode=
|doi=10.1111/pce.13006
|pmid=
|accessdate=5 October 2020 }}</ref>
|-
|-
|223. [[Specificity protein gene transcriptions|SP1-box 1]]  
|2. [[ABA-response element gene transcriptions|ABA-response element-like]]  


(Motojima)  
(ABRE-like)  
|| GGGGCT || Y || Positive strand, negative direction: GGGGCT at 3039
|| ACGTGTCC || WD40 repeat family || N || third highest scoring motif.<ref name=Watanabe/>
|-
|-
|224. [[Specificity protein gene transcriptions|SP1-box 2]]  
|3. [[Abf1 regulatory factor gene transcriptions|Abf1 regulatory factors]] || CGTCCTCTACGAT || General Regulatory Factors || N || CGTNNNNNACGAT.<ref name=Rossi>{{ cite journal
 
|author=Matthew J. Rossi
(Motojima)
|author2=William K.M. Lai
|| CTGCCC || Y || Positive strand, negative direction: CTGCCC at 3853
|author3=B. Franklin Pugh
|-
|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
|225. [[Specificity protein gene transcriptions|SP-1]]
|journal=Genome Research
 
|date=21 March 2018
(Sato)
|volume=28
|| CCGCCCC || Y || Negative strand, positive direction: GGGGCGG at 4439, GGGGCGG at 4429 
|issue=
|pages=497-508
|url=https://genome.cshlp.org/content/28/4/497.full
|arxiv=
|bibcode=
|doi=10.1101/gr.229518.117
|pmid=29563167
|accessdate=31 August 2020 }}</ref>
|-
|-
|226. [[Specificity protein gene transcriptions|SP1]]  
|4. [[Activating protein gene transcriptions|Activating proteins]]  


(Long)  
(Murata)  
|| GGGGCGGGCC || N || GGGGCGGGCC<ref name=Long/>  
|| GCCCACGGG || bHSH || N || Activating protein 2.<ref name=Murata>{{ cite journal
|-
|author=Takayuki Murata
|227. [[Specificity protein gene transcriptions|SP1]]
|author2=Chieko Noda
 
|author3=Yohei Narita1
(Yao)
|author4=Takahiro Watanabe
|| GCGGC || Y || Negative strand, negative direction: GCCGC at 2726
|author5=Masahiro Yoshida
 
|author6=Keiji Ashio
Positive strand, negative direction: GCGGC at 2725 
|author7=Yoshitaka Sato
|-
|author8=Fumi Goshima
|228. [[STAT5 gene transcription laboratory|STAT5]] || TTCNNNGAA || Y || Positive strand, negative direction: TTCCCTGAA at 3782, TTCGTTGAA at 3506
|author9=Teru Kanda
|-
|author10=Hironori Yoshiyama
|229. [[Sterol response element gene transcriptions|Sterol response elements]]
|author11=Tatsuya Tsurumi
 
|author12=Hiroshi Kimura
(Branco)
|title=Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)
|| TCGTATA || N || perhaps plant specific
|journal=Journal of Virology
|date=27 January 2016
|volume=
|issue=
|pages=
|url=https://jvi.asm.org/content/jvi/early/2016/01/21/JVI.03227-15.full.pdf
|arxiv=
|bibcode=
|doi=10.1128/JVI.03227-15
|pmid=
|accessdate=4 October 2020 }}</ref>
|-
|-
|229. [[Sterol response element gene transcriptions|Sterol response elements]]  
|5. [[Xenobiotic response element gene transcriptions|AhR-responsive elements]]  
 
(AHRE)


(Yao)  
(Yao)  
|| AGCAGATTGCG || N || liver specific
|| (G/T)NGCGTG(A/C)(C/G)A || bHLH || N || in the promoter region of AhR responsive genes
|-
|-
|230. [[Msn2,4p gene transcriptions|Stress-response elements]]  
|6. [[Alpha-amylase conserved element gene transcriptions|Alpha-amylase conserved elements]] || TATCCA || ? || N || TATCCATCCATCC.<ref name=Sharma>{{ cite journal
 
|author=Bhaskar Sharma
(STREs)
|author2=Joemar Taganna
|| CCCCT || Y || Negative strand, negative direction: CCCCT at 2924
|title=Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato
 
|journal=Scientific Reports
Positive strand, negative direction: CCCCT at 3059
|date=12 June 2020
|-
|volume=10
|231. [[Sucrose box gene transcriptions|Sucrose boxes]] || NNAATCA || Y || Negative strand, negative direction: TGATTCC at 3474, TGATTTT at 3163, TGATTCG at 3032, TGATTCG at 2915
|issue=9581
|pages=
|url=https://www.nature.com/articles/s41598-020-66553-1
|arxiv=
|bibcode=
|doi=10.1038/s41598-020-66553-1
|pmid=32533036
|accessdate=27 August 2020 }}</ref>
|-
|-
|232. [[TACTAAC box gene transcriptions|TACTAAC boxes]] || TACTAA(C/T) || Y || Positive strand, positive direction: TACTAAT at 4157, ATTAGTA at 4148
|7. [[Amino acid response element gene transcriptions|Amino acid response elements]]  
|-
|233. [[TAGteam gene transcriptions|TAGteams]] || CAGGTAG || Y || Negative strand, positive direction: CAGGTAG at 4035, CTACCTG at 1198
|-
|234. [[Tapetum box gene transcriptions|Tapetum boxes]] || TCGTGT || Y || Negative strand, negative direction: ACACGA at 4402, TCGTGT at 3915
|-
|235. [[TATA box gene transcriptions|TATA boxes]] || TATA(A/T)A(A/T)(A/G) || Y || Negative strand, negative direction: TTTATATA at 2871


Positive strand, negative direction: TATATAAA at 2874
(AARE)
|-
|236. [[TAT box gene transcriptions|TAT Boxes]]


(Yang)  
(Maruyama)  
|| TATAAAA || Y || Negative strand, negative direction: TATAAAA at 2853
|| ATTGCATCA || ? || N || AARE1 (ATTGCATCA)<ref name=Maruyama/>
|-
|-
|237. [[TAT box gene transcriptions|TAT Boxes]]
|8. [[Amino acid response element gene transcriptions|Amino acid response elements]]  
{Fan)
|| TATCCAT || Y || Negative strand, negative direction: ATGGATA at 2996
|-
|238. [[TATC box gene transcriptions|TATCCAC boxes]] || TATCCAC || N || GA responsive complex component
|-
|239. [[T box gene transcriptions|T boxes]]  


(Conlon)  
(AARE)  
|| TCACACCT || Y || positive strand: TCACACCT at 3968, TCACACCT at 1129
|-
|240. [[T box gene transcriptions|T boxes]]


(Zhang)  
(Broer)  
|| AACGTT || Y || positive strand: AACGTT at 2691, AACGTT at 1614
|| TTTGCATCA || ? || N || TTTGCATCA.<ref name=Broer>{{ cite journal
|-
|author=Angelika Bröer
|241. [[TCCACCATA element gene transcriptions|TCCACCATA elements]] || TCCACCATA || N || adjacent co-dependent regulatory element of POLLEN1
|author2=Gregory Gauthier-Coles
|-
|author3=Farid Rahimi
|242. [[TEA consensus sequence gene transcriptions|TEA consensus sequences]] || CATTCY || Y || Positive strand, negative direction: GGAATG at 4554, AGAATG at 3003
|author4=Michelle van Geldermalsen
|-
|author5=Dieter Dorsch􏰀
|243. [[Tec1p gene transcriptions|Tec1ps]] || GAATGT || Y || Ste12p cofactor
|author6=Ansgar Wegener
|-
|author7=Jeff Holst
|244. [[Telomeric repeat DNA-binding factor gene transcriptions|Telomeric repeat DNA-binding factors]]  
|author8=Stefan Bröer
 
|title=Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells
(TRFs)  
|journal=Journal of Biological Chemistry
|| TTAGGG || Y || Negative strand, negative direction: TTAGGG at 3976, TTAGGG at 3067
|date=March 15, 2019
|-
|volume=294
|245. [[Tetradecanoylphorbol-13-acetate response element gene transcriptions|Tetradecanoylphorbol-13-acetate response elements]]  
|issue=11
|pages=4012-4026
|url=https://www.jbc.org/content/294/11/4012.full.pdf
|arxiv=
|bibcode=
|doi=10.1074/jbc.RA118.006378
|pmid=
|accessdate=4 October 2020 }}</ref><ref name=Garaeva>{{ cite journal
|author=Alisa A. Garaeva
|author2=Irina E. Kovaleva
|author3=Peter M. Chumakov
|author4=Alexandra G. Evstafieva
|title=Mitochondrial dysfunction induces ''SESN2'' gene expression through Activating Transcription Factor 4
|journal=Cell Cycle
|date=15 January 2016
|volume=15
|issue=1
|pages=64-71
|url=https://www.tandfonline.com/doi/full/10.1080/15384101.2015.1120929
|arxiv=
|bibcode=
|doi=10.1080/15384101.2015.1120929
|pmid=26771712
|accessdate=5 September 2020 }}</ref>
|-
|9. [[Amino acid response element gene transcriptions|Amino acid response element-like]]  
 
(AARE-like)  
|| TGGTGAAAG || ? || N || AARE-like sequence (TGGTGAAAG, named AARE3).<ref name=Maruyama>{{ cite journal
|author=Ryuto Maruyama
|author2=Makoto Shimizu
|author3=Juan Li, Jun Inoue
|author4=Ryuichiro Sato
|title=''Fibroblast growth factor 21'' induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region
|journal=Bioscience, Biotechnology, and Biochemistry
|date=24 March 2016
|volume=80
|issue=5
|pages=929-934
|url=https://www.tandfonline.com/doi/pdf/10.1080/09168451.2015.1135045
|arxiv=
|bibcode=
|doi=10.1080/09168451.2015.1135045
|pmid=
|accessdate=4 October 2020 }}</ref>
|-
|10. [[Androgen response element gene transcriptions|Androgen response elements]]  
 
(AREs)
 
(Kouhpayeh)
|| GGTACANNNTGTTCT || Zinc finger DNA-binding domain || N || GGTACACGGTGTTCT.<ref name=Kouhpayeh>{{ cite journal
|author=S Kouhpayeh
|author2=AR Einizadeh
|author3=Z Hejazi
|author4=M Boshtam
|author5=L Shariati
|author6=M Mirian
|author7=L Darzi
|author8=M Sojoudi
|author9=H Khanahmad
|author10=A Rezaei
|title=Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line
|journal=Cancer Gene Therapy
|date=1 July 2016
|volume=23
|issue=
|pages=254-257
|url=https://www.researchgate.net/profile/Mina_Mirian/publication/304707422_Antiproliferative_effect_of_a_synthetic_aptamer_mimicking_androgen_response_elements_in_the_LNCaP_cell_line/links/59ffed00458515d0706e4f27/Antiproliferative-effect-of-a-synthetic-aptamer-mimicking-androgen-response-elements-in-the-LNCaP-cell-line.pdf
|arxiv=
|bibcode=
|doi=10.1038/cgt.2016.26
|pmid=
|accessdate=3 October 2020 }}</ref>
|-
|11. [[Androgen response element gene transcriptions|Androgen response elements]]
 
(AREs)
 
(Wilson)
|| TGATTCGTGAG || Zinc finger DNA-binding domain || N || AGAACANNNTGTTCT.<ref name=Wilson>{{ cite journal
|author=Stephen Wilson, Jianfei Qi & Fabian V. Filipp
|title=Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines
|journal=Scientific Reports
|date=14 September 2016
|volume=6
|issue=
|pages=32611
|url=https://www.nature.com/articles/srep32611
|arxiv=
|bibcode=
|doi=10.1038/srep32611
|pmid=
|accessdate=3 October 2020 }}</ref>
|-
|12. [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]]
 
(Otsuki)
|| GTGAGGTCGC || bHLH || N || GTGAGGTCGC.<ref name=Otsuki>{{ cite journal
|author=Akihito Otsuki
|author2=Mikiko Suzuki
|author3=Fumiki Katsuoka
|author4=Kouhei Tsuchida
|author5=Hiromi Suda
|author6=Masanobu Morita
|author7=Ritsuko Shimizu
|author8=Masayuki Yamamoto
|title=Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection
|journal=Free Radical Biology and Medicine
|date=February 2016
|volume=91
|issue=
|pages=45-57
|url=https://www.sciencedirect.com/science/article/abs/pii/S0891584915011478
|arxiv=
|bibcode=
|doi=10.1016/j.freeradbiomed.2015.12.005
|pmid=26677805
|accessdate=21 August 2020 }}</ref> or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A<ref name=Lacher>{{ cite journal
|author=Sarah E. Lacher
|author2=Daniel C. Levings
|author3=Samuel Freeman
|author4=Matthew Slattery
|title=Identification of a functional antioxidant response element at the HIF1A locus
|journal=Redox Biology
|date=October 2018
|volume=19
|issue=
|pages=401-411
|url=https://www.sciencedirect.com/science/article/pii/S2213231718305391
|arxiv=
|bibcode=
|doi=10.1016/j.redox.2018.08.014
|pmid=
|accessdate=6 October 2020 }}</ref>, an antioxidant response element (ARE)
|-
|13. [[CAAT box gene transcriptions|CAAT boxes]] || (C/T)(A/G)(A/G)CCAATC(A/G) || bZIP || N || consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.
|-
|14. [[Calcium-response element gene transcriptions|Calcium-response elements]] || CTATTTCGAG || ? || N || CaRE1 CTATTTCGAG.<ref name=Tao>{{ cite journal
|author=Xu Tao
|author2=Anne E. West
|author3=Wen G. Chen
|author4=Gabriel Corfas
|author5=Michael E. Greenberg
|title=A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF
|journal=Neuron
|date=2002
|volume=33
|issue=
|pages=383-95
|url=https://www.cell.com/neuron/fulltext/S0896-6273(01)00561-X?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS089662730100561X%3Fshowall%3Dtrue
|arxiv=
|bibcode=
|doi=10.1016/S0896-6273(01)00561-X
|pmid=11832226
|accessdate=2 September 2020 }}</ref>
|-
|15. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]]
 
(ChREs)
|| CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG || ? || N || ChoRE1, ChoRE2.<ref name=Long>{{ cite journal
|author=Jianyin Long
|author2=Daniel L. Galvan
|author3=Koki Mise
|author4=Yashpal S. Kanwar
|author5=Li Li
|author6=Naravat Poungavrin
|author7=Paul A. Overbeek
|author8=Benny H. Chang
|author9=Farhad R. Danesh
|title=Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1
|journal=Journal of Biological Chemistry
|date=28 May 2020
|volume=5
|issue=28
|pages=
|url=https://www.jbc.org/content/early/2020/05/28/jbc.RA120.013228.full.pdf
|arxiv=
|bibcode=
|doi=10.1074/jbc.RA120.013228
|pmid=
|accessdate=6 October 2020 }}</ref>
|-
|16. [[Carbon source-responsive element gene transcriptions|Carbon source-responsive elements]]
 
(CSREs)
|| CATTCATCCG || ? || N || confers carbon source-dependent regulation
|-
|17. [[Cbf1 regulatory factor gene transcriptions|Cbf1 regulatory factors]] || TCACGTGA || ? || N || strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end.
|-
|18. [[C box gene transcriptions|C-boxes]]
 
(Johnson)
|| GAGGCCATCT || bZIP || N || GAGGCCATCT.<ref name=Johnson>{{ cite journal
|author=PA Johnson
|author2=D Bunick
|author3=NB Hecht
|title=Protein Binding Regions in the Mouse and Rat Protamine-2 Genes
|journal=Biology of Reproduction
|date=1991
|volume=44
|issue=1
|pages=127-134
|url=https://academic.oup.com/biolreprod/article-pdf/44/1/127/10536199/biolreprod0127.pdf
|arxiv=
|bibcode=
|doi=10.1095/biolreprod44.1.127
|pmid=2015343
|accessdate=6 April 2019 }}</ref>
|-
|19. [[C box gene transcriptions|C/A hybrid boxes]] || TGACGTAT || bZIP || N || TGACGTAT.<ref name=Song>{{ cite journal
|author=Young Hun Song
|author2=Cheol Min Yoo
|author3=An Pio Hong
|author4=Seong Hee Kim
|author5=Hee Jeong Jeong
|author6=Su Young Shin
|author7=Hye Jin Kim
|author8=Dae-Jin Yun
|author9=Chae Oh Lim
|author10=Jeong Dong Bahk
|author11=Sang Yeol Lee
|author12=Ron T. Nagao
|author13=Joe L. Key
|author14=Jong Chan Hong
|title=DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins
|journal=Plant Physiology
|date=April 2008
|volume=146
|issue=4
|pages=1862–1877
|url=http://www.plantphysiol.org/content/plantphysiol/146/4/1862.full.pdf
|arxiv=
|bibcode=
|doi=10.1104/pp.107.113217
|pmid=18287490
|accessdate=26 March 2019 }}</ref> A at the 12 position
|-
|20. [[C box gene transcriptions|C/T hybrid boxes]] || TGACGTTA || bZIP || N || TGACGTTA.<ref name=Song/> T at the 12 position
|-
|21. [[CCCTC-binding factor gene transcriptions|CCCTC-binding factors]]
 
(CTCF)
|| NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T) || ? || N || NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C).<ref name=Hashimoto>{{ cite journal
|author=Hideharu Hashimoto
|author2=Dongxue Wang
|author3=John R. Horton
|author4=Xing Zhang
|author5=Victor G. Corces
|author6=Xiaodong Cheng
|title=Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA
|journal=Molecular Cell
|date=1 June 2017
|volume=66
|issue=5
|pages=711-720.e3
|url=https://www.sciencedirect.com/science/article/pii/S1097276517303179
|arxiv=
|bibcode=
|doi=10.1016/j.molcel.2017.05.004
|pmid=28529057
|accessdate=28 August 2020 }}</ref>
|-
|22. [[C-EBP box gene transcriptions|C/EBP boxes]] || TTAGGACAT,<ref name=Misra>{{ cite journal
|author=Ravi P. Misra
|author2=Azad Bonni
|author3=Cindy K. Miranti
|author4=Victor M. Rivera
|author5=Morgan Sheng
|author6=Michael E.Greenberg
|title=L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway
|journal=The Journal of Biological Chemistry
|date=14 October 1994
|volume=269
|issue=41
|pages=25483-25493
|url=http://www.jbc.org/content/269/41/25483.full.pdf
|arxiv=
|bibcode=
|doi=
|pmid=7929249
|accessdate=7 December 2019 }}</ref> or TAGCATT.<ref name=Yao>{{ cite journal
| author = Yao EF
|author2=Denison MS
| title = DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer
| journal = Biochemistry
| volume = 31
| issue = 21
| pages = 5060–7
| date = June 1992
| pmid = 1318077
| doi = 10.1021/bi00136a019 }}</ref> || bZIP || N || CCAAT-enhancer-binding site (C/EBP) is TAGCATT
|-
|23. [[Cell-cycle box gene transcriptions|Cell-cycle boxes]]
 
(CCBs)
|| CACGAAAA || ? || N || "cell cycle box" is functional in either orientation, acting as an enhancer
|-
|24. [[Cell cycle regulation gene transcriptions|Cell cycle regulation]] || CCCAACGGT<ref name=Sharma/> || ? || N || tomato genome-wide analysis
|-
|25. [[CENP-B box gene transcriptions|CENP-B boxes]] || TTTCGTTGGAAGCGGGA || ? || N || specifically localized at the centromere
|-
|26. [[Coupling element gene transcriptions|Coupling elements]]
 
(CE1)
|| TGCCACCGG<ref name=Watanabe/> || ? || N || CE1 (Watanabe)
|-
|27. [[DAF-16-associated element gene transcriptions|DAF-16-associated elements]]
 
(DAE)
|| TGATAAG || ? || N || DAF-16-associated element (DAE).<ref name=Li>{{ cite journal
|author=Yan-Hui Li
|author2=Gai-Gai Zhang
|title=Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in ''Caenorhabditis elegans''
|journal=Oncotarget
|date=12 April 2016
|volume=7
|issue=15
|pages=19185-19192
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4991374/
|arxiv=
|bibcode=
|doi=10.18632/oncotarget.8313
|pmid=2702736
|accessdate=27 August 2020 }}</ref>
|-
|28. [[D box gene transcriptions|D-boxes]]
 
(Mracek1)
|| GTTGTATAAC || ? || N || GTTGTATAAC.<ref name=Mracek>{{ cite journal
|author=Philipp Mracek
|author2=Cristina Santoriello
|author3=M. Laura Idda
|author4=Cristina Pagano
|author5=Zohar Ben-Moshe
|author6=Yoav Gothilf
|author7=Daniela Vallone
|author8=Nicholas S. Foulkes
|title=Regulation of ''per'' and ''cry'' Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression
|journal=PLoS ONE
|date=December 6, 2012
|volume=7
|issue=12
|pages=e51278
|url=https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0051278
|arxiv=
|bibcode=
|doi=10.1371/journal.pone.0051278
|pmid=
|accessdate=10 February 2019 }}</ref>
|-
|29. [[D box gene transcriptions|D-boxes]]
 
(Mracek)
|| CTTATGTAAA (Mracek2) || ? || N || CTTATGTAAA.<ref name=Mracek/>
|-
|30. [[D box gene transcriptions|D-boxes]]
(Johnson)
|| TCTCACA || ? || N || TCTCACATT(A/C)AATAAGTCA is a D-box.<ref name=Johnson/>
|-
|31. [[Defense and stress-responsive element gene transcriptions|Defense and stress-responsive elements]] || ATTTTCTTCA || ? || N || ATTTTCTTCA.<ref name=Sharma/>
|-
|32. [[DNA damage response element gene transcriptions|DNA damage response elements]]
 
(DREs)
 
(Smith)
|| TTTCAAT<ref name=Smith>{{ cite journal
|author=Joshua J. Smith, Eric S. Cole, Daniel P. Romero
|title=Transcriptional control of RAD51 expression in the ciliate ''Tetrahymena thermophila''
|journal=Nucleic Acids Research
|date=15 July 2004
|volume=32
|issue=14
|pages=4313-4321
|url=https://academic.oup.com/nar/article/32/14/4313/1279821
|arxiv=
|bibcode=
|doi=10.1093/nar/gkh771
|pmid=15304567
|accessdate=4 September 2020 }}</ref> || ? || N || in the upstream repression sequence (URS)
|-
|33. [[DNA damage response element gene transcriptions|DNA damage response elements]]
 
(DREs)
 
(Sumrada)
|| TAGCCGCCG of TAGCCGCCGRRRR.<ref name=Sumrada>{{ cite journal
|author=Roberta A. Sumrada and Terrance G. Cooper
|title=Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast
|journal=Proceedings of the National Academy of Sciences USA
|date=June 1987
|volume=84
|issue=
|pages=3997-4001
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC305008/pdf/pnas00277-0054.pdf
|arxiv=
|bibcode=
|doi=10.1073/pnas.84.12.3997
|pmid=3295874
|accessdate=6 September 2020 }}</ref> || ? || N || in the upstream repression sequence (URS)
|-
|34. [[DNA replication-related element gene transcriptions|DNA replication-related elements]]
 
(DREs)
|| TATCGATA || ? || N || DNA replication-related element (DRE).<ref name=Hirose>{{ cite journal
|author=Fumiko Hirose
|author2=Masamitsu Yamaguchi
|author3=Akio Matsukage
|title=Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a ''Drosophila'' Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc
|journal=Molecular and Cellular Biology
|date=September 1999
|volume=19
|issue=9
|pages=6020-6028
|url=https://mcb.asm.org/content/19/9/6020.full
|arxiv=
|bibcode=
|doi=10.1128/MCB.19.9.6020
|pmid=10454549
|accessdate=4 September 2020 }}</ref>
|-
|35. [[DREB box gene transcriptions|DREB boxes]] || TACCGACAT || ? || N || CRT/DREB box
|-
|36. [[EIF4E basal element gene transcriptions|EIF4E basal elements]] || TTACCCCCCCTT || ? || N || poly(C) motif
|-
|37. [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]]
 
(ERSE)
|| CCAAT-N9-CCACG || bZIP || N || compare CCAAT-box and ERSE below in the (present)
|-
|38. [[Estrogen response element gene transcriptions|Estrogen response elements]]
 
(EREs)
|| AGGTTA or GGTCAGGAT || {{chem|Cys|4}} || N || AGGTTATTGCCTCCT or GGTCAGGATGAC
|-
|39. [[I box gene transcriptions|F boxes]] || TGATAAG<ref name=Rose>{{ cite journal
|author=Annkatrin Rose, Iris Meier and Udo Wienand
|title=The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins
|journal=The Plant Journal
|date=28 October 1999
|volume=20
|issue=6
|pages=641-652
|url=https://onlinelibrary.wiley.com/doi/pdf/10.1046/j.1365-313X.1999.00638.x
|arxiv=
|bibcode=
|doi=10.1046/j.1365-313X.1999.00638.x
|pmid=
|accessdate=8 November 2018 }}</ref> || ? || N || F-box overlaps the I-box
|-
|40. [[Forkhead box gene transcriptions|Forkhead boxes]] || GTAAACAA<ref name=Yoshihara>{{ cite journal
|author=Eiji Yoshihara
|title=TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis
|journal=Antioxidants
|date=18 August 2020
|volume=9
|issue=8
|pages=765-84
|url=https://www.mdpi.com/2076-3921/9/8/765/pdf
|arxiv=
|bibcode=
|doi=10.3390/antiox9080765
|pmid=32824669
|accessdate=5 September 2020 }}</ref> || HTH, Forkhead || N || GTAAACAA FOXO1
|-
|41. [[Gal4p gene transcriptions|Gal4ps]] || CGGACCGC || ? || N || CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG<ref name=Tang>{{ cite journal
|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
|journal=Metabolites
|date=6 August 2020
|volume=10
|issue=8
|pages=320-39
|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
|arxiv=
|bibcode=
|doi=10.3390/metabo10080320
|pmid=32781665
|accessdate=18 September 2020 }}</ref>
|-
|42. [[Γ-interferon activated sequence gene transcriptions|γ-interferon activated sequences]]
 
(GAS)
|| TTCCTAGAA || ? || N || ALS-GAS1 between nt −633 and nt −625
|-
|43. [[G box gene transcriptions|G boxes]] || (G/T)CCACGTG(G/T)C || ? || N || no "perfect palindrome" G boxes in either promoter
|-
|44. [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]] || TGACTCA, TGAGTCA || bZIP || N || ACGT motif
|-
|45. [[Gcn4p gene transcriptions|Gcn4ps]] || ATGACTCTT<ref name=Tang/> || bZIP || N || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]]
|-
|46. [[GARE gene transcriptions|Gibberellin responsive element-like 2]]
 
(GARE-like 2)
 
(Fan)
|| TAACGTA<ref name=Fan>{{ cite journal
|author=Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng
|title=Gibberellin Signal Transduction in Rice
|journal=Journal of Integrative Plant Biology
|date=2007
|volume=49
|issue=6
|pages=731−741
|url=https://onlinelibrary.wiley.com/doi/pdf/10.1111/j.1744-7909.2007.00511.x
|arxiv=
|bibcode=
|doi=10.1111/j.1744-7909.2007.00511.x
|pmid=
|accessdate=16 October 2018 }}</ref> || ? || N || "in the promoters of hydrolase genes".<ref name=Fan/>
|-
|47. [[GLM box gene transcriptions|GLM boxes]] || (G/A)TGA(G/C)TCA(T/C) || ? || N || GCN4-like motif
|-
|48. [[Grainy head transcription factor gene transcriptions|Grainy head transcription factor binding sites]] || AACCGGTT || β-Scaffold factors with minor groove contacts || N || also GACTGGTT
|-
|49. [[TC element gene transcriptions|GT boxes]]
 
(Motojima)
|| TGGGTGGGGCT || ? || N || (-78 to -69)
|-
|50. [[Middle sporulation element gene transcriptions|Hapless motifs]] || CCAATCA || ? || N || heterotrimeric transcription factor, HAP2/3/4.<ref name=Ozsarac>{{ cite journal
| author = Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes
| title = Regulation of Gene Expression during Meiosis in ''Saccharomyces cerevisiae'': ''SPR3'' Is Controlled by both ABFI and a New Sporulation Control Element
| journal = Molecular and Cellular Biology
| volume = 17
| issue = 3
| pages = 1152–9
| date = March 1997
| pmid = 9032242
| pmc = 231840
| doi = 10.1128/MCB.17.3.1152 }}</ref>
|-
|51. [[Heat-responsive element gene transcriptions|Heat-responsive elements]] || AAAAAATTTC  || Helix-turn-helix (HTH), Heat shock factors (HSFs) || N || four nGAAn motifs
|-
|52. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE1)
 
(Eastmond)
|| nGAAnnTTCnnGAAn || HTH, HSFs || N || HSE1
|-
|53. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE2)
 
(Eastmond)
|| nTTCnnGAAnnTTCn || HTH, HSFs || N || HSE2 is the inverse complement of HSE1
|-
|54. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE5)
 
(Eastmond)
|| nTTCn-(5-bp)-nTTCnnGAAn || HTH, HSFs || N || HSE5
|-
|55. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE6)
 
(Eastmond)
|| nTTCn-nnGAAn-(5-bp)-nGAAn || HTH, HSFs || N || HSE6
|-
|56. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE7)
 
(Eastmond)
|| nGA(A/G)nnTTCnnGAAn || HTH, HSFs || N || HSE7 PFT1
|-
|57. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE)
 
(Eastmond)
|| nGAAnnTTCnnGA(A/G)n || HTH, HSFs || N || HSE7 PFT2
|-
|58. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE10)
 
(Eastmond)
||  nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn || HTH, HSFs || N || HSE10
|-
|59. [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]]
 
(HIF-1)
|| GCCCTACGTGCTGTCTCA<ref name=Li2020>{{ cite journal
|author=Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen
|title=Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity
|journal=Oncogene
|date=July 2020
|volume=39
|issue=29
|pages=5187-5200
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7398576/
|arxiv=
|bibcode=
|doi=10.1038/s41388-020-1344-y
|pmid=32555331
|accessdate=29 August 2020 }}</ref> || bHLH || N || composed of HIF-1α and HIF-1β
|-
|60. [[I box gene transcriptions|I boxes]] || GATAAG || ? || N || GGATGAGATAAGA
|-
|61. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
 
(ICRE)
 
(Case)
|| CANNTGAAAT || ? || N || version of Lopes, see below
|-
|62. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
 
(ICRE)
 
(Lopes)
|| ATGTGAAAT || ? || N || using ANNTGAAAT
|-
|63. [[Interferon regulatory factor gene transcriptions|Interferon-stimulated response elements]]
 
(ISREs)
|| AGTTTCN<sub>2</sub>TTTCN || ? || N || consensus sequence AGTTTCN<sub>2</sub>TTTCN.<ref name=Michalska>{{ cite journal
|author=Agata Michalska, Katarzyna Blaszczyk, Joanna Wesoly and Hans A. R. Bluyssen
|title=A Positive Feedback Amplifier Circuit That Regulates Interferon (IFN)-Stimulated Gene Expression and Controls Type I and Type II IFN Responses
|journal=Frontiers in Immunology
|date=28 May 2018
|volume=9
|issue=
|pages=1135
|url=https://www.frontiersin.org/articles/10.3389/fimmu.2018.01135/full
|arxiv=
|bibcode=
|doi=10.3389/fimmu.2018.01135
|pmid=
|accessdate=18 March 2021 }}</ref>
|-
|64. [[Kozak sequence gene transcriptions|Kozak sequences]] || GCCGCC(A/G)CCATGG || ? || N || GCCGCC(A/G)CCATGG<ref name=Kozak1987>{{ cite journal
|author=Marilyn Kozak
|date=October 1987
|title=An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs
|url=http://nar.oxfordjournals.org/cgi/pmidlookup?view=long&pmid=3313277
|journal=Nucleic Acids Research
|volume=15
|issue=20
|pages=8125–8148
|doi=10.1093/nar/15.20.8125
|pmid=3313277 }}</ref>
|-
|65. [[Kozak sequence gene transcriptions|Kozak sequences]]
 
(Matsumoto)
|| GAAAATGG || ? || N || GAAAATGG<ref name=Matsumoto>{{ cite journal
|author=Takuya Matsumoto
|author2=Saemi Kitajima
|author3=Chisato Yamamoto
|author4=Mitsuru Aoyagi
|author5=Yoshiharu Mitoma
|author6=Hiroyuki Harada
|author7=Yuji Nagashima
|title=Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes''
|journal=Fisheries Science
|date=9 August 2020
|volume=86
|issue=
|pages=873-887
|url=https://researchmap.jp/hiroyukiharada/published_papers/29953426/attachment_file.pdf
|arxiv=
|bibcode=
|doi=10.1007/s12562-020-01451-z
|pmid=
|accessdate=27 September 2020 }}</ref>
|-
|66. [[L box gene transcriptions|L boxes]] || AAATTAACCAA || ? || N || AAATTAACCAA<ref name=Donald>{{ cite journal
|author=Robert G. K. Donald and Anthony R. Cashmore
|title=Mutation of either G box or I box sequences profoundly affects expression from the ''Arabidopsis rbcS‐1A'' promoter
|journal=The EMBO Journal
|date=1990
|volume=9
|issue=6
|pages=1717-1726
|url=https://onlinelibrary.wiley.com/doi/pdf/10.1002/j.1460-2075.1990.tb08295.x
|arxiv=
|bibcode=
|doi=10.1002/j.1460-2075.1990.tb08295.x
|pmid=
|accessdate=8 November 2018 }}</ref>
|-
|67. [[Maf recognition element gene transcriptions|Maf recognition element]]
 
(MAREs)
|| TGCTGA(G/C)TCAGCA || ? || N || and TGCTGA(GC/CG)TCAGCA<ref name=Kyo>{{ cite journal
|author=Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto
|title=Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique
|journal=Genes to Cells
|date=13 February 2004
|volume=9
|issue=2
|pages=
|url=https://onlinelibrary.wiley.com/doi/full/10.1111/j.1356-9597.2004.00711.x
|arxiv=
|bibcode=
|doi=10.1111/j.1356-9597.2004.00711.x
|pmid=
|accessdate=8 September 2020 }}</ref>
|-
|68. [[Met31p box gene transcriptions|Met3s]] || TCACGTG || bZIP || N || TCACGTG<ref name=Blaiseau/>
|-
|68. [[M box gene transcriptions|M boxes]] || GTCATGTGCT || ? || N || or AGTCATGTGCT<ref name=Bertolotto>{{ cite journal
|author=Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti
|title=Different ''cis''-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia
|journal=Molecular and Cellular Biology
|date=February 1998
|volume=18
|issue=2
|pages=694–702
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC108780/
|arxiv=
|bibcode=
|doi=
|pmid=9447965
|accessdate=8 December 2018 }}</ref>
|-
|69. [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]] || TT(A/T)CCNN(A/T)TNGG(A/T)AA || ? || N || Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.<ref name=Rossi/>
|-
|70. [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]]
 
 
(Rossi)
|| TTNCCNNNTNNGGNAA || ? || N || Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.<ref name=Rossi/>
|-
|71. [[Motif ten element gene transcriptions|Motif ten elements]] || C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G) || ? || N || Gene ID: 6309
|-
|72. [[Nuclear factor gene transcriptions|NF‐κB/Rel family of eukaryotic transcription factors]] || CCCCTAAGGGG || β-Scaffold factors with minor groove contacts || N || [[NF-κB]]
|-
|73. [[Nuclear factor gene transcriptions|Nuclear factor 1]]
 
(NF-1)
|| TTGGCNNNNNGCCAA || NF I || N || palindromic sequence
|-
|74. [[Nuclear factor Y gene transcriptions|Nuclear factor Ys]] || CCAATGG(A/C)(A/G) || ? || N || NF-Y is a trimeric complex
|-
|75. [[P63 DNA-binding site gene transcriptions|p63 DNA binding sites]] || (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T) || β-Scaffold factors with minor groove contacts || N || RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
|-
|76. [[Pdr1,3p gene transcriptions|Pdr1p/Pdr3ps]] || TCCGCGGA || ? || N || Pdr1p/Pdr3p response elements (PDREs)
|-
|77. [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator hormone response elements]]
 
(PPREs)
|| AGGTCANAGGTCA || ? || N || PPARs/RXRs heterodimers bind to PPRE
|-
|78. [[Pollen1 element gene transcriptions|Pollen1 with TCCACCATA]] || AGAAANNNNTCCACCATA || ? || N || adjacent co-dependent regulatory element TCCACCATA
|-
|79. [[Pollen1 element gene transcriptions|TCCACCATA]] || TCCACCATA || ? || N || no regulatory element TCCACCATA was found, nor its ci.
|-
|80. [[Polycomb response element gene transcriptions|Polycomb response elements]] || CGCCAT(A/T)TT || ? || N || CGCCATTT
|-
|81. [[Rap1 regulatory factor gene transcriptions|Rap1 regulatory factors]] || ACCC(A/G)N(A/G)CA || ? || N || "(ACCCRnRCA), less than half of the sites were detectably bound"<ref name=Rossi/>
|-
|82. [[Reb1 general regulatory factor gene transcriptions|Extended Reb1]] || ATTACCCGAA || ? || N || "extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."<ref name=Rossi/>
|-
|83. [[Rlm1p gene transcriptions|Rlm1ps]] || CTATATATAG || ? || N || CTA(T/A)<sub>4</sub>TAG
|-
|84. [[Rox1p gene transcriptions|Rox1ps]] || RRRTAACAAGAG || ? || N || Heme-dependent repressor of hypoxic genes.<ref name=Tang/>
|-
|85. [[Rpn4p gene transcriptions|Rpn4ps]] || GGTGGCAAA || ? || N || proteasome genes
|-
|86. [[Seed-specific element gene transcriptions|Seed-specific elements]] || CATGCATG || ? || N || SRE consensus: CAGCAGATTGCG is none
|-
|87. [[Shoot specific element gene transcriptions|Shoot specific elements]] || GATAATGATG || ? || N || SRE consensus: CAGCAGATTGCG is none
|-
|88. [[Sip4p gene transcriptions|Sip4ps]] || CC(C/G)T(C/T)C(C/G)TCCG || ? || N || CC(C/G)T(C/T)C(C/G)TCCG<ref name=Tang/>
|-
|89. [[Smp1p gene transcriptions|Smp1ps]] || ACTACTA(A/T)(A/T)(A/T)(A/T)TAG || ? || N || ACTACTA(T/A)<sub>4</sub>TAG<ref name=Tang/>
|-
|90. [[Specificity protein gene transcriptions|SP1]]
 
(Long)
|| GGGGCGGGCC || ? || N || GGGGCGGGCC<ref name=Long/>
|-
|91. [[Sterol response element gene transcriptions|Sterol response elements]]
 
(Branco)
|| TCGTATA || ? || N || perhaps plant specific
|-
|92. [[Sterol response element gene transcriptions|Sterol response elements]]
 
(Yao)
|| AGCAGATTGCG || ? || N || liver specific
|-
|93. [[TATC box gene transcriptions|TATCCAC boxes]] || TATCCAC || ? || N || GA responsive complex component
|-
|94. [[TCCACCATA element gene transcriptions|TCCACCATA elements]] || TCCACCATA || ? || N || adjacent co-dependent regulatory element of POLLEN1
|-
|95. [[Tetradecanoylphorbol-13-acetate response element gene transcriptions|Tetradecanoylphorbol-13-acetate response elements]]
 
(TREs)
|| TGA(G/C)TCA || ? || N || ''cis''-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
|-
|96. [[TC element gene transcriptions|TGF-β control elements]]
 
(TCEs)
|| GAGTGGGGCG || ? || N || in mouse and rat, GCGTGGGGGA in humans
|-
|97. [[TC element gene transcriptions|TGF-β inhibitory elements]]
 
(TIEs)
|| GAGTGGTGA || ? || N || in the rat transin/stromelysin promoter
|-
|98. [[Vhr1p gene transcriptions|Vhr1ps]]
 
(VHR1)
|| AATCA-N<sub>8</sub>-TGA(C/T)T || ? || N || Response to low biotin concentrations
|-
|99. [[Vitamin D response element gene transcriptions|Vitamin D response elements]]
 
(VDREs)
|| A/GGG/TTCAnnnA/GGG/TTCA || ? || N || (A/G)G(G/T)TCANNN(A/G)G(G/T)TCA
|-
|100. [[X box gene transcriptions|X boxes]] || GTTGGCATGGCAAC<ref name=Zhang>{{ cite journal
|author=XIAN-YANG ZHANG, NABILA JABRANE-FERRAT, CLEMENT K. ASIEDU, SANJA SAMAC, B. MATIJA PETERLIN, AND MELANIE EHRLICH
|title=The Major Histocompatibility Complex Class II Promoter-Binding Protein RFX (NF-X) Is a Methylated DNA-Binding Protein
|journal=MOLECULAR AND CELLULAR BIOLOGY
|date=November 1993
|volume=13
|issue=11
|pages=6810-8
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC364743/pdf/molcellb00023-0210.pdf
|arxiv=
|bibcode=
|doi=
|pmid=
|accessdate=2017-04-05 }}</ref> || ? || N || X2 box is AGGTCCA not ⌘F
|-
|101. [[X box gene transcriptions|X-boxes]] || GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC<ref name=Moreno>{{ cite journal
|author=Eduardo Moreno, Maša Lenuzzi, Christian Rödelsperger, Neel Prabh, Hanh Witte, Waltraud Roeseler, Metta Riebesell, Ralf J. Sommer
|title=DAF‐19/RFX controls ciliogenesis and influences oxygen‐induced social behaviors in ''Pristionchus pacificus''
|journal=Evolution & Development
|date=November 2018
|volume=20
|issue=6
|pages=233-243
|url=https://onlinelibrary.wiley.com/doi/abs/10.1111/ede.12271
|arxiv=
|bibcode=
|doi=10.1111/ede.12271
|pmid=
|accessdate=9 March 2021 }}</ref> || ? || N || includes GTTNCCATGGNAAC
|-
|102. [[Xbp1p gene transcriptions|Xbp1ps]] || GcCTCGA(G/A)G(C/A)g(a/g) || ? || N || Transcriptional repressor
|-
|103. [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]]
 
(XREs)
|| (T/G)NGCGTG(A/C)(G/C)A || ? || N || contains the core sequence GCGTG, see AHRE above
|-
|104. [[Y box gene transcriptions|Y boxes]] || (A/G)CTAACC(A/G)(A/G)(C/T) || ? || N || inverted CAAT box
|-
|105. [[Zap1p gene transcriptions|Zap1ps]] || ACCCTCA || ? || N || ACC(C/T)(C/T)(A/C/G/T)AAGGT
|-
|106. [[Z box gene transcriptions|Z-box (ZboxN) samplings]]
 
(ZboxNs)
|| ATACGGT || ? || N || No ZboxN occur on either side of A1BG
|-
|107. [[Z box gene transcriptions|Z-box (ZboxSo) samplings]]
 
(ZboxNs)
|| ATACGTGT || ? || N || No ZboxSo occur on either side of A1BG
|-
|108. [[Zinc responsive element gene transcriptions|Zinc responsive elements]]
 
(ZREs)
|| MHHAACCBYNMRGGT || ? || N || (A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT
|-
|}
 
==Response element testing (Present)==
{{main|A1BG regulatory elements and regions}}
{| class="wikitable sortable"
|+ Response element
|-
! Name of elements !! Consensus sequences !! Response element class !! Testing !! Activity/Notes
|-
! Abbreviations !! Variations !! Pathways !! Present (Y) !! Random or likely active or activable
|-
! Authors !! !! !! Table (T) !!
|-
|1. [[A box gene transcriptions|A-boxes]]
 
(A-box)
 
(Nawkar 2017)
|| TACGTA || Basic leucine zipper (bZIP)
 
Light signaling and stress response pathways
|| Y
 
T
|| likely active or activable
|-
|2. [[ABA-response element gene transcriptions|Abscisic acid response elements]]
 
(ABREs)
 
(Watanabe 2017)
|| ACGTG(G/T)C|| WD40 repeat family
 
ABA-signaling pathway,<ref name=Cuming>{{ cite journal
|author=Andrew C. Cuming
|title=Evolution of ABA signaling pathways
|journal=Advances in Botanical Research
|date=5 December 2019
|volume=92
|issue=
|pages=281-313
|url=https://www.sciencedirect.com/science/article/abs/pii/S0065229619300655
|arxiv=
|bibcode=
|doi=10.1016/bs.abr.2019.06.003
|pmid=
|accessdate=15 May 2023 }}</ref> Ethylene signaling pathway
|| Y
 
T
|| likely active or activable
|-
|3. [[Abf1 regulatory factor gene transcriptions|Activated B-cell Factor-1s]]
 
(ABFs, Abfms)
 
(Rossi 2018)
|| CGTNNNNN(A/G)(C/T)GA(C/T) || General Regulatory Factors
 
B-cell receptor signal transduction pathway
|| Y
 
T
|| likely active or activable
|-
|4. [[A box gene transcriptions|boxes A]]
 
(AP-1 box A)
 
(Kokoroishi 2015)
|| TGACTCT || bZIP
 
PKC-dependent pathway
|| Y
 
T
|| likely active or activable
|-
|5. [[Phosphate starvation-response transcription factor gene transcriptions|Abscisic acid-responsive elements (Pho4s)]], [[G box gene transcriptions|G boxes]]
 
(G-box)
 
(Loake 1992)
|| CACGTG || bZIP, bHLH
 
Purine and histidine biosynthesis pathways, Phenylpropanoid pathway, Light signaling and stress response pathways
|| Y
 
T
|| likely active or activable
|-
|6. [[ACGT-containing element gene transcriptions|ACGT-containing elements]] || ACGT || bZIP
 
Purine and histidine biosynthesis pathways, Phenylpropanoid pathway
|| Y
 
T
|| cores and proximals are likely active or activable, but a few of the UTRs and distal promoters may be random
|-
|7. [[Activating protein gene transcriptions|Activating protein 2 alpha]]
 
(AP2a)
|| GCCNNNGGC || bHSH
 
Rapamycin (TOR) regulatory pathways
|| Y
 
T
|| likely active or activable, positive strand, positive direction AP2a within randoms
|-
|8. [[Activating protein gene transcriptions|Activating protein 2]]
 
(AP2)
 
(Cohen)
|| GCCTGGCC || bHSH
 
Rapamycin (TOR) regulatory pathways
|| Y
 
T
|| likely active or activable
|-
|9. [[Activating protein gene transcriptions|Activating protein 2]]
 
(Cohen)
|| TCCCCCGCCC || bHSH
 
Rapamycin (TOR) regulatory pathways
|| Y
 
T
|| likely active or activable
|-
|10. [[Activating protein gene transcriptions|Activating protein 2]]
 
(Murata)
|| (C/G)CCN(3)GG(C/G) || bHSH
 
Rapamycin (TOR) regulatory pathways
|| Y
 
T
|| likely active or activable
|-
|11. [[Activating protein gene transcriptions|Activating protein 2]]
 
(Murata)
|| (C/G)CCN(4)GG(C/G) || bHSH
 
Rapamycin (TOR) regulatory pathways
|| Y
 
T
|| likely active or activable
|-
|12. [[Activating protein gene transcriptions|Activating protein 2]]
 
(Yao)
|| TCTTCCC || bHSH
 
Rapamycin (TOR) regulatory pathways
|| Y
 
T
|| likely active or activable
|-
|13. [[Activating protein gene transcriptions|Activating protein 2]]
 
(Yao)
|| CTCCCA || bHSH
 
Rapamycin (TOR) regulatory pathways
|| Y
 
T
|| likely active or activable
|-
|14. [[Activating protein gene transcriptions|Activating proteins]]
 
(AP-2)
 
(Yao)
|| GGCCAA || bHSH
 
Rapamycin (TOR) regulatory pathways
|| Y
 
T
|| likely active or activable
|-
|15. [[Activating transcription factor gene transcriptions|Activating transcription factors]]
 
(Burton)
|| (A/C/G)TT(A/G/T)C(A/G)TCA || bZIP
 
Signal transduction pathways
|| Y
 
T
|| likely active or activable
|-
|16. [[Activating transcription factor gene transcriptions|Activating transcription factors]]
 
(Kilberg)
|| (A/G/T)TT(A/G/T)CATCA || bZIP
 
Signal transduction pathways
|| Y
 
T
|| likely active or activable
|-
|17. [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]]
 
(AUREs)
 
(Bakheet)
|| (A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) || stem-loop
 
ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein
kinase (MAP kinase) pathway
|| Y
 
T
|| likely active or activable
|-
|18. [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]]
 
(AREs)
 
(Chen and Shyu, Class I)
|| ATTTA || stem-loop
 
ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein
kinase (MAP kinase) pathway
|| Y
 
T
|| likely active or activable, UTRs at the lower end of the randoms
|-
|19. [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]]
 
(AREs)
 
(Chen and Shyu, Class II)
|| TTATTTA(A/T)(A/T) || stem-loop
 
ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein
kinase (MAP kinase) pathway
|| Y
 
T
|| likely active or activable
|-
|20. [[Adenylate–uridylate rich element gene transcriptions|Adenylate–uridylate rich elements]]
 
(AREs)
 
(Chen and Shyu, Class III)
|| ATTT || stem-loop
 
ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein
kinase (MAP kinase) pathway
|| Y
 
T
|| likely active or activable, low negative direction proximals overlap randoms
|-
|21. [[Adr1p gene transcriptions|Adr1ps]] || TTGG(A/G)G || {{chem|Cys|2|His|2}} zinc finger binding domain
 
ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein
kinase (MAP kinase) pathway
|| Y
 
T
|| likely active or activable
|-
|22. [[Aft1p gene transcriptions|Aft1s]] || (C/T)(A/G)CACCC(A/G) || bZIP? || Y
 
T
|| likely active or activable
|-
|23. [[AGC box gene transcriptions|AGC boxes]] || AGCCGCC || AP-2/EREBP-related factors || Y
 
T
|| likely active or activable
|-
|24. [[Xenobiotic responsive element gene transcriptions|AhR responsive element or Aryl hydrocarbon responsive element II]]
 
(AHRE-II)
|| CATGN<sub>6</sub>C(A/T)TG || bHLH || Y
 
T
|| likely active or activable
|-
|25. [[Xenobiotic response element gene transcriptions|AhR DNA-binding consensus sequence]]
 
(AhRY)
 
(Yao)
|| GCGTGNN(A/T)NNN(C/G) || bHLH || Y
 
T
|| likely active or activable for ZNF497
|-
|26. [[Androgen response element gene transcriptions|Androgen response element1s]]
 
(Kouhpayeh)
|| GGTACA of GGTACAnnnTGTTCT || Zinc finger DNA-binding domain || Y
 
T
|| likely active or activable
|-
|27. [[Androgen response element gene transcriptions|Androgen response element2s]]
 
(Kouhpayeh)
|| TGTTCT of GGTACAnnnTGTTCT || Zinc finger DNA-binding domain || Y
 
T
|| likely active or activable
|-
|28. [[Androgen response element gene transcriptions|Androgen response elements]]
 
(Wilson)
|| AGAACANNNTGTTCT || Zinc finger DNA-binding domain || Y
 
T
|| the two portions AGAACA and TGTTCT occurring separately are likely active or activable
|-
|29. [[AGCE gene transcriptions|Angiotensinogen core promoter elements]] || (A/C)T(C/T)GTG || bZIP? || Y
 
T
|| likely active or activable, positive direction distal low occurrences overlap randoms
|-
|30. [[Antioxidant-electrophile responsive element gene transcriptions|Antioxidant-electrophile responsive elements]]
 
(Lacher)
|| GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A || bHLH || Y
 
T
|| likely active or activable
|-
|31. [[ATA box gene transcriptions|ATA boxes]] || AATAAA || β-Scaffold factor? || Y
 
T
|| likely active or activable
|-
|32. [[Adenylate–uridylate rich element gene transcriptions|ATTTA elements]]
 
(Siegel)
|| (A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T) || β-Scaffold factor? || Y
 
T
|| likely active or activable
|-
|33. [[Auxin response factor gene transcriptions|Auxin response factors]]
 
(Stigliani)
|| (C/G/T)(A/C/T)(G/T)G(C/T)(C/T)(G/T)(C/G)(A/C/T)(A/G/T) || WD40 repeat family || Y
 
T
|| likely active or activable, positive direction proximals overlap high randoms, positive direction cores within randoms
|-
|34. [[Auxin response factor gene transcriptions|Auxin response factors]]
 
(Ulmasov)
|| TGTCTC || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|35. [[Auxin response factor gene transcriptions|Auxin response factors]]
 
(Boer)
|| TGTCGG || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|36. [[Auxin response factor gene transcriptions|Auxin response factors]]
 
(ARF5)
|| (C/G/T)N(G/T)GTC(G/T) || WD40 repeat family || Y
 
T
|| likely active or activable, negative direction proximals ≥ randoms
|-
|37. [[B box gene transcriptions|B-boxes]]
 
(Johnson)
|| TGGGCA || Zinc finger DNA-binding domains
 
PKC-dependent pathway
|| Y
 
T
|| likely active or activable, positive direction distals ≥ randoms
|-
|38. [[B box gene transcriptions|boxes B]]
 
(Sanchez)
|| TGTCTCA || Zinc finger DNA-binding domains || Y
 
T
|| likely active or activable
|-
|39. [[Factor II B recognition element gene transcriptions|B recognition elements]]
 
(BRE<sup>u</sup>)
|| (G/C)(G/C)(G/A)CGCC || HTH || Y
 
T
|| likely active or activable
|-
|40. [[Hypoxia response element gene transcriptions|CACA elements]] (Orlando 2019) || CACA || ? || Y
 
T
|| likely active or activable
|-
|40. [[CadC binding domain gene transcriptions|CadC binding domains]] || TTANNNNT || HTH || Y
 
T
|| likely active or activable, negative direction proximals within randoms
|-
|41. [[Calcineurin-responsive transcription factor gene transcriptions|Calcineurin-responsive transcription factors]] || TG(A/C)GCCNC || ?
 
calcineurin-dependent signaling pathways
|| Y
 
T
|| likely active or activable
|-
|42. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] || ChoRE1 ACCGG  || ? || Y
 
T
|| likely active or activable
|-
|43. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] || ChoRE2 CCCAT  || ? || Y
 
T
|| likely active or activable
|-
|44. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] || Carb E1 ATCTTG || bHLH? || Y
 
T
|| proximals likely active or activable
|-
|45. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] || Carb E2 CACGTG || bHLH || Y
 
T
|| likely active or activable
|-
|46. [[Carbohydrate response element gene transcriptions|Carbohydrate response elements]] || Carb E3 TCCGCC || bHLH? || Y
 
T
|| likely active or activable, low positive direction distals overlap high randoms
|-
|47. Carbon source-responsive elements [[Carbon source-responsive element gene transcriptions|TCCG elements]]
 
(TCCGs)
|| TCCG || bHLH?
 
gluconeogenic pathway
|| Y
 
T
|| likely active or activable
|-
|48. [[Carbon source-responsive element gene transcriptions|CATTCA elements]]
 
(CATTs)
|| CATTCA || bHLH?
 
gluconeogenic pathway
|| Y
 
T
|| likely active or activable
|-
|49. [[CARE gene transcriptions|CARE (Fan)]]
 
(CAREs)
 
(Fan)
|| CAACTC || WD-40 repeat family || Y
 
T
|| likely active or activable
|-
|50. [[CARE gene transcriptions|CARE (Garaeva)]]
 
(CAREs)
 
(Garaeva)
|| (A/G/T)TT(A/G/T)CATCA || WD-40 repeat family || Y
 
T
|| likely active or activable
|-
|51.  [[CRE box gene transcriptions|cAMP-responsive elements]]
 
(CREs), Aca1ps, Sko1ps
|| TGACGTCA || bZIP
 
cAMP-dependent pathway
|| Y
 
T
|| likely active or activable, same as [[Root specific element gene transcriptions|Root specific elements]]
|-
|52. [[CArG box gene transcriptions|CArG boxes]] || CCAAAAAT(G/A)G || bHLH || Y
 
T
|| likely active or activable
|-
|53. [[Cat8p gene transcriptions|Cat8ps]] || CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA || ? || Y
 
T
|| likely active or activable
|-
|54. [[CAT box gene transcriptions|CAT boxes]] || CATTCCT || bHLH || Y
 
T
|| likely active or activable
|-
|55. [[CAT box gene transcriptions|CAT-box-like elements]] || GCCATT || bHLH || Y
 
T
|| likely active or activable
|-
|56. [[C box gene transcriptions|C boxes]]
 
(Samarsky)
|| AGTAGT || bZIP || Y
 
T
|| likely active or activable
|-
|57. [[C box gene transcriptions|C-boxes]]
 
(Song)
|| GACGTC || bZIP || Y
 
T
|| likely active or activable
|-
|58. [[C box gene transcriptions|hybrid CG-boxes]]
 
(Song)
|| TGACGTGT || bZIP || Y
 
T
|| likely active or activable
|-
|59. [[C box gene transcriptions|C boxes]]
 
(Voronina)
|| GGTGATG || bZIP || Y
 
T
|| likely active or activable
|-
|60. [[CCCTC-binding factor gene transcriptions|CCCTC-binding factors]]
 
(CTCF)
 
(Lobanenkov 1990)
|| CCCTC || ? || Y
 
T
|| likely active or activable
|-
|60. [[Cell-cycle box gene transcriptions|Cell-cycle box variants]]
 
(CCBs)
|| CACGAAA, ACGAAA and C-CGAAA || ? || Y
 
T
|| likely active or activable
|-
|61. [[CGCG box gene transcriptions|CGCG boxes]] || (A/C/G)CGCG(C/G/T) || ?
 
signal transduction pathways
|| Y
 
T
|| likely active or activable probably for the respective zinc fingers
|-
|62. [[Circadian control element gene transcriptions|Circadian control elements]] || CAANNNNATC || ? || Y
 
T
|| likely active or activable but overlaps highest randoms
|-
|63. [[N box gene transcriptions|Class C DNA binding sites]] || CACGNG || bHLH || Y
 
T
|| likely active or activable
|-
|64. [[Cold-responsive element gene transcriptions|Cold-responsive elements]] || CCGAC || ? || Y
 
T
|| likely active or activable
|-
|65. [[Adenylate–uridylate rich element gene transcriptions|Constitutive decay elements]]
 
(CDEs)
 
(Siegel)
|| TTC(C/T)(A/G)(C/T)GAA || stem-loop || Y
 
T
|| likely active or activable possibly for ZNF497
|-
|66. [[Copper response element gene transcriptions|Copper response elements]]
 
(CuREs)
 
(Quinn)
|| TTTGC(T/G)C(A/G) || ? || Y
 
T
|| likely active or activable
|-
|67. [[Copper response element gene transcriptions|Copper response elements]]
 
(CuREs)
 
(Park)
|| TGTGCTCA || ? || Y
 
T
|| likely active or activable
|-
|68. [[Coupling element gene transcriptions|Coupling elements]]
 
(CE3s)
 
(Watanabe)
|| GCGTGTC || WD-40 repeat family || Y
 
T
|| likely active or activable
|-
|69. [[Coupling element gene transcriptions|Coupling elements]]
 
(CE3s)
 
(Ding)
|| CACGCG || WD-40 repeat family || Y
 
T
|| likely active or activable
|-
|70. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]
 
(ARR1s)
|| AGATT(C/T) || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|71. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]
 
(ARR10s)
|| (A/G)GATA(A/C)G || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|72. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]
 
(ARR12s)
|| (A/G)AGATA || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|73. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]
 
(ARRs)
 
(Ferreira)
|| (G/A)GGAT(T/C) || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|74. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]
 
(ARRs)
 
(Rashotte1)
|| GATCTT || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|75. [[Cytokinin response regulator gene transcriptions|Cytokinin response regulators]]
 
(ARRs)
 
(Rashotte2)
|| (G/A)GAT(T/C) || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|76. [[Cytoplasmic polyadenylation element gene transcriptions|Cytoplasmic polyadenylation elements]]
 
(CPEs)
|| TTTTTAT || ? || Y
 
T
|| likely active or activable
|-
|77. [[DAF-16 binding element gene transcriptions|DAF-16 binding elements]] || (A/G)(C/T)AAA(C/T)A || ? || Y
 
T
|| likely active or activable
|-
|78. [[D box gene transcriptions|D boxes]]
 
(Samarsky)
|| AGTCTG || ? || Y
 
T
|| likely active or activable
|-
|79. [[D box gene transcriptions|D boxes]]
 
(Voronina)
|| TCCTG || ? || Y
 
T
|| likely active or activable
|-
|80. [[D box gene transcriptions|D-boxes]]
 
(Motojima)
|| TGAGTGG || ? || Y
 
T
|| likely active or activable
|-
|115. [[D box gene transcriptions|Destruction boxes]]
 
(D box)
 
(Pfleger and Kirschner 2000)
|| CGN(C/T)TNAAN || ? || Y
 
T
|| likely active or activable
|-
|81. [[Xenobiotic response element gene transcriptions|Dioxin-responsive elements]]
 
(DREs)
|| TNGCGTG || bHLH? || Y
 
T
|| likely active or activable
|-
|82. [[Downstream TFIIB recognition element gene transcriptions|Downstream B recognition elements]] || (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) || ? || Y
 
T
|| likely active or activable, negatives > randoms, positives overlap or outside randoms
|-
|83. [[Downstream core element gene transcriptions|Downstream core elements]]
 
(DCESIs)
|| CTTC of CTTC...CTGT...AGC || ? || Y
 
T
|| likely active or activable, depending on overlaps
|-
|84. [[Downstream core element gene transcriptions|Downstream core elements]]
 
(DCESIIs)
|| CTGT of CTTC...CTGT...AGC || ? || Y
 
T
|| likely active or activable, depending on overlaps
|-
|85. [[Downstream core element gene transcriptions|Downstream core elements]]
 
(DCESIIIs)
|| AGC of CTTC...CTGT...AGC || ? || Y
 
T
|| likely active or activable, depending on overlaps
|-
|86. [[Downstream promoter element gene transcriptions|Downstream promoter elements]]
 
(DPEs)
 
(Juven-Gershon)
|| (A/G)G(A/T)(C/T)(A/C/G)T || ? || Y
 
T
|| most or all of the real DPE (Juven-Gershon)s are likely active or activable
|-
|87. [[Downstream promoter element gene transcriptions|Downstream promoter elements]]
 
(DPEs)
 
(Kadonaga)
|| (A/G)G(A/T)CGTG || ? || Y
 
T
|| likely active or activable
|-
|88. [[Downstream promoter element gene transcriptions|Downstream promoter elements]]
 
(DPEs)
 
(Matsumoto)
|| AGTCTC || ? || Y
 
T
|| likely active or activable
|-
|89. [[E2 box gene transcriptions|E2 boxes]] || (G/A)CAG(A/C/G/T)TG(A/C/G/T) || bHLH || Y
 
T
|| likely active or activable
|-
|90. [[EIN3 binding site gene transcriptions|EIN3 binding sites]] || A(C/T)G(A/T)A(C/T)CT || ?
 
Ethylene signaling pathway
|| Y
 
T
|| likely active or activable
|-
|91. [[Endoplasmic reticulum stress response element gene transcriptions|Endoplasmic reticulum stress response elements]] || CCAAT-N9-CCACG, part 1 see Hap motif no.114 below, ESRE2, CCACG || bZIP || Y
 
T
|| likely active or activable
|-
|92. [[Endosperm expression gene transcriptions|Endosperm expressions]] || TGTGTCA || ? || Y
 
T
|| likely active or activable
|-
|93. [[Enhancer box gene transcriptions|Enhancer boxes]] || CA(A/C/G/T)(A/C/G/T)TG || bHLH
 
metabolic pathways
|| Y
 
T
|| likely active or activable
|-
|94. [[Estrogen response element gene transcriptions|Estrogen response elements]]
 
(ERE1s)
 
(Driscoll)
|| GGTCA || {{chem|Cys|4}}
 
estrogen response element-dependent signaling pathway
|| Y
 
T
|| likely active or activable
|-
|95. [[Estrogen response element gene transcriptions|Estrogen response elements]]
 
(ERE2s)
 
(Driscoll)
|| TGACC || {{chem|Cys|4}}
 
estrogen response element-dependent signaling pathway
|| Y
 
T
|| likely active or activable
|-
|96. [[Ethylene responsive element gene transcriptions|Ethylene responsive elements]] || ATTTCAAA || WD40 repeat family
 
Ethylene signaling pathway
|| Y
 
T
|| likely active or activable
|-
|97. [[Forkhead box gene transcriptions|Forkhead boxes]] || (A/G)(C/T)AAA(C/T)A || HTH, Forkhead || Y
 
T
|| likely active or activable
|-
|98. [[GAAC element gene transcriptions|GAAC elements]] || GAACT || ? || Y
 
T
|| likely active or activable
|-
|99. [[Γ-interferon activated sequence gene transcriptions|Γ-interferon activated sequences]]
 
(GAS), see STAT5
|| TTNCNNNAA || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|100. [[GATA gene transcriptions|GATA boxes]] || GATA || Zinc finger DNA-binding domains, bHLH
 
STAT5 pathway
|| Y
 
T
|| likely active or activable
|-
|101. [[GATA gene transcriptions|GATA (GATAAG, GATAAH, GATTA) motifs]]
 
(Staschke)
|| GAT(A/T)A || Zinc finger DNA-binding domains, bHLH
 
Rapamycin (TOR) Regulatory Pathways
|| Y
 
T
|| likely active or activable
|-
|102. [[ABA-response element gene transcriptions|GATC repeats]]
 
(ABREN)
 
(Watanabe ''et al''. 2017)
|| GATC || ?
 
ABA-signaling pathway, Ethylene signaling pathway
|| Y
 
T
|| GATC UTRs, proximals and positive strand, negative direction distals greater than randoms, negative strand, negative direction distals, positive direction distals likely randoms. GATCs are likely active or activable
|-
|103. [[GC box gene transcriptions|GC boxes]]
 
(Briggs)
|| (G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) || ? || Y
 
T
|| likely active or activable
|-
|103. [[GC box gene transcriptions|GC boxes]]
 
(Ye)
|| GGGCGG || ? || Y
 
T
|| likely active or activable
|-
|104. [[AGC box gene transcriptions|GCC boxes]] || GCCGCC || ?
 
Ethylene signaling pathway
|| Y
 
T
|| likely active or activable
|-
|105. [[Gcn4p gene transcriptions|General control nonderepressible 4 protein binding site]]
 
(GCRE, GCN4)
|| TGA(C/G/T)T(A/C/G)(A/T) || bZIP
 
Rapamycin (TOR) Regulatory Pathways
|| Y
 
T
|| likely active or activable
|-
|106. [[GGC triplet gene transcriptions|GGCGGC triplet]] || GGCGGC || Zn(II)<sub>2</sub>Cys<sub>6</sub> || Y
 
T
|| likely active or activable
|-
|107. [[GGC triplet gene transcriptions|GGC triplets]] || GGC || Zn(II)<sub>2</sub>Cys<sub>6</sub> || Y
 
T
|| likely active or activable
|-
|108. [[GARE gene transcriptions|Gibberellic acid responsive elements]]
 
(GAREs)
|| TAACAAA || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|109. [[GARE gene transcriptions|Gibberellic acid responsive elements-like 1]]
 
(GAREL1s)
|| TAACA(A/G)A || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|110. [[Gibberellin responsive element gene transcriptions|Gibberellin responsive elements]]
 
(GREs)
 
(Sharma)
|| AAACAGA<ref name=Sharma>{{ cite journal
|author=Bhaskar Sharma
|author2=Joemar Taganna
|title=Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato
|journal=Scientific Reports
|date=12 June 2020
|volume=10
|issue=9581
|pages=
|url=https://www.nature.com/articles/s41598-020-66553-1
|arxiv=
|bibcode=
|doi=10.1038/s41598-020-66553-1
|pmid=32533036
|accessdate=27 August 2020 }}</ref> || WD40 repeat family
 
Gibberellin (GA) growth regulator pathway, GA-biosynthesis pathway
|| Y
 
T
|| likely active or activable
|-
|111. [[Gcr1p gene transcriptions|G-protein-coupled receptors]]
 
(GCR1s), CT boxes
|| CTTCC || ?
 
cAMP signal pathway, phosphatidylinositol signal pathway
|| Y
 
T
|| likely active or activable.
|-
|112. [[Glucocorticoid response element gene transcriptions|Glucocorticoid response elements]] || AGAACA || bHLH
 
gluconeogenesis pathway
|| Y
 
T
|| likely active or activable
|-
|113. [[TC element gene transcriptions|GT boxes]]
 
(Sato)
|| GGGG(T/A)GGGG || ? || Y
 
T
|| likely active or activable
|-
|114. [[Hac1p gene transcriptions|Hac1]] ''KAR2'' || CAGCGTG || ?
 
unfolded protein response (UPR) pathway
|| Y
 
T
|| likely active or activable
|-
|115. [[H and ACA box gene transcriptions|H and ACA boxes]] || AGAGGA || Hairpin-hinge-hairpin-tail || Y
 
T
|| likely active or activable, negative distals likely random
|-
|116. [[CAAT box gene transcriptions|Hap motif]] and [[Endoplasmic reticulum stress response element gene transcriptions#CCAAT samplings|ESRE CCAAT]]
 
(Hap4p)
|| CCAAT || bZIP || Y
 
T
|| likely active or activable
|-
|117. [[H box gene transcriptions|H-boxes]]
 
(Grandbastien)
|| CC(A/T)ACCNNNNNNN(A/C)T || hairpin-hinge-hairpin-tail
 
phenylpropanoid pathway
|| Y
 
T
|| likely active or activable
|-
|118. [[H box gene transcriptions|H-boxes]]
 
(Lindsay)
|| CCTACC || hairpin-hinge-hairpin-tail || Y
 
T
|| likely active or activable, equal to or greater than the randoms for the negative direction distals
|-
|119. [[H box gene transcriptions|H box]]
 
(Mitchell)
|| ANANNA || hairpin-hinge-hairpin-tail || Y
 
T
|| likely active or activable
|-
|120. [[H box gene transcriptions|H box]]
 
(Rozhdestvensky)
|| ACACCA || hairpin-hinge-hairpin-tail || Y
 
T
|| likely active or activable
|-
|121. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE3s)
 
(Eastmond)
|| nGAAn-(5-bp)-nGAAnnTTCn || HTH, HSFs || Y
 
T
|| likely active or activable
|-
|122. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSEs)
 
(Eastmond)
|| nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP1) || HTH, HSFs || Y
 
T
|| same result as HSE3, likely active or activable
|-
|123. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSEs)
 
(Eastmond)
|| nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP2) || HTH, HSFs || Y
 
T
|| same result as HSE3, likely active or activable
|-
|124. [[Hsf1p gene transcriptions|Heat shock elements]]
 
(HSE4s)
 
(Eastmond)
|| nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn || HTH, HSFs || Y
 
T
|| likely active or activable
|-
|125. [[Hsf1p gene transcriptions|Heat shock factors]]
 
(Hsfs)
 
(Tang)
|| NGAAN || HTH, HSFs || Y
 
T
|| likely active or activable
|-
|85. [[HMG box gene transcriptions|Helper site]]
 
(Atcha et al. 2007), (Cadigan and Waterman 2012)
|| (C/G)C(C/G)G(C/G) || ?
 
Wnt/beta-catenin signaling pathway
|| Y
 
T
|| likely active or activable
|-
|126. [[Hex sequence gene transcriptions|Hex sequences]] || TGACGTGGC || ? || Y
 
T
|| likely active or activable
|-
|127. [[HMG box gene transcriptions|High Mobility Group boxes]]
 
(HMG boxes)
|| (A/T)(A/T)CAAAG || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|128. [[HNF gene transcriptions|HNF6s]] || (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) || {{chem|Cys|4}}
 
GH/HNF-6 pathway, HNF6/HNF1β pathway, HNF6 pathway, KLF4/HNF-6 pathway
|| Y
 
T
|| likely active or activable, although the negative direction distals are at or less than randoms
|-
|129. [[Homeobox gene transcriptions|Homeoboxes]] || CAAG || HTH
 
lignin pathway, Wnt dorsalisation pathway, lefty-signaling pathway
|| Y
 
T
|| likely active or activable
|-
|130. [[Homeobox gene transcriptions|Homeodomains]] || TAAT || HTH || Y
 
T
|| likely active or activable, low occurrence UTRs and negative direction distals overlap high randoms
|-
|131. [[HY box gene transcriptions|HY boxes]] || TG(A/T)GGG || ? || Y
 
T
|| likely active or activable
|-
|132. [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]] || ACGTG || bHLH || Y
 
T
|| likely active or activable
|-
|133. [[Hypoxia response element gene transcriptions|Hypoxia response elements]] || CACGC || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|134. [[Hypoxia response element gene transcriptions|CACA elements]] || CACA || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|135. [[Initiator element gene transcriptions|Initiator elements]]
 
(Inrs)
|| YYRNWYY || ? || Y
 
T
|| likely active or activable
|-
|136. [[Initiator element gene transcriptions|Initiator elements]]
 
(Inrs)
|| BBCABW || ? || Y
 
T
|| likely active or activable
|-
|137. [[Initiator element gene transcriptions|Initiator-like elements]]
 
(Ins-Like)
|| TTCTCT || ? || Y
 
T
|| likely active or activable, where real Inr-like negative direction distals are within the range of the randoms
|-
|138. [[Initiator element gene transcriptions|Initiator-like elements]]
 
(TCT)
|| (C/T)CT(C/T)T(C/T)(C/T) || ? || Y
 
T
|| likely active or activable
|-
|139. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
 
(ICRE)
 
(Case, Lopes)
|| CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991) || bHLH || Y
 
T
|| likely active or activable
|-
|140. [[Inositol, choline-responsive element gene transcriptions|Inositol/choline-responsive elements]]
 
(ICREs)
 
(Schwank)
|| TYTTCACATGY contains the core sequence CANNTG || bHLH || Y
 
T
|| likely active or activable
|-
|141. [[Interferon regulatory factor gene transcriptions|Interferon regulatory factor]]
 
(IRF3)
|| GCTTTCC || HTH || Y
 
T
|| likely active or activable
|-
|142. [[Interferon regulatory factor gene transcriptions|IFN-stimulated response elements]]
 
(ISREs)
 
(Lu)
|| GAAANNGAAA || HTH || Y
 
T
|| likely active or activable
|-
|143. [[Interferon regulatory factor gene transcriptions|IRS consensus]]
 
(Fujii)
|| AANNGAAA || HTH || Y
 
T
|| likely active or activable
|-
|144. [[Interferon regulatory factor gene transcriptions|Tryptophan residues]]
 
(Lu)
|| GAAA || HTH || Y
 
T
|| likely active or activable, the tryptophan residues occur in the IRS, IFN, ICRE, Cell-cycle box variants, V-box, Pollen1, and β-Scaffold response elements
|-
|145. [[Jasmonic acid-responsive element gene transcriptions|Jasmonic acid-responsive elements]]
(JAREs)
|| TGACG || ? || Y
 
T
|| likely active or activable
|-
|146. [[Krüppel-like factor gene transcriptions|Krüppel-like factors]] || GGGNN(G/T)(G/T)(G/T) || ? || Y
 
T
|| likely active or activable
|-
|147. [[Leu3 gene transcriptions|Leu3 transcription factors]] || (C/G)C(G/T)NNNN(A/C)G(C/G) || Zn(II)<sub>2</sub>Cys<sub>6</sub> || Y
 
T
|| likely active or activable
|-
|148. [[M35 box gene transcriptions|-35 sequence]] || TTGACA || ? || Y
 
T
|| likely active or activable, the UTR does overlap the randoms at the random's upper end
|-
|149. [[Met31p box gene transcriptions|Met31ps]] || AAACTGTG<ref name=Blaiseau>{{ cite journal
|author=Pierre‐Louis Blaiseau and Dominique Thomas
|title=Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA
|journal=The EMBO Journal
|date=2 November 1998
|volume=17
|issue=
|pages=6327-6336
|url=https://www.embopress.org/doi/full/10.1093/emboj/17.21.6327
|arxiv=
|bibcode=
|doi=10.1093/emboj/17.21.6327
|pmid=
|accessdate=4 February 2021 }}</ref> || bZIP || Y
 
T
|| likely active or activable
|-
|150. [[Metal responsive element gene transcriptions|Metal responsive elements]]
 
(MRE)
|| TGC(A/G)C(A/C/G/T)C || ? || Y
 
T
|| likely active or activable
|-
|151. [[Middle sporulation element gene transcriptions|Middle sporulation element]]
 
(MSE)
 
(Branco)
|| ACACAAA || ? || Y
 
T
|| likely active or activable
|-
|152. [[Middle sporulation element gene transcriptions|Midsporulation element]]
 
(MSE)
 
(Ozsarac)
|| C(A/G)CAAA(A/T) || ? || Y
 
T
|| likely active or activable
|-
|153. [[Mig1p gene transcriptions|Multicopy inhibitor of the ''GAL1'' promoter]]
 
(''MIG1'')
|| (C/G)(C/T)GGGG || bZIP || Y
 
T
|| likely active or activable, UTRs may be random
|-
|154. [[Mig1p gene transcriptions|MITF E-box (CAYRTG)]]
 
(''MITF'')
|| CA(C/T)(A/G)TG || ? || Y
 
T
|| likely active or activable, negative distals overlap randoms at low end
|-
|155. [[Musashi binding element gene transcriptions|Musashi binding elements]]
 
(MBE1s)
|| (G/A)U<sub>1</sub>AGU || ? || Y
 
T
|| likely active or activable
|-
|156. [[Musashi binding element gene transcriptions|Musashi binding elements]]
 
(MBE2s)
|| (G/A)U<sub>2</sub>AGU || ? || Y
 
T
|| likely active or activable, negative direction distals may be random
|-
|157. [[Musashi binding element gene transcriptions|Musashi binding elements]]
 
(MBE3s)
|| (G/A)U<sub>3</sub>AGU || ? || Y
 
T
|| likely active or activable
|-
|158. [[MYB recognition element gene transcriptions|MYB ACGT-containing elements]]
 
(ACEs)
|| CACGT || ? || Y
 
T
|| likely active or activable, positive strand UTR is likely random, negative strand, positive direction distals are likely random
|-
|159. [[MYB recognition element gene transcriptions|Myeloblastosis recognition element]]
 
(MRE)
|| A(A/C)C(A/T)A(A/C)C || ? || Y
 
T
|| likely active or activable
|-
|160. [[Myocyte enhancer factor gene transcriptions|Myocyte enhancer factors]]
 
(MEFs)
|| (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|161. [[UTR promoter gene transcriptions|Nanos/Pumilio response elements]]
 
(PREs)
|| TGTAAAT || ? || Y
 
T
|| likely active or activable
|-
|162. [[N box gene transcriptions|N-boxes]]
 
(Lee)
|| CCGGAA || bHLH || Y
 
T
||likely active or activable
|-
|163. [[N box gene transcriptions|N-boxes]]
 
(Bai)
|| CACGAG || bHLH || Y
 
T
|| likely active or activable
|-
|164. [[N box gene transcriptions|N-boxes]]
 
(Gao)
|| CACGGC or CACGAC, CACG(A/G)C || bHLH || Y
 
T
|| likely active or activable
|-
|165. [[N box gene transcriptions|N-boxes]]
 
(Leal)
|| CACNAG || bHLH || Y
 
T
|| likely active or activable
|-
|166. [[Ndt80p gene transcriptions|Non-DiTyrosine 80 transcription factor DNA binding domain]]
 
(Ndt80)
|| (A/G/T)NC(A/G)CAAA(A/T) || ? || Y
 
T
|| likely active or activable
|-
|167. [[Nuclear factor of activated T cell gene transcriptions (NFAT)|Nuclear factor of activated T cells]]
 
(NFATs)
 
complement and inverse of the [[Pyrimidine box gene transcriptions|Pyrimidine boxes]]
|| GGAAAA || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable, negative direction distals likely random
|-
|168. [[Nuclear factor gene transcriptions|NF𝜿B (Sato)]]
 
(NF𝜿BSs)
|| GAATTC || ? || Y
 
T
|| likely active or activable
|-
|169. [[Nutrient-sensing response element gene transcriptions|Nutrient-sensing response element 1]]
 
(NSRE)
|| GTTTCATCA || ? || Y
 
T
|| likely active or activable
|-
|170. [[Oaf1p gene transcriptions|Oaf1 transcription factor]] || CGGN<sub>3</sub>TNAN<sub>9-12</sub>CCG || ? || Y
 
T
|| likely active or activable
|-
|171. [[ORE1 binding site gene transcriptions|ORESARA1]]
 
(ORE1)
 
(Matallana)
|| (A/C/G)(A/C)GT(A/G)N<sub>5,6</sub>(C/T)AC(A/G) || ? || Y
 
T
|| likely active or activable
|-
|172. [[ORE1 binding site gene transcriptions|ORESARA1]]
 
(ORE1)
 
(Olsen)
|| T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) || ? || Y
 
T
|| likely active or activable
|-
|173. [[P53 response element gene transcriptions|p53 response elements]] || (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|174. [[P53 response element gene transcriptions|p53 response elements]]
 
(Long1)
|| CAGGCCC || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|175. [[P53 response element gene transcriptions|p53 response elements]]
 
(Long2)
|| GGGCGTG || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|176. [[P box gene transcriptions|P-box (Mena)]] || (A/T)AAAG || ? || Y
 
T
|| likely active or activable, the positive direction proximals overlap the randoms
|-
|177. [[P box gene transcriptions|P-box]]
 
(Motojima)
|| TGAGTTCA || ? || Y
 
T
|| likely active or activable
|-
|178. [[P box gene transcriptions|P-box]]
 
(Yu)
|| GTAA(T/C) || ? || Y
 
T
|| likely active or activable with some overlapping the randoms
|-
|179. [[Peroxisome proliferator hormone response element gene transcriptions|Peroxisome proliferator-activated receptor alpha]] || CGACCCC || ? || Y
 
T
|| likely active or activable, positive direction distal overlaps upper end of randoms
|-
|180. [[Phosphate starvation-response transcription factor gene transcriptions|Phosphate starvation-response transcription factor]]
 
(Pho4)
 
(Tang 2020)
|| CAC(A/G)T(T/G) || bHLH
 
purine and histidine biosynthesis pathways
|| Y
 
T
|| likely active or activable, positive strands of the UTRs and negative direction distals are in the random range
|-
|181. [[Pollen1 element gene transcriptions|Pollen1 elements]] || AGAAA || ? || Y
 
T
|| likely active or activable
|-
|182. [[Polycomb response element gene transcriptions|Polycomb response elements]]
 
(PRE)
|| GCCAT || ? || Y
 
T
|| likely active or activable
|-
|183. [[Pribnow box gene transcriptions|Pribnow boxes]] || TATAAT || ? || Y
 
T
|| likely active or activable
|-
|184. [[Prolamin box gene transcriptions|Prolamin boxes]] || TG(A/T)AAAG || ? || Y
 
T
|| likely active or activable
|-
|185. [[Q element gene transcriptions|Q elements]]
 
See [[Retinoic acid response element gene transcriptions|Retinoic acid response element]]
|| AGGTCA || ? || Y
 
T
|| likely active or activable
|-
|186. [[Xenobiotic response element gene transcriptions|Quinone reductase response element]]
 
(QRDRE)
 
(Yao)
|| TCCCCT of TCCCCTTGCGTG || ? || Y
 
T
|| likely active or activable
|-
|187. [[Rap1 regulatory factor gene transcriptions|Rap1 reduced consensus]] || (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|188. [[Reb1 general regulatory factor gene transcriptions|Reb1 bound and exact occurrences]] || TTACCC(G/T) || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|189. [[Retinoic acid response element gene transcriptions|Retinoic acid response element]]
 
(RARE)
|| AG(A/G)TCA || ? || Y
 
T
|| likely active or activable, positive direction distals appear random
|-
|190. [[Rgt1p gene transcriptions|Glucose transporter gene repressor]]
 
(Rgt1)
|| CGG(A/G)(A/T)N(A/T)(A/T) || ? || Y
 
T
|| likely active or activable
|-
|191. [[ROR-response element gene transcriptions|classic RORE motif]]
(RORE)
|| A(A/T)NTAGGTCA || ? || Y
 
T
|| likely active or activable
|-
|192. [[ROR-response element gene transcriptions|variant RORE motif]] || C(T/A)(G/A)GGNCA || ? || Y
 
T
|| likely active or activable
|-
|193. [[MYB recognition element gene transcriptions|R response elements]]
 
(RRE)
|| CATCTG || ? || Y
 
T
|| likely active or activable
|-
|194. [[Serum response element gene transcriptions|Serum response elements]]
 
(SRE)
 
see [[CArG box gene transcriptions|CArG boxes]]
|| ACAGGATGT || bHLH-ZIP || Y
 
T
|| likely active or activable
|-
|195. [[Servenius sequence gene transcriptions|Servenius sequences]] || GGACCCT || ? || Y
 
T
|| likely active or activable
|-
|196. [[Specificity protein gene transcriptions|SP1]]
 
(Zhang)
|| (G/T)GGGCGG(G/A)(G/A)(C/T) || ?
|| Y
 
T
|| likely active or activable
|-
|197. [[Specificity protein gene transcriptions|SP1-box 1]]
 
(Motojima)
|| GGGGCT || ? || Y
 
T
|| likely active or activable
|-
|198. [[Specificity protein gene transcriptions|SP1-box 2]]
 
(Motojima)
|| CTGCCC || ? || Y
 
T
|| likely active or activable
|-
|199. [[Specificity protein gene transcriptions|SP-1]]
 
(Sato)
|| CCGCCCC || ? || Y
 
T
|| likely active or activable 
|-
|200. [[Specificity protein gene transcriptions|SP1]]
 
(Yao)
|| GCGGC || ? || Y
 
T
|| likely active or activable
|-
|201. [[STAT5 gene transcription laboratory|STAT5]] || TTCNNNGAA || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|202. [[Msn2,4p gene transcriptions|Stress-response elements]]
 
(STREs)
|| CCCCT || ? || Y
 
T
|| likely active or activable, positive cores overlap randoms
 
Positive strand, negative direction: CCCCT at 3059
|-
|203. [[Sucrose box gene transcriptions|Sucrose boxes]] || NNAATCA || ? || Y
 
T
|| likely active or activable
|-
|204. [[TACTAAC box gene transcriptions|TACTAAC boxes]] || TACTAA(C/T) || ? || Y
 
T
|| likely active or activable
|-
|205. [[TAGteam gene transcriptions|TAGteams]] || CAGGTAG || ? || Y
 
T
|| likely active or activable
|-
|206. [[Tapetum box gene transcriptions|Tapetum boxes]] || TCGTGT || ? || Y
 
T
|| likely active or activable
|-
|207. [[TATA box gene transcriptions|metazoan TATA boxes]] || TATA(A/T)AA(A/G) || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|208. [[TATA box gene transcriptions|TATA boxes]] || TATA(A/T)A(A/T)(A/G) || β-Scaffold factors with minor groove contacts || Y
 
T
|| likely active or activable
|-
|209. [[TAT box gene transcriptions|TAT Boxes]]
 
(Yang)
|| TATAAAA || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|210. [[TAT box gene transcriptions|TAT Boxes]]
(Fan)
|| TATCCAT || WD40 repeat family || Y
 
T
|| likely active or activable
|-
|211. [[Tbf1 regulatory factor gene transcriptions|Tbf1 regulatory factors]] || A(A/G)CCCTAA || General Regulatory Factors || Y
 
T
|| ''Saccharomyces cerevisiae'', likely active or activable
|-
|212. [[T box gene transcriptions|T boxes]]
 
(Conlon)
|| TCACACCT || bZIP || Y
 
T
|| likely active or activable
|-
|213. [[T box gene transcriptions|T boxes]]
 
(Zhang)
|| AACGTT || bZIP || Y
 
T
|| likely active or activable
|-
|214. [[TEA consensus sequence gene transcriptions|TEA consensus sequences]] || CATTCY || ? || Y
 
T
|| likely active or activable
|-
|215. [[Tec1p gene transcriptions|Tec1ps]] || GAATGT || ? || Y
 
T
|| likely random, Ste12p cofactor
|-
|216. [[Telomeric repeat DNA-binding factor gene transcriptions|Telomeric repeat DNA-binding factors]]
 
(TRFs)
|| TTAGGG || ? || Y
 
T
|| likely active or activable
|-
|217. [[Thyroid hormone response element gene transcriptions|Thyroid hormone response elements]]
 
(TREs)(THRs)
|| AGGTCA || ? || Y
 
T
|| likely active or activable
|-
|218. [[Transcription factor 3 gene transcriptions|Transcription factor 3]]
 
(TCF3)
|| GTCTGGT || ? || Y
 
T
|| likely active or activable
|-
|219. [[Translational control sequence gene transcriptions|Translational control sequences]]
 
(TCSs)
|| (A/T)TT(A/G)TCT || ? || Y
 
T
|| likely active or activable
|-
|220. [[Hac1p gene transcriptions|Unfolded protein response element]]
 
(URE) (UPRE-1)
|| CANCNTG || ? || Y
 
T
|| likely active or activable
|-
|221. [[Unfolded protein response element gene transcriptions|Unfolded protein response elements]]
 
(UPREs)
|| TGACGTG(G/A) || bZIP || Y
 
T
|| likely active or activable
|-
|222. [[DNA damage response element gene transcriptions|Upstream repressor site 1]]
 
(URS1, core)
 
(Sumrada)
|| CCGCC || ? || Y
 
T
|| likely active or activable, negative direction proximals are within randoms
|-
|223. [[Upstream stimulatory factor gene transcriptions|Upstream stimulating factors]]
 
(USFs)
|| GCC(A/T)NN(C/G/T)(A/G) || bHLH-ZIP || Y
 
T
|| likely active or activable, cores overlap lower randoms
|-
|224. [[Adenylate–uridylate rich element gene transcriptions|UUA rich elements]]
 
(Chen)
|| TTATTTA(A/T)(A/T) || ? || Y
 
T
|| likely active or activable
|-
|225. [[V box gene transcriptions|V boxes]] || (A/G)TT(A/T)(C/T) || ? || Y
 
T
|| likely active or activable
|-
|226. [[Vitamin D response element gene transcriptions|Vitamin D response elements]]
 
(VDREs)
|| (A/G)G(G/T)(G/T)CA || ? || Y
 
T
|| likely active or activable
|-
|227. [[W box gene transcriptions|W boxes]] || (C/T)TGAC(C/T) || WRKY || Y
 
T
|| likely active or activable
|-
|228. [[X core promoter element gene transcriptions|X core promoter elements]] || (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) || ? || Y
 
T
|| likely active or activable
|-
|229. [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]]
 
(XREs)
|| GCGTG || bHLH


(TREs)
aryl hydrocarbon receptor pathways
|| TGA(G/C)TCA || N || ''cis''-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
|| Y
|-
|245. [[TC element gene transcriptions|TGF-β control elements]]


(TCEs)
T
|| GAGTGGGGCG || N || in mouse and rat, GCGTGGGGGA in humans
|| likely active or activable
|-
|-
|246. [[TC element gene transcriptions|TGF-β inhibitory elements]]  
|230. [[Yap1p,2p gene transcriptions|Yap recognition sequences]] || TTACTAA || ? || Y


(TIEs)
T
|| GAGTGGTGA || N || in the rat transin/stromelysin promoter
|| likely active or activable
|-
|-
|247. [[Thyroid hormone response element gene transcriptions|Thyroid hormone response elements]]  
|231. [[YY1 gene transcriptions|YY1 binding sites]] || CCATCTT || {{chem|Cys|2|His|2}} || Y


(TREs)(THRs)
T
|| AGGTCA || Y || See VDREs, X boxes, Positive strand, negative direction: AGGTCA at 4307
|| likely active or activable
|-
|-
|248. [[Transcription factor 3 gene transcriptions|Transcription factor 3]]  
|232. [[Z box gene transcriptions|Z boxes]]  


(TCF3)  
NSoSp form
|| GTCTGGT || Y || Negative strand, negative direction: GTCTGGT at 2122
|| A(C/T)A(C/G)G(G/T)(A/G/T)T || ? || Y  
|-
|249. [[Translational control sequence gene transcriptions|Translational control sequences]]


(TCSs)
T
|| AUUAUCU (Wee1 TCS1), AUUGUCU (Wee1 TCS2) and UUUGUCU (Mos and PCM-1 TCS) || Y || Negative strand, negative direction: TTTGTCT at 4518, ATTATCT at 4079, TTTGTCT at 2878.
|| likely active or activable, negative direction distals within randoms
|-
|-
|250. [[Hac1p gene transcriptions|Unfolded protein response element]]  
|233. [[Z box gene transcriptions|Z boxes]]  


(URE) (UPRE-1)  
ZboxG
|| CANCNTG || Y || Positive strand, negative direction: CAGCCTG at 4348, CATGGTG at 4109, CAGCCTG at 4036, CATCCTG at 3905, CACCCTG at 3743, CAGCCTG at 3297, CAAGGTG at 3143, CAGCCTG at 3127
|| A(C/T)A(C/G)GT(A/G)T || ? || Y  
|-
|251. [[Unfolded protein response element gene transcriptions|Unfolded protein response elements]]


(UPREs)
T
|| TGACGTG(G/A) || Y || XBP1 binds to UPRE, Negative strand, negative direction: TGACGTGA at 4340
|| likely active or activable
|-
|-
|252. [[Upstream stimulatory factor gene transcriptions|Upstream stimulating factors]]  
|234. [[Z box gene transcriptions|Z boxes]]  


(USFs)
ZboxSp
|| GCC(A/T)NN(C/G/T)(A/G) || Y || Negative strand, negative direction: CGGTCCAC at 3953
|| CAGGT(A/G) || ? || Y


Positive strand, negative direction: CAGATGGC at 3629
T
|| likely active or activable
|-
|-
|252. [[Adenylate–uridylate rich element gene transcriptions|UUA rich elements]]
|}
 
(Siegel)
|| TTATTTA(A/T)(A/T) || Y || Negative strand, negative direction: TTATTTATT at 4075
|-
|253. [[V box gene transcriptions|V boxes]] || (A/G)TT(A/T)(C/T) || Y || Negative strand, negative direction: ATAAT at 4538, AAAAT at 4512, GTTTC at 4504, GAAAC at 4462, GTTTT at 4376, GTTTT at 4310, ATTAT at 4223, GTTTT at 4216
 
Positive strand, negative direction: ATTTT at 4511, AAAAC at 4396, AAAAC at 4311, ATAAT at 4225, ATAAT at 4222, AAAAT at 4219
|-
|254. [[Vhr1p gene transcriptions|Vhr1ps]]
 
(VHR1)
|| AATCA-N<sub>8</sub>-TGA(C/T)T || N || Response to low biotin concentrations
|-
|255. [[Vitamin D response element gene transcriptions|Vitamin D response elements]]
 
(VDREs)
|| (A/G)G(G/T)(G/T)CA || Y || Negative strand, negative direction: TGAACC at 4268, TGAACT at 4012, TGACCC at 3750, TGAACT at 3242, TGAACT at 3103, TGAACC at 2921
|-
|256. [[Vitamin D response element gene transcriptions|Vitamin D response elements]]
 
(VDREs)
|| A/GGG/TTCAnnnA/GGG/TTCA || N || (A/G)G(G/T)TCANNN(A/G)G(G/T)TCA
|-
|257. [[W box gene transcriptions|W boxes]] || (C/T)TGAC(C/T) || Y || Negative strand, negative direction: GGTCAA at 4416, GGTCAA at 4308, CTGACC at 3749
|-
|258. [[X box gene transcriptions|X boxes]] || GTTGGCATGGCAAC<ref name=Zhang/> || N || X2 box is AGGTCCA not ⌘F
|-
|259. [[X box gene transcriptions|X-boxes]] || GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC<ref name=Moreno>{{ cite journal
|author=Eduardo Moreno, Maša Lenuzzi, Christian Rödelsperger, Neel Prabh, Hanh Witte, Waltraud Roeseler, Metta Riebesell, Ralf J. Sommer
|title=DAF‐19/RFX controls ciliogenesis and influences oxygen‐induced social behaviors in ''Pristionchus pacificus''
|journal=Evolution & Development
|date=November 2018
|volume=20
|issue=6
|pages=233-243
|url=https://onlinelibrary.wiley.com/doi/abs/10.1111/ede.12271
|arxiv=
|bibcode=
|doi=10.1111/ede.12271
|pmid=
|accessdate=9 March 2021 }}</ref> || N || includes GTTNCCATGGNAAC
|-
|260. [[Xbp1p gene transcriptions|Xbp1ps]] || GcCTCGA(G/A)G(C/A)g(a/g) || N || Transcriptional repressor
|-
|261. [[X core promoter element gene transcriptions|X core promoter elements]] || (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) || Y || Negative strand, negative direction: TGGTGGGACC at 3744
|-
|262. [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]]


(XREs)
==Totals==
|| GCGTG || Y || Positive strand, negative direction: CACGC at 3280, GCGTG at 3046
|-
|263. [[Xenobiotic response element gene transcriptions|Xenobiotic response elements]]


(XREs)  
Of 376 response elements, there are 121 Ns for not present (absent) in either A1BG promoter and 255 Ys for (present) or transcription factors that occur in the promoters on either side A1BG. There are 255 likely active or activable (67.82 %). With 4560 nts considered between ZSCAN22 and A1BG, halfway would be at 2280. Less than 2280 suggests the nearest other gene. In the positive direction, 4445 nts considered between ZNF497 and A1BG, halfway would be 2222 for another nearest gene. Less than 2222 suggests the nearest other gene.
|| (T/G)NGCGTG(A/C)(G/C)A || N || contains the core sequence GCGTG, see AHRE above
|-
|264. [[Yap1p,2p gene transcriptions|Yap recognition sequences]] || TTACTAA || Y || Yap1, Yap2, Yap3, and Yap5
|-
|265. [[Y box gene transcriptions|Y boxes]] || (A/G)CTAACC(A/G)(A/G)(C/T) || N || inverted CAAT box
|-
|266. [[YY1 gene transcriptions|YY1 binding sites]] || CCATCTT || Y || Negative strand, negative direction: CCATCTT at 1654
|-
|267. [[Zap1p gene transcriptions|Zap1ps]] || ACCCTCA || N || ACC(C/T)(C/T)(A/C/G/T)AAGGT
|-
|268. [[Z box gene transcriptions|Z boxes]] || A(C/T)A(C/G)GT(A/G)T || Y || Positive strand, negative direction: ACACCTGT at 3970, ATACCTAT at 2996
|-
|269. [[Zinc responsive element gene transcriptions|Zinc responsive elements]]


(ZREs)
==Number of non-degenerate nucleotides per response element==
|| MHHAACCBYNMRGGT || N || (A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT
see [[Non-degenerate nucleotides per response element]]
|-
|}


==Acknowledgements==
==Acknowledgements==
Line 1,930: Line 3,795:


<!-- footer categories -->
<!-- footer categories -->
[[Category:Resources last modified in April 2021]]

Latest revision as of 18:03, 3 March 2024

Associate Editor(s)-in-Chief: Henry A. Hoff

Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"[1] are called response elements.

Hypotheses

Main article: Hypotheses
  1. A1BG has no response elements in either promoter.
  2. A1BG is not transcribed by a response element.
  3. Each response element does not participate in the transcription of A1BG.

Response element testing

Response element
Name of elements, Abbreviations, Authors Consensus sequences, Variations Testing Order Resource nucleotides for one occurrence or likelihood found
1. ABA-response element-like, (ABRE-like) ACGTGTCC Absent 27 ABA-response elements 13:07, 8 October 2020 48
2. ABA-response elements, novel, (ABREN, novel ABRE) GATCGATC, CGATCGAT, GATCGAT Absent 28 ABA-response elements 13:07, 8 October 2020 47-48
3. ABA responsive elements (ABREs) ACGTG(G/T)C Present 29 ABA-response elements 05:53, 9 October 2020 likely active or activable
4. Abf1 regulatory factors CGTNNNNNACGAT Absent 31 Abf1 regulatory factors 18:32, 10 October 2020 413
5. A-boxes TACGTA Present 26 A-boxes 21:24, 7 October 2020 likely active or activable
6. Abscisic acid-responsive elements (Pho4s), G boxes CACGTG Present 126 Abscisic acid-responsive elements (Pho4s), G boxes 06:38, 10 May 2022 likely active or activable
7. ACGT-containing elements ACGT Present 182 ACGT-containing elements 03:02, 25 September 2022 cores, proximals likely active or activable, few UTRs, distals may be random
8. Activated B-cell Factor-1s (ABFs, Abfms) CGTNNNNN(A/G)(C/T)GA(C/T) Present 30 Abf1 regulatory factors 17:47, 10 October 2020 likely active or activable
9. Activating proteins (APs), (Murata) GCCCACGGG Absent 275 Activating proteins 05:32, 15 December 2022‎ 49
10. Activating protein 2 alpha (AP2a) GCCNNNGGC Present 184 Activating protein 2 alpha 00:57, 29 September 2022‎‎ likely active or activable, positive strand, positive direction within randoms
11. Activating protein 2 (AP2), (Cohen1) GCCTGGCC Present 187 Activating protein 2 06:54, 30 September 2022 likely active or activable
12. Activating protein 2, (Cohen2) TCCCCCGCCC Present 188 Activating protein 2 07:41, 30 September 2022‎‎ likely active or activable
13. Activating protein 2, (Murata) (C/G)CCN(3)GG(C/G) Present 183 Activating protein 2 23:47, 28 September 2022‎ likely active or activable
14. Activating protein 2, (Murata) (C/G)CCN(4)GG(C/G) Present 186 Activating protein 2 19:10, 29 September 2022‎ likely active or activable
15. Activating protein 2, (Yao1) TCTTCCC Present 189 Activating protein 2 08:11, 30 September 2022 likely active or activable
16. Activating protein 2, (Yao2) CTCCCA Present 190 Activating protein 2 19:00, 30 September 2022‎ likely active or activable
17. Activating protein 2, (AP-2), (Yao3) GGCCAA Present 191 Activating proteins 22:23, 30 September 2022‎‎ likely active or activable
18. Activating protein 2, (AP-2), (Roesler) CCCCACC(A/C) Present 353 AP-2 (Roesler) samplings 19:31, 21 April 2023‎ likely active or activable
19. Activating transcription factors, (ATF), (Burton) (A/C/G)TT(A/G/T)C(A/G)TCA Present 192 Activating transcription factors 01:48, 1 October 2022‎ likely active or activable
20. Activating transcription factors, (ATF), (Kilberg) (A/G/T)TT(A/G/T)CATCA Present 193 Activating transcription factors 02:21, 1 October 2022 likely active or activable
21. Adenylate–uridylate rich elements, (AUREs), (Bakheet) (A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) Present 116 Adenylate–uridylate rich elements 02:16, 3 October 2021 likely active or activable
22. Adenylate–uridylate rich elements, (AREs), (Chen and Shyu, Class I) ATTTA Present 273 Adenylate–uridylate rich elements 04:44, 15 December 2022 likely active or activable, UTRs at the lower end of the randoms
23. Adenylate–uridylate rich elements, (AREs), (Chen and Shyu, Class II) TTATTTA(A/T)(A/T) Present 272 Adenylate–uridylate rich elements 04:31, 15 December 2022‎ likely active or activable
24. Adenylate–uridylate rich elements, (AREs), (Chen and Shyu, Class III) ATTT Present 271 Adenylate–uridylate rich elements 04:06, 15 December 2022‎ likely active or activable, low negative direction proximals overlap randoms
25. Adr1ps, (ADR), (Tang 2020) TTGG(A/G)G Present 268 Adr1ps 01:36, 15 December 2022‎ likely active or activable
26. Aft1s, (AFT) (C/T)(A/G)CACCC(A/G) Present 194 Aft1s 15:48, 3 October 2022‎ likely active or activable
27. AGC boxes AGCCGCC (Leubner-Metzger 1998) Present 8 AGC boxes 14:40, 2 May 2014 likely active or activable
28. AhR DNA-binding consensus sequence, (AhRY), (Yao) GCGTGNN(A/T)NNN(C/G) Present 234 AhR DNA-binding consensus sequence 05:37, 5 November 2022‎ likely active or activable for ZNF497
29. AhR-responsive elements (AHRE) (Yao 1992) (G/T)NGCGTG(A/C)(C/G)A Absent 84 AhR/ARNT complex 20:45, 17 February 2021 23*46
30. Alpha-amylase conserved elements (Sharma 2020) TATCCATCCATCC Absent 36 Alpha-amylase conserved elements 22:18, 31 October 2020 413
31. Alpha-amylase conserved elements portion TATCCA Present 347 Alpha-amylase conserved elements portion 05:39, 11 April 2023 likely active or activable
32. Amino acid response elements, (AARE1), (Maruyama) ATTGCATCA Absent 110 Amino acid response elements 01:32, 22 May 2021 49
33. Amino acid response elements, (AARE), (Broer) TTTGCATCA[2][3] Absent 38 Amino acid response elements 01:59, 1 November 2020 49
34. Amino acid response element-like, (AARE-like), (AARE3), (Maruyama) TGGTGAAAG Absent 39 Amino acid response element-like 02:27, 2 November 2020‎ 49
35. Androgen response elements, (AREs), (Kouhpayeh) GGTACANNNTGTTCT Absent 40 Androgen response elements 17:01, 2 November 2020 412
36. Androgen response element1s, (Kouhpayeh) GGTACA of GGTACAnnnTGTTCT Present 196 Androgen response element1s 17:22, 4 October 2022 likely active or activable
37. Androgen response element2s, (Kouhpayeh) TGTTCT of GGTACAnnnTGTTCT Present 197 Androgen response element2s 17:01, 5 October 2022‎ likely active or activable
38. Androgen response elements, (AREs), (Wilson) AGAACANNNTGTTCT Absent 117 Androgen response elements 16:21, 11 November 2021 412
39. Androgen response elements, (Wilson) AGAACANNNTGTTCT Present 198 Androgen response elements 18:53, 5 October 2022 the two portions AGAACA and TGTTCT occurring separately are likely active or activable
40. Angiotensinogen core promoter elements (AGCE) (A/C)T(C/T)GTG Present 256 Angiotensinogen core promoter elements 20:01, 5 December 2022 likely active or activable, positive direction distal low occurrences overlap randoms
41. Antioxidant-electrophile responsive elements, (ARE), (Otsuki) GTGAGGTCGC[4] or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A[5] Absent 41 Antioxidant-electrophile responsive elements 06:06, 4 November 2020 (4/3)*2*45-410
42. Antioxidant-electrophile responsive elements, (Lacher) GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A Present 199 Antioxidant-electrophile responsive elements 23:22, 5 October 2022‎ likely active or activable
43. Aryl hydrocarbon responsive element II, (AHRE-II) CATGN6C(A/T)TG Present 257 AhR responsive element or Aryl hydrocarbon responsive element II 18:04, 6 December 2022‎ likely active or activable
44. ATA boxes AATAAA Present 267 ATA boxes 19:59, 14 December 2022‎ likely active or activable
45. ATTTA elements, (Siegel) (A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T) Present 270 ATTTA elements 04:04, 15 December 2022‎ likely active or activable
46. Auxin response factors, (ARF), (Stigliani) (C/G/T)(A/C/T)(G/T)G(C/T)(C/T)(G/T)(C/G)(A/C/T)(A/G/T) Present 235 Auxin response factors 05:55, 5 November 2022‎ likely active or activable, positive direction proximals overlap high randoms, positive direction cores within randoms
47. Auxin response factors, (ARF), (Ulmasov) TGTCTC Present 236 Auxin response factors 06:02, 5 November 2022‎ likely active or activable
48. Auxin response factors, (ARF), (Boer) TGTCGG Present 200 Auxin response factors 17:03, 7 October 2022‎ likely active or activable
49. Auxin response factors, (ARF5) (C/G/T)N(G/T)GTC(G/T) Present 201 Auxin response factors 04:15, 10 October 2022 likely active or activable, negative direction proximals ≥ randoms
50. B-boxes, (Johnson) TGGGCA Present 203 B-boxes 18:05, 10 October 2022 likely active or activable, positive direction distals ≥ randoms
51. boxes A TGACTCT Present 125 Box A 06:50, 9 May 2022‎ likely active or activable
52. boxes B, (Sanchez) TGTCTCA Present 202 boxes B 15:26, 10 October 2022 likely active or activable
53. B recognition elements, (BREu) (G/C)(G/C)(G/A)CGCC Present 255 B recognition elements 20:39, 4 December 2022 likely active or activable
54. CAACTC regulatory elements, (CAREs), (Fan) CAACTC Present 122 CARE (Fan) 17:45, 7 May 2022 likely active or activable
55. CAAT boxes (C/T)(A/G)(A/G)CCAATC(A/G) Absent 14 CAAT boxes 02:41, 22 March 2019 48, consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.
56. CACA elements (Orlando 2019) CACA Present 108 CACA elements 05:04, 7 May 2021 likely active or activable
57. CadC binding domains TTANNNNT Present 204 CadC binding domains 22:14, 12 October 2022 likely active or activable, negative direction proximals within randoms
58. Calcineurin-responsive transcription factors TG(A/C)GCCNC Present 265 Calcineurin-responsive transcription factors 19:14, 12 December 2022‎ likely active or activable
59. Calcium-response elements, (CaRE1s), (Tao 2002) CTATTTCGAG Absent 42 Calcium-response elements 19:43, 7 November 2020‎ 410
60. Carbohydrate response elements, (ChREs), (ChoRE1, ChoRE2), (Long 2020) CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG Absent 43 Carbohydrate response elements 20:50, 10 November 2020 417
61. Carbohydrate response elements, (ChoRE1), (Carb) ACCGG Present 143 Carbohydrate response elements 18:56, 18 June 2022 likely active or activable
62. Carbohydrate response elements, (ChoRE2), (Carb1) CCCAT Present 205 Carbohydrate response elements 06:01, 13 October 2022 likely active or activable
63. Carbohydrate response elements, (Carb E1) ATCTTG Present 206 Carbohydrate response elements 18:45, 13 October 2022‎ proximals likely active or activable
64. Carbohydrate response elements, (Carb E2) CACGTG Present 207 Carbohydrate response elements 21:30, 13 October 2022 likely active or activable
65. Carbohydrate response elements, (Carb E3) TCCGCC Present 208 Carbohydrate response elements 01:21, 14 October 2022‎ likely active or activable, low positive direction distals overlap high randoms
66. Carbon source-responsive elements, (CSREs) CATTCATCCG Absent 105 Carbon source-responsive elements 17:08, 19 March 2021 410, confers carbon source-dependent regulation
67. Carbon source-responsive elements, (TCCGs) TCCG Present 209 TCCG elements 02:41, 16 October 2022 likely active or activable
68. Carbon source-responsive elements, (CATTs) CATTCA Present 210 CATTCA elements 17:05, 18 October 2022 likely active or activable
69. CArG boxes, (Kamada 1992), (McDonald 2006) CC(A/T)6GG Absent 211 CArG boxes 19:08, 18 October 2022 26*44
70. CArG boxes, (Deng 2011) CCAAAAAT(G/A)G Absent 212 CArG boxes 19:08, 18 October 2022 2*49
71. CArG boxes, (suggested more general motif), (Deng 2011) C(C/A/T)(A/T)6(A/G)G from two different CArG-box motifs at 502 bp (CTAAATATGG) and 287 bp (CAATAATTGG) upstream Present 213 CArG boxes 19:08, 18 October 2022 likely active or activable, positive strand, negative direction: CATTAAAAGG at 3441 and CAAAAAAAAG at 1399
72. Cat8ps, (Tang 2020) CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA Present 214 Cat8ps 22:21, 18 October 2022 likely active or activable
73. CAT boxes, (Saitoh 1993) CATTCCT Present 215 CAT boxes 23:56, 18 October 2022‎ likely active or activable
74. CAT-box-like elements, (Berberich 1993) GCCATT Present 216 CAT-box-like elements 19:38, 20 October 2022‎ likely active or activable
75. Cbf1 regulatory factors TCACGTGA Absent 112 Cbf1 regulatory factors 15:57, 11 June 2021 48
76. C-boxes, (Johnson) GAGGCCATCT Absent 33 C-boxes 02:51, 22 October 2020 410
77. C boxes, (Samarsky) AGTAGT Present 217 C boxes 02:22, 21 October 2022 likely active or activable
78. C-boxes, (Song) GACGTC Present 218 C-boxes 06:22, 21 October 2022 likely active or activable
79. C/A hybrid boxes, (Song) TGACGTAT Absent 32 C/A hybrid boxes 16:18, 20 October 2020 48
80. C/G hybrid boxes, (Song) TGACGTGT Present 244 CG hybrid boxes 18:35, 15 November 2022 likely active or activable
81. C/T hybrid boxes, (Song) TGACGTTA Absent 34 C/T hybrid boxes 01:51, 24 October 2020 48
82. C boxes, (Voronina) GGTGATG Present 243 C boxes 18:28, 15 November 2022‎ likely active or activable
83. CCAAT-enhancer-binding site (C/EBP) activating transcription factor (ATF), or C/EBP-ATF responsive elements, (CAREs), (Garaeva) (A/G/T)TT(A/G/T)CATCA Present 123 CARE (Garaeva) 01:10, 8 May 2022 likely active or activable
84. CCAAT-enhancer-binding site (C/EBP), C/EBP boxes TTAGGACAT,[6] or TAGCATT.[7] Absent 44 C/EBP boxes 23:21, 18 November 2020 47-49
85. CCCTC-binding factors, (CTCF), (Hashimoto 2017) NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T) Absent 35 CCCTC-binding factors 23:02, 24 October 2020‎ 49
86. CCCTC-binding factors, (CTCF), (Lobanenkov 1990) CCCTC Present 370 CCCTC-binding factors 23:44, 12 May 2023 likely active or activable
87. C clamp, (HMG DBD), (Cadigan 2012) (C/G)CTTTGAT(C/G) Absent 367 C clamp 06:03, 10 May 2023‎ 48
88. Cell-cycle boxes, (CCBs) CACGAAAA Absent 107 Cell-cycle boxes 22:13, 19 April 2021 48, "cell cycle box" is functional in either orientation, acting as an enhancer
89. Cell-cycle box variants, (CCBs) CACGAAA, ACGAAA and C-CGAAA Present 219 Cell-cycle box variants 05:54, 23 October 2022 likely active or activable
90. Cell cycle regulation, (Sharma 2020) CCCAACGGT Absent 45 Cell cycle regulation 20:53, 25 November 2020‎ 49
91. CENP-B boxes TTTCGTTGGAAGCGGGA Absent 16 CENP-B boxes 13:25, 11 May 2019 417, specifically localized at the centromere
92. CGCG boxes, (Yang 2002) (A/C/G)CGCG(C/G/T) Present 264 CGCG boxes 07:14, 12 December 2022‎ likely active or activable, probably for zinc fingers
93. Circadian control elements CAANNNNATC Present 263 Circadian control elements 00:33, 12 December 2022 likely active or activable but overlaps highest randoms
94. Class C DNA binding sites, (Leal) CACGNG Present 164 Class C DNA binding sites 06:16, 5 August 2022 likely active or activable, distals may be random
95. Cold-responsive elements CCGAC Present 220 Cold-responsive elements 05:34, 24 October 2022 likely active or activable
96. Constitutive decay elements, (CDEs), (Siegel) TTC(C/T)(A/G)(C/T)GAA Present 269 Constitutive decay elements 03:50, 15 December 2022‎ likely active or activable possibly for ZNF497
97. Copper response elements, (CuREs), (Quinn) TTTGC(T/G)C(A/G) Present 221 Copper response elements 07:57, 24 October 2022 likely active or activable
98. Copper response elements, (CuREs), (Park) TGTGCTCA Present 222 Copper response elements 05:45, 25 October 2022 likely active or activable
99. Coupling elements, (CE1), (Watanabe) TGCCACCGG Absent 46 Coupling elements 01:51, 1 December 2020 49
100. Coupling elements, (CE3s), (Watanabe) GCGTGTC Present 118 Coupling elements 15:47, 12 February 2022‎ likely active or activable
101. Coupling elements, (CE3s), (Ding) CACGCG Present 119 Coupling elements 02:59, 15 February 2022 likely active or activable
102. cyclic-AMP-responsive elements, (CREs), Aca1ps, Sko1ps, (Montminy 1986) TGACGTCA Present 274 cAMP-responsive elements 05:05, 15 December 2022 likely active or activable, same as Root specific elements
103. Cytokinin response regulators, (ARR1s) AGATT(C/T) Present 227 Cytokinin response regulators 16:21, 31 October 2022 likely active or activable
104. Cytokinin response regulators, (ARR10s) (A/G)GATA(A/C)G Present 223 Cytokinin response regulators 17:47, 27 October 2022 likely active or activable or may be random
105. Cytokinin response regulators, (ARR12s) (A/G)AGATA Present 224 Cytokinin response regulators 06:09, 28 October 2022 likely active or activable
106. Cytokinin response regulators, (ARRs), (Ferreira) (G/A)GGAT(T/C) Present 225 Cytokinin response regulators 03:25, 31 October 2022 likely active or activable
107. Cytokinin response regulators, (ARRs), (Rashotte1) GATCTT Present 226 Cytokinin response regulators 16:21, 31 October 2022‎ likely active or activable
108. Cytokinin response regulators, (ARRs), (Rashotte2) (G/A)GAT(T/C) Present 228 Cytokinin response regulators 20:24, 1 November 2022 likely active or activable
109. Cytoplasmic polyadenylation elements, (CPEs) TTTTTAT Present 160 Cytoplasmic polyadenylation elements 06:10, 25 July 2022‎ likely active or activable
110. DAF-16-associated elements, (DAE), (Li) TGATAAG Absent 47 DAF-16-associated elements 22:51, 3 December 2020 47
111. DAF-16 binding elements (A/G)(C/T)AAA(C/T)A Present 229 DAF-16 binding elements 19:54, 2 November 2022 likely active or activable
112. D-boxes, (Mracek1) GTTGTATAAC Absent 49 D-boxes 02:46, 10 December 2020 410
113. D-boxes, (Mracek2) CTTATGTAAA Absent 50 D-boxes 02:20, 12 December 2020 410
114. D-boxes, (Johnson) TCTCACATT(A/C)AATAAGTCA Absent 48 D-boxes 04:12, 8 December 2020 2*418
115. D boxes, (Samarsky) AGTCTG Present 262 D boxes 00:16, 12 December 2022 likely active or activable
116. D boxes, (Voronina) TCCTG Present 230 D boxes 02:28, 4 November 2022 likely active or activable
117. D-boxes, (Motojima) TGAGTGG Present 261 D-boxes 00:11, 12 December 2022 likely active or activable
118. Defense and stress-responsive elements, (Sharma) ATTTTCTTCA Absent 51 Defense and stress-responsive elements 21:02, 13 December 2020 410
119. Destruction box, (D box), (Pfleger and Kirschner 2000) CGN(C/T)TNAAN Present 371 Destruction boxes 17:39, 15 May 2023 likely active or activable
120. Dioxin-responsive elements, (DREs) TNGCGTG Present 231 Dioxin-responsive elements 20:43, 4 November 2022 likely active or activable
121. DNA damage response elements, (DREs), (Smith) TTTCAAT Absent 52 DNA damage response elements 12:25, 17 December 2020 47
122. DNA damage response elements, (DREs), (Sumrada) TAGCCGCCG of TAGCCGCCGRRRR Absent 276 DNA damage response elements 06:31, 17 December 2022‎ 49-24*49
123. DNA replication-related elements, (DREs), (Hirose) TATCGATA Absent 53 DNA replication-related elements 02:56, 20 December 2020‎ 48
124. Downstream B recognition elements (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) Present 278 Downstream B recognition elements 22:45, 20 December 2022 likely active or activable, negatives > randoms, positives overlap or outside randoms
125. Downstream core elements, (DCESIs) CTTC of CTTC...CTGT...AGC Present 279 Downstream core elements 21:36, 22 December 2022 likely active or activable, depending on overlaps
126. Downstream core elements, (DCESIIs) CTGT of CTTC...CTGT...AGC Present 280 Downstream core elements 06:59, 26 December 2022 likely active or activable, depending on overlaps
127. Downstream core elements, (DCESIIIs) AGC of CTTC...CTGT...AGC Present 281 Downstream core elements 02:54, 28 December 2022 likely active or activable, depending on overlaps
128. Downstream promoter elements, (DPEs), (Juven-Gershon 2010) RGWYVT, (A/G)G(A/T)(C/T)(A/C/G)T Present 157 Downstream promoter elements 05:18, 17 July 2022 most or all of the real DPE (Juven-Gershon)s are likely active or activable
129. Downstream promoter elements, (DPEs), (Butler 2002) RGWYV or (A/G)G(A/T)(C/T)(A/C/G) Present 3 Initiator elements 21:32, 20 May 2012‎ likely active or activable
130. Downstream promoter elements, (DPEs) (Butler 2002) RGWYV or (A/G)G(A/T)(C/T)(A/C/G) Present 376 Downstream promoter elements 19:59, 15 June 2023‎ likely active or activable
131. Downstream promoter elements, (DPEs), (Kadonaga) (A/G)G(A/T)CGTG Present 155 Downstream promoter elements 20:16, 16 July 2022‎ likely active or activable
132. Downstream promoter elements, (DPEs), (Matsumoto) AGTCTC Present 156 Downstream promoter elements 21:32, 16 July 2022‎ likely active or activable
133. Downstream TFIIB recognition elements (BREd, dBRE) (Deng 2005) (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) Present 6 Downstream TFIIB recognition elements 21:32, 11 February 2013 likely active or activable
134. DREB boxes (CRT/DREB box) TACCGACAT Absent 21 DREB boxes 17:03, 28 December 2019 49
135. E2 boxes (A/G)CAGNTGN Present 195 E2 boxes 17:04, 3 October 2022‎ likely active or activable
136. EIF4E basal elements (poly(C) motif) TTACCCCCCCTT Absent 15 EIF4E basal elements 20:24, 30 March 2019 412
137. EIN3 binding sites A(C/T)G(A/T)A(C/T)CT Present 282 EIN3 binding sites 01:44, 29 December 2022 likely active or activable
138. Endoplasmic reticulum stress response elements, (ERSE) CCAAT-N9-CCACG Absent 284 Endoplasmic reticulum stress response elements 01:58, 31 December 2022 410
139. Endoplasmic reticulum stress response elements, (ESRE2) CCACG, for part 1 (CCAAT) see Hap motif Present 283 Endoplasmic reticulum stress response elements 01:57, 31 December 2022‎ likely active or activable
140. Endosperm expressions TGTGTCA Present 285 Endosperm expressions 03:16, 31 December 2022‎ likely active or activable
141. Enhancer boxes (E-box), (Massari 2000) CANNTG Present 7 Enhancer boxes 22:01, 17 April 2013 likely active or activable
142. Estrogen response elements, (EREs), (Matsumoto) AGGTTA or GGTCAGGAT of AGGTTATTGCCTCCT or GGTCAGGATGAC Absent 335 Estrogen response elements 05:34, 9 March 2023 46-412
143. Estrogen response elements, (EREs), (Yasar) GGTCAGGATGAC Absent 336 Estrogen response elements 05:37, 9 March 2023 412
144. Estrogen response elements, (ERE1s), (Driscoll) GGTCA Present 338 Estrogen response elements 03:27, 14 March 2023‎ likely active or activable
145. Estrogen response elements, (ERE2s), (Driscoll) TGACC Present 339 Estrogen response elements 03:37, 14 March 2023 likely active or activable
146. Ethylene responsive elements, (EtREs) ATTTCAAA Present 237 Ethylene responsive elements 18:06, 5 November 2022‎ likely active or activable
147. F boxes, (Rose) TGATAAG Absent 67 F boxes 05:52, 28 January 2021 47, F-box overlaps the I-box
148. Forkhead boxes, (FOXO1), (Yoshihara) GTAAACAA Absent 351 Forkhead boxes 04:33, 20 April 2023 48
149. Forkhead boxes, (FOXA2), (Li 2017) (A/G)(C/T)AAA(C/T)A Present 286 Forkhead boxes 03:54, 1 January 2023 likely active or activable
150. GAAC elements GAACT Present 287 GAAC elements 22:49, 1 January 2023 likely active or activable
151. Galactose-inducible transcription activator 4s, (Gal4s), (Tang) CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG Absent 54 Gal4ps 22:28, 31 December 2020‎ 410
152. γ-interferon activated sequences, (GAS) TTCCTAGAA Absent 352 γ-interferon activated sequences 18:24, 20 April 2023 49
153. Γ-interferon activated sequences, (GAS) TTNCNNNAA Present 288 Γ-interferon activated sequences 01:56, 3 January 2023, see STAT5 likely active or activable
154. GATA boxes GATA Present 258 GATA boxes 06:29, 8 December 2022 likely active or activable, may be random in proximals
155. GATA (GATAAG, GATAAH, GATTA) motifs, (Staschke) GAT(A/T)A Present 259 GATA (GATAAG, GATAAH, GATTA) motifs 20:11, 9 December 2022‎ likely active or activable
156. GATC repeats, (ABREN), (Watanabe et al. 2017) GATC Present 369 GATC samplings 20:08, 11 May 2023‎ GATC UTRs, proximals and positive strand, negative direction distals greater than randoms, negative strand, negative direction distals, positive direction distals likely randoms. GATCs are likely active or activable
157. G boxes, (Song) (G/T)CCACGTG(G/T)C Absent 115 G boxes 03:20, 25 July 2021‎ 49
158. G-box motif, (Oeda) GCCACGTGGC Absent 114 G boxes 04:25, 20 July 2021 410, no "perfect palindrome" G boxes in either promoter
159. GC boxes, (Briggs 1986), (Rroji 2021) (G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) Present 289 GC boxes 16:57, 3 January 2023 likely active or activable
160. GC boxes, (Ye 2019) GGGCGG Present 290 GC boxes 08:28, 4 January 2023‎ likely active or activable
161. GCC boxes, (Sato 1996) GCCGCC Present 291 GCC boxes 06:52, 5 January 2023 likely active or activable
162. GCN4 motifs, (Zhang 2014) TGA(C/G)TCA Absent 185 GCN4 motifs 05:52, 30 September 2022 47
163. General control nonderepressible 4 protein binding sites, (Staschke 2010), (GCRE, GCN4) TGA(C/G/T)T(A/C/G)(A/T) Present 292 General control nonderepressible 4 protein binding site 07:05, 5 January 2023‎ likely active or activable
164. Gcn4ps, (Tang) ATGACTCTT Absent 245 Gcn4ps 22:17, 15 November 2022 49
165. GGCGGC triplet GGCGGC Present 293 GGCGGC triplet 00:32, 7 January 2023 likely active or activable
166. GGC triplets GGC Present 295 GGC triplets 19:40, 7 January 2023 likely active or activable
167. Gibberellic acid responsive elements-like 1, (GAREL1s) TAACA(A/G)A Present 238 Gibberellic acid responsive elements-like 1 19:12, 5 November 2022 likely active or activable
168. Gibberellin responsive element-like 2, (GARE-like 2), (Fan) TAACGTA Absent 55 Gibberellin responsive element-like 2 06:39, 2 January 2021 47
169. Gibberellin responsive elements, (GREs), (Sharma) AAACAGA Present 296 Gibberellin responsive elements 01:19, 8 January 2023‎ likely active or activable
170. GLM boxes, (GCN4-like motif) (G/A)TGA(G/C)TCA(T/C) Absent 20 GLM boxes 04:17, 13 October 2019 23*46
171. Glucocorticoid response elements, (GlRE), (Parsonnet 2019) AGAACA Present 260 Glucocorticoid response elements 05:34, 10 December 2022 likely active or activable
172. Glucose transporter gene repressor, (Rgt1), (Kim 2019) CGG(A/G)(A/T)N(A/T)(A/T) Present 311 Glucose transporter gene repressor 20:06, 21 January 2023‎ likely active or activable
173. G-protein-coupled receptors,(GCR1s), CT boxes CTTCC Present 297 G-protein-coupled receptors 03:36, 8 January 2023 likely active or activable
174. Grainy head transcription factor binding sites AACCGGTT Absent 56 Grainy head transcription factor binding sites 23:33, 6 January 2021 48
175. Grainy head transcription factor binding sites GACTGGTT Absent 354 Grainy head transcription factor binding sites 07:13, 22 April 2023 48
176. GT boxes, (Motojima) TGGGTGGGGCT Absent 57 GT boxes 00:39, 11 January 2021 (-78 to -69) 411
177. GT boxes, (Sato) GGGG(T/A)GGGG Present 298 GT boxes 04:33, 8 January 2023 likely active or activable
178. Hac1, KAR2 CAGCGTG Present 299 Hac1 05:27, 8 January 2023‎ likely active or activable
179. H and ACA boxes AGAGGA Present 301 H and ACA boxes 04:33, 9 January 2023‎ likely active or activable, negative distals likely random
180. Hapless motifs (Ozsarac 1997) CCAATCA Absent 150 Hapless motifs 02:33, 30 June 2022‎ heterotrimeric transcription factor, HAP2/3/4 47
181. Hap motif (Hap4p) CCAAT Present 302 Hap motif 20:38, 9 January 2023 and ESRE CCAAT likely active or activable
182. H-boxes, (Grandbastien) CC(A/T)ACCNNNNNNN(A/C)T Present 121 H-boxes 16:34, 7 May 2022‎ likely active or activable
183. H-boxes, (Lindsay) CCTACC Present 124 H-boxes 14:39, 8 May 2022‎ likely active or activable, equal to or greater than the randoms for the negative direction distals
184. H box, (Mitchell) ANANNA Present 266 H box 20:03, 12 December 2022‎ likely active or activable
185. H box, (Rozhdestvensky) ACACCA Present 120 H box 05:46, 5 May 2022 likely active or activable
186. Heat-responsive elements AAAAAATTTC Absent 58 Heat-responsive elements 02:10, 14 January 2021 four nGAAn motifs 410
187. Heat shock elements, (HSE1), (Eastmond) nGAAnnTTCnnGAAn Absent 59 Heat shock elements 04:13, 20 January 2021 HSE1 49
188. Heat shock elements, (HSE2), (Eastmond) nTTCnnGAAnnTTCn Absent 127 Heat shock elements 16:30, 10 May 2022‎ HSE2 is the inverse complement of HSE1 49
189. Heat shock elements, (HSE3s), (Eastmond) nGAAn-(5-bp)-nGAAnnTTCn Present 130 Heat shock elements 17:47, 13 May 2022 likely active or activable
190. Heat shock elements, (HSEs), (Eastmond) nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP1) Present 132 Heat shock elements 16:28, 16 May 2022 same result as HSE3, likely active or activable
191. Heat shock elements, (HSEs), (Eastmond) nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP2) Present 133 Heat shock elements 06:36, 17 May 2022 same result as HSE3, likely active or activable
192. Heat shock elements, (HSE4s), (Eastmond) nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn Present 131 Heat shock elements 05:14, 14 May 2022‎ likely active or activable
193. Heat shock elements, (HSE5), (Eastmond) nTTCn-(5-bp)-nTTCnnGAAn Absent 60 Heat shock elements 02:49, 23 January 2021 HSE5 49
194. Heat shock elements, (HSE6), (Eastmond) nTTCn-nnGAAn-(5-bp)-nGAAn Absent 61 Heat shock elements 18:05, 23 January 2021 HSE6 49
195. Heat shock elements, (HSE7), (Eastmond) nGA(A/G)nnTTCnnGAAn Absent 62 Heat shock elements 22:36, 23 January 2021‎ HSE7 PFT1 2*48
196. Heat shock elements, (HSE), (Eastmond) nGAAnnTTCnnGA(A/G)n Absent 63 Heat shock elements 05:45, 24 January 2021 HSE7 PFT2 2*48
197. Heat shock elements, (HSE10), (Eastmond) nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn Absent 64 Heat shock elements 22:33, 26 January 2021 HSE10 49
198. Heat shock factors, (Hsfs), (Tang) NGAAN Present 128 Heat shock factors 06:01, 11 May 2022‎ likely active or activable
199. Helper site, (Atcha et al. 2007), (Cadigan and Waterman 2012) (C/G)C(C/G)G(C/G) Present 368 Helper site 10:54, 10 May 2023 likely active or activable
200. Hepatic nuclear factors (HNFs) (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) Present 135 HNF6s 17:53, 20 May 2022 likely active or activable, although the negative direction distals are at or less than randoms
201. Hex sequences TGACGTGGC Present 134 Hex sequences 19:57, 17 May 2022‎ likely active or activable
202. High Mobility Group boxes, (HMG boxes) (A/T)(A/T)CAAAG Present 358 High Mobility Group boxes 22:01, 30 April 2023‎ likely active or activable
203. Homeoboxes CAAG Present 253 Homeoboxes 04:28, 4 December 2022 likely active or activable, occurs in Rox1ps
204. Homeodomains TAAT Present 254 Homeodomains 19:46, 4 December 2022‎ likely active or activable, low occurrence UTRs and negative direction distals overlap high randoms, occurs in CArG boxes and Pribnow boxes
205. HY boxes TG(A/T)GGG Present 136 HY boxes 12:43, 25 May 2022‎ likely active or activable
206. Hypoxia-inducible factors, (HIF-1), (Li 2020) GCCCTACGTGCTGTCTCA Absent 65 Hypoxia-inducible factors 16:43, 27 January 2021 composed of HIF-1α and HIF-1β 418
207. Hypoxia-inducible factors (HIF) (Orlando 2019), ABA-response element (ABRE) (Asad 2019) ACGTG Present 37 Hypoxia-inducible factors 06:03, 7 May 2021, ABA-response element (ABRE) 03:06, 8 October 2020 likely active or activable
208. Hypoxia response elements (HRE) (Orlando 2019) CACGC Present 109 Hypoxia response elements 05:04, 7 May 2021 likely active or activable
209. I boxes GATAAG of GGATGAGATAAGA Absent 66 I boxes 05:49, 28 January 2021 413
210. Initiator element (Inr) (Liston 1999) YYA+1NWYY Present 2 Initiator elements 17:02, 17 April 2012 likely active or activable
211. Initiator element (Inr) (Juven-Gershon 2008) YYR+1NWYY Present 24 Initiator elements 17:44, 27 September 2020 likely active or activable
212. Initiator element (Inr) (Ngoc 2017) BBCA+1BW Present 13 Initiator elements 13:24, 22 December 2018 likely active or activable
213. Initiator element (Inr), Drosophila melanogaster (Butler 2002) TCA+1(G/T)T(C/T) Present 375 Initiator elements 06:40, 21 June 2023 likely active or activable, UTRs are likely random
214. Initiator element-like (Inr-like) (Matsumoto 2020) TTCTCT Present 25 Initiator-like element gene transcriptions 01:25, 29 September 2020 likely active or activable
215. Initiator element-like (TCT) (Parry 2010) (C/T)CT(C/T)T(C/T)(C/T) Present 346 TCT (Parry 2010) 22:06, 10 April 2023 likely active or activable
216. Inositol/choline-responsive elements, (ICRE), (Case) CANNTGAAAT Absent 68 Inositol/choline-responsive elements 21:43, 29 January 2021 version of Lopes, see below 48
217. Inositol/choline-responsive elements, (ICRE), (Case, Lopes) CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG Present 139 Inositol/choline-responsive elements 23:14, 9 June 2022‎ likely active or activable
218. Inositol/choline-responsive elements, (ICRE), (Lopes) ATGTGAAAT Absent 137 Inositol/choline-responsive elements 23:01, 7 June 2022 49, using ANNTGAAAT, likely active or activable
219. Inositol/choline-responsive elements, (ICREs), (Schwank) TYTTCACATGY contains the core sequence CANNTG Present 138 Inositol/choline-responsive elements 05:39, 9 June 2022 likely active or activable
220. Interferon regulatory factor, (IRF3) GCTTTCC Present 359 Interferon regulatory factor 03:07, 2 May 2023‎ likely active or activable
221. Interferon-stimulated response elements, (ISREs), (Michalska) AGTTTCN2TTTCN Absent 106 Interferon-stimulated response elements 15:43, 28 March 2021 410
222. Interferon-stimulated response elements, (ISREs), (Lu) GAAANNGAAA Present 140 IFN-stimulated response elements 06:41, 12 June 2022‎ likely active or activable
223. IRS consensus, (Fujii) AANNGAAA Present 141 IRS consensus 03:16, 14 June 2022‎ likely active or activable
224. Jasmonic acid-responsive elements, (JAREs) TGACG Present 144 Jasmonic acid-responsive elements 23:12, 20 June 2022‎ likely active or activable
225. K-boxes, (Saito 2020) GTTCGG-NNAN-CCNNAC Absent 104 K-boxes 22:22, 17 March 2021‎ 411
226. K-box1s, (Saito 2020) GTTCGG Present 366 K-boxes 20:59, 4 May 2023‎ likely active or activable
227. KEN box, (Pfleger and Kirschner 2000) AA(A/G)GA(A/G)AA(C/T) Present 372 KEN boxes 20:13, 15 May 2023‎ likely active or activable
228. Kozak sequences, (Kozak 1987) GCCGCC(A/G)CCATGG Absent 103 Kozak sequences 18:12, 17 March 2021 2*412
229. Kozak sequences, (Matsumoto) GAAAATGG Absent 69 Kozak sequences 01:16, 2 February 2021 48
230. Krüppel-like factors GGGNN(G/T)(G/T)(G/T) Present 145 Krüppel-like factors 18:25, 23 June 2022‎ likely active or activable
231. L boxes (Donald) AAATTAACCAA Absent 70 L boxes 04:21, 2 February 2021 411
232. Leu3 transcription factors, (Leu3), (Reddy 2020) (C/G)C(G/T)NNNN(A/C)G(C/G) Present 294 Leu3 transcription factors 04:52, 7 January 2023 likely active or activable
233. M3 motif (C/G)CGGAAG(C/T) or SCGGAAGY Present 373 M3 motif 05:47, 6 June 2023‎ likely active or activable
234. M22 TGCGCAN(G/T) or TGCGCANK Present 374 M22 samplings 00:52, 11 June 2023 likely active or activable
235. M35 or -35 sequence TTGACA Present 146 -35 sequence 16:16, 25 June 2022‎ likely active or activable, the UTR does overlap the randoms at the random's upper end
236. Maf recognition element, (MAREs), (Kyo) TGCTGA(G/C)TCAGCA Absent 71 Maf recognition element 03:29, 3 February 2021 2*412
237. M boxes, (Bertolotto) GTCATGTGCT or AGTCATGTGCT Absent 72 M boxes 16:05, 3 February 2021 410-411
238. M-CAT boxes, (Berberich 1993) GCGGCCTC Absent 349 M-CAT boxes 18:06, 18 April 2023 48
239. Mcm1 regulatory factors, (Rossi) TT(A/T)CCNN(A/T)TNGG(A/T)AA Absent 73 Mcm1 regulatory factors 03:17, 4 February 2021 23*49
240. Mcm1 regulatory factors, (Rossi) TTNCCNNNTNNGGNAA Absent 111 Mcm1 regulatory factors 04:32, 9 June 2021 49
241. Met3s, (Blaiseau) TCACGTG Absent 148 Met3s 08:09, 27 June 2022‎ 47
242. Met31ps, (Blaiseau) AAACTGTG Present 147 Met31ps 07:26, 27 June 2022‎ likely active or activable
243. Metal responsive elements, (MRE) TGC(A/G)C(A/C/G/T)C Present 149 Metal responsive elements 02:25, 30 June 2022‎ likely active or activable
244. Middle sporulation element, (MSE), (Branco) ACACAAA Present 151 Middle sporulation element 05:04, 2 July 2022‎ likely active or activable
245. Midsporulation element, (MSE), (Ozsarac) C(A/G)CAAA(A/T) Present 169 Midsporulation element 15:07, 14 August 2022 likely active or activable
246. MITF E-box, (MITF) CA(C/T)(A/G)TG, (CAYRTG) Present 360 MITF E-box (CAYRTG) 16:09, 2 May 2023‎ likely active or activable, negative distals overlap randoms at low end
247. Motif ten elements (MTE) (Lim 2004) C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G), CSARCSSAACGS Absent 5 Motif ten elements 15:28, 10 February 2013 25*47
248. Multicopy inhibitor of the GAL1 promoter, (MIG1), (Gancedo 1998) (C/G)(C/T)GGGG Present 361 Multicopy inhibitor of the GAL1 promoter 16:09, 2 May 2023 likely active or activable, UTRs may be random
249. Musashi binding elements, (MBE1s) (G/A)U1AGU Present 152 Musashi binding elements 15:31, 10 July 2022‎ likely active or activable
250. Musashi binding elements, (MBE2s) (G/A)U2AGU Present 153 Musashi binding elements 06:37, 14 July 2022‎ likely active or activable, negative direction distals may be random
251. Musashi binding elements, (MBE3s) (G/A)U3AGU Present 154 Musashi binding elements 19:37, 16 July 2022‎ likely active or activable
252. Myeloblastosis (MYB) ACGT-containing elements, (ACEs) CACGT Present 159 MYB ACGT-containing elements 17:07, 22 July 2022 likely active or activable, positive strand UTR is likely random, negative strand, positive direction distals are likely random
253. Myeloblastosis recognition element, (MRE) A(A/C)C(A/T)A(A/C)C Present 161 Myeloblastosis recognition element 15:36, 25 July 2022‎ likely active or activable
254. Myocyte enhancer factors, (MEFs) (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) Present 162 Myocyte enhancer factors 05:44, 28 July 2022 likely active or activable
255. Nanos/Pumilio response elements, (PREs) TGTAAAT Present 163 Nanos/Pumilio response elements 15:29, 31 July 2022‎ likely active or activable
256. N-boxes, (Lee) CCGGAA Present 168 N-boxes 05:07, 14 August 2022 likely active or activable
257. N-boxes, (Bai) CACGAG Present 167 N-boxes 17:10, 10 August 2022‎ likely active or activable
258. N-boxes, (Gao) CACGGC or CACGAC, CACG(A/G)C Present 166 N-boxes 05:54, 7 August 2022‎ likely active or activable
259. N-boxes, (Leal) CACNAG Present 165 N-boxes 06:16, 5 August 2022 likely active or activable
260. Non-DiTyrosine 80 transcription factor DNA binding domain, (Ndt80) (A/G/T)NC(A/G)CAAA(A/T) Present 170 Non-DiTyrosine 80 transcription factor DNA binding domain 20:36, 17 August 2022 likely active or activable
261. Nuclear factor of activated T cells, (NFATs) GGAAAA Present 171 Nuclear factor of activated T cells 22:08, 19 August 2022 likely active or activable, negative direction distals likely random, complement and inverse of the Pyrimidine boxes
262. NF‐κB/Rel family of eukaryotic transcription factors, (NF-κB) CCCCTAAGGGG Absent 74 NF‐κB/Rel family of eukaryotic transcription factors 02:53, 9 February 2021 411
263. NF𝜿B (Sato)(NF𝜿BSs) GAATTC Present 323 NF𝜿B (Sato) 07:30, 8 February 2023‎ likely active or activable
264. Nuclear factor 1, (NF-1) TTGGCNNNNNGCCAA Absent 75 Nuclear factor 1 03:51, 9 February 2021 palindromic sequence 410
265. Nuclear factor Ys CCAATGG(A/C)(A/G) Absent 76 Nuclear factor Ys 04:48, 9 February 2021 NF-Y is a trimeric complex 48
266. Nutrient-sensing response element 1, (NSRE) GTTTCATCA Present 172 Nutrient-sensing response element 1 04:29, 21 August 2022 likely active or activable
267. Oaf1 transcription factor CGGN3TNAN9-12CCG Present 173 Oaf1 transcription factor 05:57, 31 August 2022 likely active or activable
268. Oresara1, (ORE1), (Matallana) (A/C/G)(A/C)GT(A/G)N5,6(C/T)AC(A/G) Present 174 ORESARA1 05:42, 4 September 2022 likely active or activable
269. Oresara1, (ORE1), (Olsen) T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) Present 175 ORESARA1 23:53, 7 September 2022‎ likely active or activable
270. p53 response elements (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) Present 176 p53 response elements 18:30, 8 September 2022 likely active or activable
271. p53 response elements, (Long1) CAGGCCC Present 177 p53 response elements 03:26, 11 September 2022 likely active or activable
272. p53 response elements, (Long2) GGGCGTG Present 178 p53 response elements 20:10, 13 September 2022‎ likely active or activable
273. p63 DNA binding sites, (Perez 2007) (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T), RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY Absent 78 p63 DNA binding sites 04:14, 14 February 2021 412
274. P-box (Mena) (A/T)AAAG Present 180 P-box (Mena) 22:30, 21 September 2022‎ likely active or activable, the positive direction proximals overlap the randoms
275. P-box, (Motojima) TGAGTTCA Present 181 P-box 18:27, 24 September 2022‎ likely active or activable
276. P-box, (Yu) GTAA(T/C) Present 179 P-box 02:46, 18 September 2022‎ likely active or activable with some overlapping the randoms
277. Pleiotropic drug resistance 1p (Pdr1p), (Tang 2020) TCCGCGGA Absent 79 Pdr1p/Pdr3ps 04:07, 15 February 2021 Pdr1p/Pdr3p response elements (PDREs) 48
278. Pleiotropic drug resistance 1p (Pdr1p), (Salin 2008) TCCG(C/T)GG(A/G) Present 363 Pdr1p/Pdr3ps 03:11, 4 May 2023 likely active or activable
279. Peroxisome proliferator-activated receptor alpha CGACCCC Present 80 Peroxisome proliferator-activated receptor alpha 18:37, 15 February 2021 likely active or activable, positive direction distal overlaps upper end of randoms
280. Peroxisome proliferator hormone response elements, (PPREs) AGGTCANAGGTCA Absent 81 Peroxisome proliferator hormone response elements 18:37, 15 February 2021 PPARs/RXRs heterodimers bind to PPRE 412
281. Phosphate starvation-response transcription factor (Pho4) CAC(A/G)T(T/G) Present 129 Pho4ps 16:20, 12 May 2022 likely active or activable, positive strand of the UTRs is in the random range but the negative direction distals are outside the randoms
282. Pollen1 element with TCCACCATA AGAAANNNNTCCACCATA Absent 303 Pollen1 with TCCACCATA 23:24, 9 January 2023 adjacent co-dependent regulatory element TCCACCATA 49-414
283. Pollen1 elements AGAAA Present 304 Pollen1 elements 21:40, 10 January 2023 likely active or activable
284. Pollen1 element TCCACCATA Absent 305 TCCACCATA 08:30, 11 January 2023 no regulatory element TCCACCATA was found, nor its ci. 49
285. Polycomb response elements CGCCAT(A/T)TT Absent 82 Polycomb response elements 06:52, 16 February 2021 2*48-49
286. Polycomb response elements, (PRE) GCCAT Present 306 Polycomb response elements 22:28, 13 January 2023 likely active or activable
287. Pribnow boxes TATAAT Present 307 Pribnow boxes 03:43, 15 January 2023 likely active or activable
288. Prolamin boxes TG(A/T)AAAG, TGTAAAG Present 308 Prolamin boxes 06:14, 18 January 2023 likely active or activable
289. Q elements AGGTCA Present 309 Q elements 20:23, 18 January 2023‎ See Retinoic acid response element likely active or activable
290. Quinone reductase response element, (QRDRE), (Yao) TCCCCT of TCCCCTTGCGTG Present 232 Quinone reductase response element 05:08, 5 November 2022‎ likely active or activable
291. Rap1 regulatory factors ACCC(A/G)N(A/G)CA Absent 85 Rap1 regulatory factors 05:04, 20 February 2021 "(ACCCRnRCA), less than half of the sites were detectably bound"[8] 47
292. Rap1 reduced consensus (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) Present 240 Rap1 reduced consensus 03:47, 15 November 2022‎ likely active or activable
293. Reb1 extended, (Rossi) ATTACCCGAA Absent 113 Extended Reb1 00:07, 20 June 2021 410
294. Reb1 bound and exact occurrences TTACCC(G/T) Present 241 Reb1 bound and exact occurrences 16:38, 15 November 2022 likely active or activable
295. Retinoic acid response element AG(A/G)TCA Present 310 Retinoic acid response element 19:56, 19 January 2023 likely active or activable, positive direction distals appear random
296. Ribophorin (RPN) (Rpn4), PACE (proteasome associated control element) GGTGGCAAA Absent 88 Rpn4ps 03:15, 23 February 2021‎ 49
297. Rlm1ps CTA(A/T)(A/T)(A/T)(A/T)TAG Absent 86 Rlm1ps 05:55, 22 February 2021‎ 4TAG 24*46
298. RORE motif, (RORE) A(A/T)NTAGGTCA Present 312 classic RORE motif 05:51, 22 January 2023 likely active or activable
299. RORE motif, variant C(T/A)(G/A)GGNCA Present 313 variant RORE motif 03:04, 24 January 2023‎ likely active or activable
300. Rox1ps (Tang 2020) RRRTAACAAGAG Absent 87 Rox1ps Heme-dependent repressor of hypoxic genes 21:50, 22 February 2021 23*49
301. R response elements (RRE) CATCTG Present 158 R response elements 16:04, 19 July 2022‎ likely active or activable
302. Seed-specific elements (SRE) CATGCATG Absent 89 Seed-specific elements 20:18, 23 February 2021 48-412
303. Serum response elements, (SRE) ACAGGATGT Present 314 Serum response elements 16:38, 25 January 2023 likely active or activable
304. Servenius sequences GGACCCT Present 315 Servenius sequences 03:07, 28 January 2023‎ likely active or activable
305. Shoot specific elements, (SREs) GATAATGATG Absent 90 Shoot specific elements 15:13, 24 February 2021‎ 410
306. Shue box element, (Crowder 1988) CCCTG(C/G) Present 348 Shue box elements 05:24, 18 April 2023‎ likely active or activable
307. Sip4ps (Tang) CC(C/G)T(C/T)C(C/G)TCCG Absent 91 Sip4ps 02:55, 25 February 2021 23*48
308. Smp1ps (Tang) ACTACTA(T/A)4TAG Absent 92 Smp1ps 23:43, 25 February 2021 2*410
309. SP1, (Long) GGGGCGGGCC Absent 355 SP1 19:43, 25 April 2023 410
310. Sp1 element, (Berberich 1993) GGGGCGGGT Absent 350 Sp1 elements 21:03, 18 April 2023 49
311. SP1, (Zhang) (G/T)GGGCGG(G/A)(G/A)(C/T) Present 319 SP1 05:57, 2 February 2023‎ likely active or activable
312. SP-1, (Sato) CCGCCCC Present 318 SP-1 05:54, 2 February 2023‎ likely active or activable
313. SP1, (Yao) GCGGC Present 320 SP1 05:57, 4 February 2023 likely active or activable
314. SP1-box 1, (Motojima) GGGGCT Present 316 SP1-box 1 05:46, 29 January 2023‎ likely active or activable
315. SP1-box 2, (Motojima) CTGCCC Present 317 SP1-box 2 19:30, 30 January 2023‎ likely active or activable
316. STAT5 TTCNNNGAA Present 321 STAT5 03:41, 5 February 2023‎ likely active or activable, positive distal likely random
317. Sterile12, (STE12), (Tang 2020) TGAAAC Present 356 Sterile12 encodes a transcription factor (Ste12) 05:53, 27 April 2023‎‎ likely active or activable
318. Sterol response elements, (Branco) TCGTATA Absent 93 Sterol response elements 19:00, 28 February 2021‎ perhaps plant specific 47
319. Sterol response elements, (Yao) AGCAGATTGCG Absent 94 Sterol response elements 03:22, 1 March 2021 liver specific 411
320. Stress-response elements, (STREs) CCCCT Present 322 Stress-response elements 07:49, 7 February 2023‎ likely active or activable, positive cores overlap randoms
321. Sucrose boxes NNAATCA Present 324 Sucrose boxes 08:03, 10 February 2023‎ likely active or activable
322. TACTAAC boxes TACTAA(C/T) Present 325 TACTAAC boxes 06:05, 12 February 2023‎ likely active or activable
323. TAGteams CAGGTAG Present 326 TAGteams 04:15, 14 February 2023‎ likely active or activable
324. Tapetum boxes TCGTGT Present 327 Tapetum boxes 08:10, 16 February 2023‎ likely active or activable
325. TATA boxes TATAAAA (Carninci 2006) TAT box (Yang 2006) Present 1 Wikipedia:TATA box 02:36, 10 January 2011 likely active or activable
326. TATA boxes TATAAA (Butler 2002) Present 4 Downstream promoter elements 21:32, 20 May 2012 likely active or activable
327. TATA boxes (RGWYV(T)) (Burke 1996) TATA(A/T)A(A/T) (Watson 2014) Present 10 Wikipedia:TATA box 04:32, 4 December 2017‎ likely active or activable
328. TATA boxes (Yang 2007) TATA(A/T)AA(A/G) (Juven-Gershon 2010) Present 17 metazoan TATA box 01:05, 13 October 2019 likely active or activable
329. TATA boxes (Yang 2007) TATA(A/T)A(A/T)(A/G) (Basehoar 2004) Present 9 Wikipedia:TATA box 18:28, 21 November 2017 likely active or activable
330. TAT boxes (Fan 2007) TATCCAT Present 239 TAT box (Fan) samplings 06:17, 13 November 2022 likely active or activable
331. TATCCAC boxes TATCCAC Absent 18 TATCCAC boxes 03:59, 13 October 2019 GA responsive complex component 47
332. TATCCAC boxes (Yang 2007) TATCCAC Absent 19 TATC box gene transcriptions 03:59, 13 October 2019 47
333. Tbf1 regulatory factors A(A/G)CCCTAA Present 242 Tbf1 regulatory factors 17:38, 15 November 2022 Saccharomyces cerevisiae, likely active or activable
334. T boxes, (Conlon) TCACACCT Present 246 T boxes 23:28, 18 November 2022 likely active or activable
335. T boxes, (Zhang) AACGTT Present 247 T boxes 17:21, 20 November 2022‎ likely active or activable
336. TCCACCATA elements TCCACCATA Absent 77 TCCACCATA elements 05:10, 13 February 2021 adjacent co-dependent regulatory element of POLLEN1 49
337. TEA consensus sequences CATTCY Present 328 TEA consensus sequences 06:35, 24 February 2023‎ likely active or activable
338. Telomeric repeat DNA-binding factors, (TRFs) TTAGGG Present 330 Telomeric repeat DNA-binding factors 06:35, 2 March 2023 likely active or activable
339. Tetradecanoylphorbol-13-acetate response elements, (TREs) TGA(G/C)TCA Absent 23 Tetradecanoylphorbol-13-acetate response elements 15:07, 24 August 2020‎ cis-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40 2*46
340. TGF-β control elements, (TCEs) GCGTGGGGGA Absent 95 TGF-β control elements 17:38, 5 March 2021 GCGTGGGGGA in humans 410
341. TGF-β inhibitory elements, (TIEs) GAGTGGTGA Absent 22 TGF-β inhibitory elements 01:57, 23 August 2020 in the rat transin/stromelysin promoter 49
342. Thyroid hormone response elements, (TREs)(THRs) AGGTCA Present 331 Thyroid hormone response elements 23:06, 3 March 2023‎ likely active or activable
343. Transcription factor 3, (TCF3) GTCTGGT Present 332 Transcription factor 3 19:21, 5 March 2023‎ likely active or activable
344. Translational control sequences, (TCSs) (A/T)TT(A/G)TCT Present 333 Translational control sequences 20:33, 7 March 2023‎ likely active or activable
345. Transposon enhancement control (TEC) or Tec1 GAATGT Present 329 Tec1ps 22:49, 26 February 2023 likely random, Ste12p cofactor
346. Tryptophan residues, (Lu) GAAA Present 142 Tryptophan residues 03:55, 18 June 2022‎ likely active or activable, the tryptophan residues occur in the IRS, IFN, ICRE, Cell-cycle box variants, V-box, Pollen1, and β-Scaffold response elements
347. Unfolded protein response element, (URE), (UPRE-1) CANCNTG Present 300 Unfolded protein response element 18:24, 8 January 2023 likely active or activable
348. Unfolded protein response elements, (UPREs) TGACGTG(G/A) Present 334 Unfolded protein response elements 21:02, 7 March 2023 likely active or activable
349. Upstream repressor site 1, (URS1, core), (Sumrada) CCGCC Present 277 Upstream repressor site 1 06:31, 17 December 2022 likely active or activable
350. Upstream stimulating factors, (USFs) GCC(A/T)NN(C/G/T)(A/G) Present 337 Upstream stimulating factors 05:51, 11 March 2023‎ likely active or activable
351. V boxes (A/G)TT(A/T)(C/T) Present 340 V boxes 20:50, 16 March 2023‎ likely active or activable
352. Vhr1ps, (VHR1), (Weider 2016), (Tang 2020) AATCA-N8-TGA(C/T)T Absent 96 Vhr1ps 01:26, 9 March 2021 Response to low biotin concentrations 2*49
353. Vitamin D response elements, (VDRE2s) A/GGG/TTCAnnnA/GGG/TTCA Absent 97 Vitamin D response elements 03:48, 10 March 2021 410
354. Vitamin D response elements (VDRE) (Kakhki 2018) (A/G)G(G/T)TCA, RGKTCA Present 341 Vitamin D response elements 04:37, 19 March 2023 likely active or activable
355. W boxes (W-boxes) (WRKY) (C/T)TGAC(C/T) Present 342 W boxes 20:46, 20 March 2023 likely active or activable
356. X1a boxes (Ferstl 2004) TCTGCC Present 364 X-boxes 04:29, 4 May 2023‎ likely active or activable
357. X1b boxes (Ferstl 2004) AGAGACAGAT Absent 357 X-boxes 17:57, 30 April 2023‎ 410
358. X2 boxes (Ferstl 2004) AGGTCCA Present 362 X-boxes 01:41, 4 May 2023‎‎ likely active or activable
359. X boxes (Zhang 1993) GTTGGCATGGCAAC Absent 12 X boxes 02:35, 20 November 2018 X2 box is AGGTCCA 414
360. X-boxes (Moreno) GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC Absent 98 X-boxes 16:43, 10 March 2021‎ includes GTTNCCATGGNAAC (4/3)*24*47-412
361. X core promoter elements (XCPE1) (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) Present 343 X core promoter elements 19:37, 22 March 2023‎ likely active or activable
362. Xenobiotic response elements, (XREs) (T/G)NGCGTG(A/C)(G/C)A Absent 83 Xenobiotic response elements 20:45, 17 February 2021 contains the core sequence GCGTG, see AHRE above 2*47
363. Xenobiotic response elements (XREs) (Shen 1992) GCGTG Present 233 Xenobiotic response elements 05:22, 5 November 2022 likely active or activable
364. XhoI site-binding protein 1 protein (Xbp1p), (Mai 1997), (Tang 2020) GcCTCGA(G/A)G(C/A)g(a/g) Absent 99 Xbp1ps 14:40, 11 March 2021 Transcriptional repressor 2*410
365. Yap response elements (Salin 2008) T(G/T)ACT(A/C)A Present 365 Yap response elements 05:18, 4 May 2023 likely active or activable
366. Yap recognition sequences (Tang 2020) TTACTAA Present 344 Yap recognition sequences 19:57, 24 March 2023 likely active or activable
367. Y boxes, (Koike 1997) (A/G)CTAACC(A/G)(A/G)(C/T) Absent 11 Y boxes 01:31, 20 November 2018 inverted CAAT box, 48
368. YY1 binding sites CCATTTA Absent 100 YY1 binding sites 06:23, 12 March 2021 47
369. YY1 binding sites CCATCTT Present 345 YY1 binding sites 22:07, 25 March 2023 likely active or activable
370. Z-box (ZboxN) samplings, (ZboxNs) ATACGGT Absent 251 Z-box (ZboxN) samplings 19:47, 2 December 2022‎ 47
371. Z-box (ZboxSo) samplings, (ZboxNs) ATACGTGT Absent 252 Z-box (ZboxSo) samplings 20:21, 3 December 2022‎ 48
372. Z boxes, NSoSp form A(C/T)A(C/G)G(G/T)(A/G/T)T Present 249 Z boxes 17:23, 28 November 2022‎ likely active or activable, negative direction distals within randoms
373. Z boxes, ZboxG A(C/T)A(C/G)GT(A/G)T Present 250 Z boxes 03:00, 1 December 2022 likely active or activable
374. Z boxes, ZboxSp CAGGT(A/G) Present 248 Z boxes 05:10, 24 November 2022‎ likely active or activable
375. Zinc-responsive elements, (Zhao 1998), (Tang 2020) (ZREs) ACCYYNAAGGT or ACC(C/T)(C/T)NAAGGT Absent 101 Zap1ps 15:52, 15 March 2021 49
376. Zinc responsive elements, (ZREs), (Nicola 2007) MHHAACCBYNMRGGT or (A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT Absent 102 Zinc responsive elements 19:02, 15 March 2021 (4/3)3*49

Response element testing (Absent)

Main article: A1BG regulatory elements and regions
Response element
Name of elements Consensus sequences Response element class Testing Activity
Abbreviations Variations Absent (N) Notes
Authors
1. novel ABA-response elements

(ABREN, novel ABRE)

GATCGATC, CGATCGAT, GATCGAT WD40 repeat family N ABREN, CGATCGAT motif, and core of ABREN and CGATCGAT motif.[9]
2. ABA-response element-like

(ABRE-like)

ACGTGTCC WD40 repeat family N third highest scoring motif.[9]
3. Abf1 regulatory factors CGTCCTCTACGAT General Regulatory Factors N CGTNNNNNACGAT.[8]
4. Activating proteins

(Murata)

GCCCACGGG bHSH N Activating protein 2.[10]
5. AhR-responsive elements

(AHRE)

(Yao)

(G/T)NGCGTG(A/C)(C/G)A bHLH N in the promoter region of AhR responsive genes
6. Alpha-amylase conserved elements TATCCA ? N TATCCATCCATCC.[11]
7. Amino acid response elements

(AARE)

(Maruyama)

ATTGCATCA ? N AARE1 (ATTGCATCA)[12]
8. Amino acid response elements

(AARE)

(Broer)

TTTGCATCA ? N TTTGCATCA.[2][3]
9. Amino acid response element-like

(AARE-like)

TGGTGAAAG ? N AARE-like sequence (TGGTGAAAG, named AARE3).[12]
10. Androgen response elements

(AREs)

(Kouhpayeh)

GGTACANNNTGTTCT Zinc finger DNA-binding domain N GGTACACGGTGTTCT.[13]
11. Androgen response elements

(AREs)

(Wilson)

TGATTCGTGAG Zinc finger DNA-binding domain N AGAACANNNTGTTCT.[14]
12. Antioxidant-electrophile responsive elements

(Otsuki)

GTGAGGTCGC bHLH N GTGAGGTCGC.[4] or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A[5], an antioxidant response element (ARE)
13. CAAT boxes (C/T)(A/G)(A/G)CCAATC(A/G) bZIP N consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.
14. Calcium-response elements CTATTTCGAG ? N CaRE1 CTATTTCGAG.[15]
15. Carbohydrate response elements

(ChREs)

CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG ? N ChoRE1, ChoRE2.[16]
16. Carbon source-responsive elements

(CSREs)

CATTCATCCG ? N confers carbon source-dependent regulation
17. Cbf1 regulatory factors TCACGTGA ? N strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end.
18. C-boxes

(Johnson)

GAGGCCATCT bZIP N GAGGCCATCT.[17]
19. C/A hybrid boxes TGACGTAT bZIP N TGACGTAT.[18] A at the 12 position
20. C/T hybrid boxes TGACGTTA bZIP N TGACGTTA.[18] T at the 12 position
21. CCCTC-binding factors

(CTCF)

NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T) ? N NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C).[19]
22. C/EBP boxes TTAGGACAT,[6] or TAGCATT.[7] bZIP N CCAAT-enhancer-binding site (C/EBP) is TAGCATT
23. Cell-cycle boxes

(CCBs)

CACGAAAA ? N "cell cycle box" is functional in either orientation, acting as an enhancer
24. Cell cycle regulation CCCAACGGT[11] ? N tomato genome-wide analysis
25. CENP-B boxes TTTCGTTGGAAGCGGGA ? N specifically localized at the centromere
26. Coupling elements

(CE1)

TGCCACCGG[9] ? N CE1 (Watanabe)
27. DAF-16-associated elements

(DAE)

TGATAAG ? N DAF-16-associated element (DAE).[20]
28. D-boxes

(Mracek1)

GTTGTATAAC ? N GTTGTATAAC.[21]
29. D-boxes

(Mracek)

CTTATGTAAA (Mracek2) ? N CTTATGTAAA.[21]
30. D-boxes

(Johnson)

TCTCACA ? N TCTCACATT(A/C)AATAAGTCA is a D-box.[17]
31. Defense and stress-responsive elements ATTTTCTTCA ? N ATTTTCTTCA.[11]
32. DNA damage response elements

(DREs)

(Smith)

TTTCAAT[22] ? N in the upstream repression sequence (URS)
33. DNA damage response elements

(DREs)

(Sumrada)

TAGCCGCCG of TAGCCGCCGRRRR.[23] ? N in the upstream repression sequence (URS)
34. DNA replication-related elements

(DREs)

TATCGATA ? N DNA replication-related element (DRE).[24]
35. DREB boxes TACCGACAT ? N CRT/DREB box
36. EIF4E basal elements TTACCCCCCCTT ? N poly(C) motif
37. Endoplasmic reticulum stress response elements

(ERSE)

CCAAT-N9-CCACG bZIP N compare CCAAT-box and ERSE below in the (present)
38. Estrogen response elements

(EREs)

AGGTTA or GGTCAGGAT Cys
4		 N AGGTTATTGCCTCCT or GGTCAGGATGAC
39. F boxes TGATAAG[25] ? N F-box overlaps the I-box
40. Forkhead boxes GTAAACAA[26] HTH, Forkhead N GTAAACAA FOXO1
41. Gal4ps CGGACCGC ? N CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG[27]
42. γ-interferon activated sequences

(GAS)

TTCCTAGAA ? N ALS-GAS1 between nt −633 and nt −625
43. G boxes (G/T)CCACGTG(G/T)C ? N no "perfect palindrome" G boxes in either promoter
44. GCN4 motifs TGACTCA, TGAGTCA bZIP N ACGT motif
45. Gcn4ps ATGACTCTT[27] bZIP N GCN4 motifs
46. Gibberellin responsive element-like 2

(GARE-like 2)

(Fan)

TAACGTA[28] ? N "in the promoters of hydrolase genes".[28]
47. GLM boxes (G/A)TGA(G/C)TCA(T/C) ? N GCN4-like motif
48. Grainy head transcription factor binding sites AACCGGTT β-Scaffold factors with minor groove contacts N also GACTGGTT
49. GT boxes

(Motojima)

TGGGTGGGGCT ? N (-78 to -69)
50. Hapless motifs CCAATCA ? N heterotrimeric transcription factor, HAP2/3/4.[29]
51. Heat-responsive elements AAAAAATTTC Helix-turn-helix (HTH), Heat shock factors (HSFs) N four nGAAn motifs
52. Heat shock elements

(HSE1)

(Eastmond)

nGAAnnTTCnnGAAn HTH, HSFs N HSE1
53. Heat shock elements

(HSE2)

(Eastmond)

nTTCnnGAAnnTTCn HTH, HSFs N HSE2 is the inverse complement of HSE1
54. Heat shock elements

(HSE5)

(Eastmond)

nTTCn-(5-bp)-nTTCnnGAAn HTH, HSFs N HSE5
55. Heat shock elements

(HSE6)

(Eastmond)

nTTCn-nnGAAn-(5-bp)-nGAAn HTH, HSFs N HSE6
56. Heat shock elements

(HSE7)

(Eastmond)

nGA(A/G)nnTTCnnGAAn HTH, HSFs N HSE7 PFT1
57. Heat shock elements

(HSE)

(Eastmond)

nGAAnnTTCnnGA(A/G)n HTH, HSFs N HSE7 PFT2
58. Heat shock elements

(HSE10)

(Eastmond)

nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn HTH, HSFs N HSE10
59. Hypoxia-inducible factors

(HIF-1)

GCCCTACGTGCTGTCTCA[30] bHLH N composed of HIF-1α and HIF-1β
60. I boxes GATAAG ? N GGATGAGATAAGA
61. Inositol/choline-responsive elements

(ICRE)

(Case)

CANNTGAAAT ? N version of Lopes, see below
62. Inositol/choline-responsive elements

(ICRE)

(Lopes)

ATGTGAAAT ? N using ANNTGAAAT
63. Interferon-stimulated response elements

(ISREs)

AGTTTCN2TTTCN ? N consensus sequence AGTTTCN2TTTCN.[31]
64. Kozak sequences GCCGCC(A/G)CCATGG ? N GCCGCC(A/G)CCATGG[32]
65. Kozak sequences

(Matsumoto)

GAAAATGG ? N GAAAATGG[33]
66. L boxes AAATTAACCAA ? N AAATTAACCAA[34]
67. Maf recognition element

(MAREs)

TGCTGA(G/C)TCAGCA ? N and TGCTGA(GC/CG)TCAGCA[35]
68. Met3s TCACGTG bZIP N TCACGTG[36]
68. M boxes GTCATGTGCT ? N or AGTCATGTGCT[37]
69. Mcm1 regulatory factors TT(A/T)CCNN(A/T)TNGG(A/T)AA ? N Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.[8]
70. Mcm1 regulatory factors


(Rossi)

TTNCCNNNTNNGGNAA ? N Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.[8]
71. Motif ten elements C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G) ? N Gene ID: 6309
72. NF‐κB/Rel family of eukaryotic transcription factors CCCCTAAGGGG β-Scaffold factors with minor groove contacts N NF-κB
73. Nuclear factor 1

(NF-1)

TTGGCNNNNNGCCAA NF I N palindromic sequence
74. Nuclear factor Ys CCAATGG(A/C)(A/G) ? N NF-Y is a trimeric complex
75. p63 DNA binding sites (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T) β-Scaffold factors with minor groove contacts N RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
76. Pdr1p/Pdr3ps TCCGCGGA ? N Pdr1p/Pdr3p response elements (PDREs)
77. Peroxisome proliferator hormone response elements

(PPREs)

AGGTCANAGGTCA ? N PPARs/RXRs heterodimers bind to PPRE
78. Pollen1 with TCCACCATA AGAAANNNNTCCACCATA ? N adjacent co-dependent regulatory element TCCACCATA
79. TCCACCATA TCCACCATA ? N no regulatory element TCCACCATA was found, nor its ci.
80. Polycomb response elements CGCCAT(A/T)TT ? N CGCCATTT
81. Rap1 regulatory factors ACCC(A/G)N(A/G)CA ? N "(ACCCRnRCA), less than half of the sites were detectably bound"[8]
82. Extended Reb1 ATTACCCGAA ? N "extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."[8]
83. Rlm1ps CTATATATAG ? N CTA(T/A)4TAG
84. Rox1ps RRRTAACAAGAG ? N Heme-dependent repressor of hypoxic genes.[27]
85. Rpn4ps GGTGGCAAA ? N proteasome genes
86. Seed-specific elements CATGCATG ? N SRE consensus: CAGCAGATTGCG is none
87. Shoot specific elements GATAATGATG ? N SRE consensus: CAGCAGATTGCG is none
88. Sip4ps CC(C/G)T(C/T)C(C/G)TCCG ? N CC(C/G)T(C/T)C(C/G)TCCG[27]
89. Smp1ps ACTACTA(A/T)(A/T)(A/T)(A/T)TAG ? N ACTACTA(T/A)4TAG[27]
90. SP1

(Long)

GGGGCGGGCC ? N GGGGCGGGCC[16]
91. Sterol response elements

(Branco)

TCGTATA ? N perhaps plant specific
92. Sterol response elements

(Yao)

AGCAGATTGCG ? N liver specific
93. TATCCAC boxes TATCCAC ? N GA responsive complex component
94. TCCACCATA elements TCCACCATA ? N adjacent co-dependent regulatory element of POLLEN1
95. Tetradecanoylphorbol-13-acetate response elements

(TREs)

TGA(G/C)TCA ? N cis-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
96. TGF-β control elements

(TCEs)

GAGTGGGGCG ? N in mouse and rat, GCGTGGGGGA in humans
97. TGF-β inhibitory elements

(TIEs)

GAGTGGTGA ? N in the rat transin/stromelysin promoter
98. Vhr1ps

(VHR1)

AATCA-N8-TGA(C/T)T ? N Response to low biotin concentrations
99. Vitamin D response elements

(VDREs)

A/GGG/TTCAnnnA/GGG/TTCA ? N (A/G)G(G/T)TCANNN(A/G)G(G/T)TCA
100. X boxes GTTGGCATGGCAAC[38] ? N X2 box is AGGTCCA not ⌘F
101. X-boxes GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC[39] ? N includes GTTNCCATGGNAAC
102. Xbp1ps GcCTCGA(G/A)G(C/A)g(a/g) ? N Transcriptional repressor
103. Xenobiotic response elements

(XREs)

(T/G)NGCGTG(A/C)(G/C)A ? N contains the core sequence GCGTG, see AHRE above
104. Y boxes (A/G)CTAACC(A/G)(A/G)(C/T) ? N inverted CAAT box
105. Zap1ps ACCCTCA ? N ACC(C/T)(C/T)(A/C/G/T)AAGGT
106. Z-box (ZboxN) samplings

(ZboxNs)

ATACGGT ? N No ZboxN occur on either side of A1BG
107. Z-box (ZboxSo) samplings

(ZboxNs)

ATACGTGT ? N No ZboxSo occur on either side of A1BG
108. Zinc responsive elements

(ZREs)

MHHAACCBYNMRGGT ? N (A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT

Response element testing (Present)

Main article: A1BG regulatory elements and regions
Response element
Name of elements Consensus sequences Response element class Testing Activity/Notes
Abbreviations Variations Pathways Present (Y) Random or likely active or activable
Authors Table (T)
1. A-boxes

(A-box)

(Nawkar 2017)

TACGTA Basic leucine zipper (bZIP)

Light signaling and stress response pathways

Y

T

likely active or activable
2. Abscisic acid response elements

(ABREs)

(Watanabe 2017)

ACGTG(G/T)C WD40 repeat family

ABA-signaling pathway,[40] Ethylene signaling pathway

Y

T

likely active or activable
3. Activated B-cell Factor-1s

(ABFs, Abfms)

(Rossi 2018)

CGTNNNNN(A/G)(C/T)GA(C/T) General Regulatory Factors

B-cell receptor signal transduction pathway

Y

T

likely active or activable
4. boxes A

(AP-1 box A)

(Kokoroishi 2015)

TGACTCT bZIP

PKC-dependent pathway

Y

T

likely active or activable
5. Abscisic acid-responsive elements (Pho4s), G boxes

(G-box)

(Loake 1992)

CACGTG bZIP, bHLH

Purine and histidine biosynthesis pathways, Phenylpropanoid pathway, Light signaling and stress response pathways

Y

T

likely active or activable
6. ACGT-containing elements ACGT bZIP

Purine and histidine biosynthesis pathways, Phenylpropanoid pathway

Y

T

cores and proximals are likely active or activable, but a few of the UTRs and distal promoters may be random
7. Activating protein 2 alpha

(AP2a)

GCCNNNGGC bHSH

Rapamycin (TOR) regulatory pathways

Y

T

likely active or activable, positive strand, positive direction AP2a within randoms
8. Activating protein 2

(AP2)

(Cohen)

GCCTGGCC bHSH

Rapamycin (TOR) regulatory pathways

Y

T

likely active or activable
9. Activating protein 2

(Cohen)

TCCCCCGCCC bHSH

Rapamycin (TOR) regulatory pathways

Y

T

likely active or activable
10. Activating protein 2

(Murata)

(C/G)CCN(3)GG(C/G) bHSH

Rapamycin (TOR) regulatory pathways

Y

T

likely active or activable
11. Activating protein 2

(Murata)

(C/G)CCN(4)GG(C/G) bHSH

Rapamycin (TOR) regulatory pathways

Y

T

likely active or activable
12. Activating protein 2

(Yao)

TCTTCCC bHSH

Rapamycin (TOR) regulatory pathways

Y

T

likely active or activable
13. Activating protein 2

(Yao)

CTCCCA bHSH

Rapamycin (TOR) regulatory pathways

Y

T

likely active or activable
14. Activating proteins

(AP-2)

(Yao)

GGCCAA bHSH

Rapamycin (TOR) regulatory pathways

Y

T

likely active or activable
15. Activating transcription factors

(Burton)

(A/C/G)TT(A/G/T)C(A/G)TCA bZIP

Signal transduction pathways

Y

T

likely active or activable
16. Activating transcription factors

(Kilberg)

(A/G/T)TT(A/G/T)CATCA bZIP

Signal transduction pathways

Y

T

likely active or activable
17. Adenylate–uridylate rich elements

(AUREs)

(Bakheet)

(A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) stem-loop

ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein kinase (MAP kinase) pathway

Y

T

likely active or activable
18. Adenylate–uridylate rich elements

(AREs)

(Chen and Shyu, Class I)

ATTTA stem-loop

ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein kinase (MAP kinase) pathway

Y

T

likely active or activable, UTRs at the lower end of the randoms
19. Adenylate–uridylate rich elements

(AREs)

(Chen and Shyu, Class II)

TTATTTA(A/T)(A/T) stem-loop

ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein kinase (MAP kinase) pathway

Y

T

likely active or activable
20. Adenylate–uridylate rich elements

(AREs)

(Chen and Shyu, Class III)

ATTT stem-loop

ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein kinase (MAP kinase) pathway

Y

T

likely active or activable, low negative direction proximals overlap randoms
21. Adr1ps TTGG(A/G)G Cys
2His
2 zinc finger binding domain

ARE-mediated mRNA decay pathways, neddylation pathway, p38 mitogen-activated protein kinase (MAP kinase) pathway

Y

T

likely active or activable
22. Aft1s (C/T)(A/G)CACCC(A/G) bZIP? Y

T

likely active or activable
23. AGC boxes AGCCGCC AP-2/EREBP-related factors Y

T

likely active or activable
24. AhR responsive element or Aryl hydrocarbon responsive element II

(AHRE-II)

CATGN6C(A/T)TG bHLH Y

T

likely active or activable
25. AhR DNA-binding consensus sequence

(AhRY)

(Yao)

GCGTGNN(A/T)NNN(C/G) bHLH Y

T

likely active or activable for ZNF497
26. Androgen response element1s

(Kouhpayeh)

GGTACA of GGTACAnnnTGTTCT Zinc finger DNA-binding domain Y

T

likely active or activable
27. Androgen response element2s

(Kouhpayeh)

TGTTCT of GGTACAnnnTGTTCT Zinc finger DNA-binding domain Y

T

likely active or activable
28. Androgen response elements

(Wilson)

AGAACANNNTGTTCT Zinc finger DNA-binding domain Y

T

the two portions AGAACA and TGTTCT occurring separately are likely active or activable
29. Angiotensinogen core promoter elements (A/C)T(C/T)GTG bZIP? Y

T

likely active or activable, positive direction distal low occurrences overlap randoms
30. Antioxidant-electrophile responsive elements

(Lacher)

GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A bHLH Y

T

likely active or activable
31. ATA boxes AATAAA β-Scaffold factor? Y

T

likely active or activable
32. ATTTA elements

(Siegel)

(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T) β-Scaffold factor? Y

T

likely active or activable
33. Auxin response factors

(Stigliani)

(C/G/T)(A/C/T)(G/T)G(C/T)(C/T)(G/T)(C/G)(A/C/T)(A/G/T) WD40 repeat family Y

T

likely active or activable, positive direction proximals overlap high randoms, positive direction cores within randoms
34. Auxin response factors

(Ulmasov)

TGTCTC WD40 repeat family Y

T

likely active or activable
35. Auxin response factors

(Boer)

TGTCGG WD40 repeat family Y

T

likely active or activable
36. Auxin response factors

(ARF5)

(C/G/T)N(G/T)GTC(G/T) WD40 repeat family Y

T

likely active or activable, negative direction proximals ≥ randoms
37. B-boxes

(Johnson)

TGGGCA Zinc finger DNA-binding domains

PKC-dependent pathway

Y

T

likely active or activable, positive direction distals ≥ randoms
38. boxes B

(Sanchez)

TGTCTCA Zinc finger DNA-binding domains Y

T

likely active or activable
39. B recognition elements

(BREu)

(G/C)(G/C)(G/A)CGCC HTH Y

T

likely active or activable
40. CACA elements (Orlando 2019) CACA ? Y

T

likely active or activable
40. CadC binding domains TTANNNNT HTH Y

T

likely active or activable, negative direction proximals within randoms
41. Calcineurin-responsive transcription factors TG(A/C)GCCNC ?

calcineurin-dependent signaling pathways

Y

T

likely active or activable
42. Carbohydrate response elements ChoRE1 ACCGG ? Y

T

likely active or activable
43. Carbohydrate response elements ChoRE2 CCCAT ? Y

T

likely active or activable
44. Carbohydrate response elements Carb E1 ATCTTG bHLH? Y

T

proximals likely active or activable
45. Carbohydrate response elements Carb E2 CACGTG bHLH Y

T

likely active or activable
46. Carbohydrate response elements Carb E3 TCCGCC bHLH? Y

T

likely active or activable, low positive direction distals overlap high randoms
47. Carbon source-responsive elements TCCG elements

(TCCGs)

TCCG bHLH?

gluconeogenic pathway

Y

T

likely active or activable
48. CATTCA elements

(CATTs)

CATTCA bHLH?

gluconeogenic pathway

Y

T

likely active or activable
49. CARE (Fan)

(CAREs)

(Fan)

CAACTC WD-40 repeat family Y

T

likely active or activable
50. CARE (Garaeva)

(CAREs)

(Garaeva)

(A/G/T)TT(A/G/T)CATCA WD-40 repeat family Y

T

likely active or activable
51. cAMP-responsive elements

(CREs), Aca1ps, Sko1ps

TGACGTCA bZIP

cAMP-dependent pathway

Y

T

likely active or activable, same as Root specific elements
52. CArG boxes CCAAAAAT(G/A)G bHLH Y

T

likely active or activable
53. Cat8ps CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA ? Y

T

likely active or activable
54. CAT boxes CATTCCT bHLH Y

T

likely active or activable
55. CAT-box-like elements GCCATT bHLH Y

T

likely active or activable
56. C boxes

(Samarsky)

AGTAGT bZIP Y

T

likely active or activable
57. C-boxes

(Song)

GACGTC bZIP Y

T

likely active or activable
58. hybrid CG-boxes

(Song)

TGACGTGT bZIP Y

T

likely active or activable
59. C boxes

(Voronina)

GGTGATG bZIP Y

T

likely active or activable
60. CCCTC-binding factors

(CTCF)

(Lobanenkov 1990)

CCCTC ? Y

T

likely active or activable
60. Cell-cycle box variants

(CCBs)

CACGAAA, ACGAAA and C-CGAAA ? Y

T

likely active or activable
61. CGCG boxes (A/C/G)CGCG(C/G/T) ?

signal transduction pathways

Y

T

likely active or activable probably for the respective zinc fingers
62. Circadian control elements CAANNNNATC ? Y

T

likely active or activable but overlaps highest randoms
63. Class C DNA binding sites CACGNG bHLH Y

T

likely active or activable
64. Cold-responsive elements CCGAC ? Y

T

likely active or activable
65. Constitutive decay elements

(CDEs)

(Siegel)

TTC(C/T)(A/G)(C/T)GAA stem-loop Y

T

likely active or activable possibly for ZNF497
66. Copper response elements

(CuREs)

(Quinn)

TTTGC(T/G)C(A/G) ? Y

T

likely active or activable
67. Copper response elements

(CuREs)

(Park)

TGTGCTCA ? Y

T

likely active or activable
68. Coupling elements

(CE3s)

(Watanabe)

GCGTGTC WD-40 repeat family Y

T

likely active or activable
69. Coupling elements

(CE3s)

(Ding)

CACGCG WD-40 repeat family Y

T

likely active or activable
70. Cytokinin response regulators

(ARR1s)

AGATT(C/T) WD40 repeat family Y

T

likely active or activable
71. Cytokinin response regulators

(ARR10s)

(A/G)GATA(A/C)G WD40 repeat family Y

T

likely active or activable
72. Cytokinin response regulators

(ARR12s)

(A/G)AGATA WD40 repeat family Y

T

likely active or activable
73. Cytokinin response regulators

(ARRs)

(Ferreira)

(G/A)GGAT(T/C) WD40 repeat family Y

T

likely active or activable
74. Cytokinin response regulators

(ARRs)

(Rashotte1)

GATCTT WD40 repeat family Y

T

likely active or activable
75. Cytokinin response regulators

(ARRs)

(Rashotte2)

(G/A)GAT(T/C) WD40 repeat family Y

T

likely active or activable
76. Cytoplasmic polyadenylation elements

(CPEs)

TTTTTAT ? Y

T

likely active or activable
77. DAF-16 binding elements (A/G)(C/T)AAA(C/T)A ? Y

T

likely active or activable
78. D boxes

(Samarsky)

AGTCTG ? Y

T

likely active or activable
79. D boxes

(Voronina)

TCCTG ? Y

T

likely active or activable
80. D-boxes

(Motojima)

TGAGTGG ? Y

T

likely active or activable
115. Destruction boxes

(D box)

(Pfleger and Kirschner 2000)

CGN(C/T)TNAAN ? Y

T

likely active or activable
81. Dioxin-responsive elements

(DREs)

TNGCGTG bHLH? Y

T

likely active or activable
82. Downstream B recognition elements (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) ? Y

T

likely active or activable, negatives > randoms, positives overlap or outside randoms
83. Downstream core elements

(DCESIs)

CTTC of CTTC...CTGT...AGC ? Y

T

likely active or activable, depending on overlaps
84. Downstream core elements

(DCESIIs)

CTGT of CTTC...CTGT...AGC ? Y

T

likely active or activable, depending on overlaps
85. Downstream core elements

(DCESIIIs)

AGC of CTTC...CTGT...AGC ? Y

T

likely active or activable, depending on overlaps
86. Downstream promoter elements

(DPEs)

(Juven-Gershon)

(A/G)G(A/T)(C/T)(A/C/G)T ? Y

T

most or all of the real DPE (Juven-Gershon)s are likely active or activable
87. Downstream promoter elements

(DPEs)

(Kadonaga)

(A/G)G(A/T)CGTG ? Y

T

likely active or activable
88. Downstream promoter elements

(DPEs)

(Matsumoto)

AGTCTC ? Y

T

likely active or activable
89. E2 boxes (G/A)CAG(A/C/G/T)TG(A/C/G/T) bHLH Y

T

likely active or activable
90. EIN3 binding sites A(C/T)G(A/T)A(C/T)CT ?

Ethylene signaling pathway

Y

T

likely active or activable
91. Endoplasmic reticulum stress response elements CCAAT-N9-CCACG, part 1 see Hap motif no.114 below, ESRE2, CCACG bZIP Y

T

likely active or activable
92. Endosperm expressions TGTGTCA ? Y

T

likely active or activable
93. Enhancer boxes CA(A/C/G/T)(A/C/G/T)TG bHLH

metabolic pathways

Y

T

likely active or activable
94. Estrogen response elements

(ERE1s)

(Driscoll)

GGTCA Cys
4

estrogen response element-dependent signaling pathway

Y

T

likely active or activable
95. Estrogen response elements

(ERE2s)

(Driscoll)

TGACC Cys
4

estrogen response element-dependent signaling pathway

Y

T

likely active or activable
96. Ethylene responsive elements ATTTCAAA WD40 repeat family

Ethylene signaling pathway

Y

T

likely active or activable
97. Forkhead boxes (A/G)(C/T)AAA(C/T)A HTH, Forkhead Y

T

likely active or activable
98. GAAC elements GAACT ? Y

T

likely active or activable
99. Γ-interferon activated sequences

(GAS), see STAT5

TTNCNNNAA β-Scaffold factors with minor groove contacts Y

T

likely active or activable
100. GATA boxes GATA Zinc finger DNA-binding domains, bHLH

STAT5 pathway

Y

T

likely active or activable
101. GATA (GATAAG, GATAAH, GATTA) motifs

(Staschke)

GAT(A/T)A Zinc finger DNA-binding domains, bHLH

Rapamycin (TOR) Regulatory Pathways

Y

T

likely active or activable
102. GATC repeats

(ABREN)

(Watanabe et al. 2017)

GATC ?

ABA-signaling pathway, Ethylene signaling pathway

Y

T

GATC UTRs, proximals and positive strand, negative direction distals greater than randoms, negative strand, negative direction distals, positive direction distals likely randoms. GATCs are likely active or activable
103. GC boxes

(Briggs)

(G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) ? Y

T

likely active or activable
103. GC boxes

(Ye)

GGGCGG ? Y

T

likely active or activable
104. GCC boxes GCCGCC ?

Ethylene signaling pathway

Y

T

likely active or activable
105. General control nonderepressible 4 protein binding site

(GCRE, GCN4)

TGA(C/G/T)T(A/C/G)(A/T) bZIP

Rapamycin (TOR) Regulatory Pathways

Y

T

likely active or activable
106. GGCGGC triplet GGCGGC Zn(II)2Cys6 Y

T

likely active or activable
107. GGC triplets GGC Zn(II)2Cys6 Y

T

likely active or activable
108. Gibberellic acid responsive elements

(GAREs)

TAACAAA WD40 repeat family Y

T

likely active or activable
109. Gibberellic acid responsive elements-like 1

(GAREL1s)

TAACA(A/G)A WD40 repeat family Y

T

likely active or activable
110. Gibberellin responsive elements

(GREs)

(Sharma)

AAACAGA[11] WD40 repeat family

Gibberellin (GA) growth regulator pathway, GA-biosynthesis pathway

Y

T

likely active or activable
111. G-protein-coupled receptors

(GCR1s), CT boxes

CTTCC ?

cAMP signal pathway, phosphatidylinositol signal pathway

Y

T

likely active or activable.
112. Glucocorticoid response elements AGAACA bHLH

gluconeogenesis pathway

Y

T

likely active or activable
113. GT boxes

(Sato)

GGGG(T/A)GGGG ? Y

T

likely active or activable
114. Hac1 KAR2 CAGCGTG ?

unfolded protein response (UPR) pathway

Y

T

likely active or activable
115. H and ACA boxes AGAGGA Hairpin-hinge-hairpin-tail Y

T

likely active or activable, negative distals likely random
116. Hap motif and ESRE CCAAT

(Hap4p)

CCAAT bZIP Y

T

likely active or activable
117. H-boxes

(Grandbastien)

CC(A/T)ACCNNNNNNN(A/C)T hairpin-hinge-hairpin-tail

phenylpropanoid pathway

Y

T

likely active or activable
118. H-boxes

(Lindsay)

CCTACC hairpin-hinge-hairpin-tail Y

T

likely active or activable, equal to or greater than the randoms for the negative direction distals
119. H box

(Mitchell)

ANANNA hairpin-hinge-hairpin-tail Y

T

likely active or activable
120. H box

(Rozhdestvensky)

ACACCA hairpin-hinge-hairpin-tail Y

T

likely active or activable
121. Heat shock elements

(HSE3s)

(Eastmond)

nGAAn-(5-bp)-nGAAnnTTCn HTH, HSFs Y

T

likely active or activable
122. Heat shock elements

(HSEs)

(Eastmond)

nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP1) HTH, HSFs Y

T

same result as HSE3, likely active or activable
123. Heat shock elements

(HSEs)

(Eastmond)

nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP2) HTH, HSFs Y

T

same result as HSE3, likely active or activable
124. Heat shock elements

(HSE4s)

(Eastmond)

nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn HTH, HSFs Y

T

likely active or activable
125. Heat shock factors

(Hsfs)

(Tang)

NGAAN HTH, HSFs Y

T

likely active or activable
85. Helper site

(Atcha et al. 2007), (Cadigan and Waterman 2012)

(C/G)C(C/G)G(C/G) ?

Wnt/beta-catenin signaling pathway

Y

T

likely active or activable
126. Hex sequences TGACGTGGC ? Y

T

likely active or activable
127. High Mobility Group boxes

(HMG boxes)

(A/T)(A/T)CAAAG β-Scaffold factors with minor groove contacts Y

T

likely active or activable
128. HNF6s (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) Cys
4

GH/HNF-6 pathway, HNF6/HNF1β pathway, HNF6 pathway, KLF4/HNF-6 pathway

Y

T

likely active or activable, although the negative direction distals are at or less than randoms
129. Homeoboxes CAAG HTH

lignin pathway, Wnt dorsalisation pathway, lefty-signaling pathway

Y

T

likely active or activable
130. Homeodomains TAAT HTH Y

T

likely active or activable, low occurrence UTRs and negative direction distals overlap high randoms
131. HY boxes TG(A/T)GGG ? Y

T

likely active or activable
132. Hypoxia-inducible factors ACGTG bHLH Y

T

likely active or activable
133. Hypoxia response elements CACGC WD40 repeat family Y

T

likely active or activable
134. CACA elements CACA WD40 repeat family Y

T

likely active or activable
135. Initiator elements

(Inrs)

YYRNWYY ? Y

T

likely active or activable
136. Initiator elements

(Inrs)

BBCABW ? Y

T

likely active or activable
137. Initiator-like elements

(Ins-Like)

TTCTCT ? Y

T

likely active or activable, where real Inr-like negative direction distals are within the range of the randoms
138. Initiator-like elements

(TCT)

(C/T)CT(C/T)T(C/T)(C/T) ? Y

T

likely active or activable
139. Inositol/choline-responsive elements

(ICRE)

(Case, Lopes)

CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991) bHLH Y

T

likely active or activable
140. Inositol/choline-responsive elements

(ICREs)

(Schwank)

TYTTCACATGY contains the core sequence CANNTG bHLH Y

T

likely active or activable
141. Interferon regulatory factor

(IRF3)

GCTTTCC HTH Y

T

likely active or activable
142. IFN-stimulated response elements

(ISREs)

(Lu)

GAAANNGAAA HTH Y

T

likely active or activable
143. IRS consensus

(Fujii)

AANNGAAA HTH Y

T

likely active or activable
144. Tryptophan residues

(Lu)

GAAA HTH Y

T

likely active or activable, the tryptophan residues occur in the IRS, IFN, ICRE, Cell-cycle box variants, V-box, Pollen1, and β-Scaffold response elements
145. Jasmonic acid-responsive elements

(JAREs)

TGACG ? Y

T

likely active or activable
146. Krüppel-like factors GGGNN(G/T)(G/T)(G/T) ? Y

T

likely active or activable
147. Leu3 transcription factors (C/G)C(G/T)NNNN(A/C)G(C/G) Zn(II)2Cys6 Y

T

likely active or activable
148. -35 sequence TTGACA ? Y

T

likely active or activable, the UTR does overlap the randoms at the random's upper end
149. Met31ps AAACTGTG[36] bZIP Y

T

likely active or activable
150. Metal responsive elements

(MRE)

TGC(A/G)C(A/C/G/T)C ? Y

T

likely active or activable
151. Middle sporulation element

(MSE)

(Branco)

ACACAAA ? Y

T

likely active or activable
152. Midsporulation element

(MSE)

(Ozsarac)

C(A/G)CAAA(A/T) ? Y

T

likely active or activable
153. Multicopy inhibitor of the GAL1 promoter

(MIG1)

(C/G)(C/T)GGGG bZIP Y

T

likely active or activable, UTRs may be random
154. MITF E-box (CAYRTG)

(MITF)

CA(C/T)(A/G)TG ? Y

T

likely active or activable, negative distals overlap randoms at low end
155. Musashi binding elements

(MBE1s)

(G/A)U1AGU ? Y

T

likely active or activable
156. Musashi binding elements

(MBE2s)

(G/A)U2AGU ? Y

T

likely active or activable, negative direction distals may be random
157. Musashi binding elements

(MBE3s)

(G/A)U3AGU ? Y

T

likely active or activable
158. MYB ACGT-containing elements

(ACEs)

CACGT ? Y

T

likely active or activable, positive strand UTR is likely random, negative strand, positive direction distals are likely random
159. Myeloblastosis recognition element

(MRE)

A(A/C)C(A/T)A(A/C)C ? Y

T

likely active or activable
160. Myocyte enhancer factors

(MEFs)

(C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) β-Scaffold factors with minor groove contacts Y

T

likely active or activable
161. Nanos/Pumilio response elements

(PREs)

TGTAAAT ? Y

T

likely active or activable
162. N-boxes

(Lee)

CCGGAA bHLH Y

T

likely active or activable
163. N-boxes

(Bai)

CACGAG bHLH Y

T

likely active or activable
164. N-boxes

(Gao)

CACGGC or CACGAC, CACG(A/G)C bHLH Y

T

likely active or activable
165. N-boxes

(Leal)

CACNAG bHLH Y

T

likely active or activable
166. Non-DiTyrosine 80 transcription factor DNA binding domain

(Ndt80)

(A/G/T)NC(A/G)CAAA(A/T) ? Y

T

likely active or activable
167. Nuclear factor of activated T cells

(NFATs)

complement and inverse of the Pyrimidine boxes

GGAAAA β-Scaffold factors with minor groove contacts Y

T

likely active or activable, negative direction distals likely random
168. NF𝜿B (Sato)

(NF𝜿BSs)

GAATTC ? Y

T

likely active or activable
169. Nutrient-sensing response element 1

(NSRE)

GTTTCATCA ? Y

T

likely active or activable
170. Oaf1 transcription factor CGGN3TNAN9-12CCG ? Y

T

likely active or activable
171. ORESARA1

(ORE1)

(Matallana)

(A/C/G)(A/C)GT(A/G)N5,6(C/T)AC(A/G) ? Y

T

likely active or activable
172. ORESARA1

(ORE1)

(Olsen)

T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) ? Y

T

likely active or activable
173. p53 response elements (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) β-Scaffold factors with minor groove contacts Y

T

likely active or activable
174. p53 response elements

(Long1)

CAGGCCC β-Scaffold factors with minor groove contacts Y

T

likely active or activable
175. p53 response elements

(Long2)

GGGCGTG β-Scaffold factors with minor groove contacts Y

T

likely active or activable
176. P-box (Mena) (A/T)AAAG ? Y

T

likely active or activable, the positive direction proximals overlap the randoms
177. P-box

(Motojima)

TGAGTTCA ? Y

T

likely active or activable
178. P-box

(Yu)

GTAA(T/C) ? Y

T

likely active or activable with some overlapping the randoms
179. Peroxisome proliferator-activated receptor alpha CGACCCC ? Y

T

likely active or activable, positive direction distal overlaps upper end of randoms
180. Phosphate starvation-response transcription factor

(Pho4)

(Tang 2020)

CAC(A/G)T(T/G) bHLH

purine and histidine biosynthesis pathways

Y

T

likely active or activable, positive strands of the UTRs and negative direction distals are in the random range
181. Pollen1 elements AGAAA ? Y

T

likely active or activable
182. Polycomb response elements

(PRE)

GCCAT ? Y

T

likely active or activable
183. Pribnow boxes TATAAT ? Y

T

likely active or activable
184. Prolamin boxes TG(A/T)AAAG ? Y

T

likely active or activable
185. Q elements

See Retinoic acid response element

AGGTCA ? Y

T

likely active or activable
186. Quinone reductase response element

(QRDRE)

(Yao)

TCCCCT of TCCCCTTGCGTG ? Y

T

likely active or activable
187. Rap1 reduced consensus (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) WD40 repeat family Y

T

likely active or activable
188. Reb1 bound and exact occurrences TTACCC(G/T) WD40 repeat family Y

T

likely active or activable
189. Retinoic acid response element

(RARE)

AG(A/G)TCA ? Y

T

likely active or activable, positive direction distals appear random
190. Glucose transporter gene repressor

(Rgt1)

CGG(A/G)(A/T)N(A/T)(A/T) ? Y

T

likely active or activable
191. classic RORE motif

(RORE)

A(A/T)NTAGGTCA ? Y

T

likely active or activable
192. variant RORE motif C(T/A)(G/A)GGNCA ? Y

T

likely active or activable
193. R response elements

(RRE)

CATCTG ? Y

T

likely active or activable
194. Serum response elements

(SRE)

see CArG boxes

ACAGGATGT bHLH-ZIP Y

T

likely active or activable
195. Servenius sequences GGACCCT ? Y

T

likely active or activable
196. SP1

(Zhang)

(G/T)GGGCGG(G/A)(G/A)(C/T) ? Y

T

likely active or activable
197. SP1-box 1

(Motojima)

GGGGCT ? Y

T

likely active or activable
198. SP1-box 2

(Motojima)

CTGCCC ? Y

T

likely active or activable
199. SP-1

(Sato)

CCGCCCC ? Y

T

likely active or activable
200. SP1

(Yao)

GCGGC ? Y

T

likely active or activable
201. STAT5 TTCNNNGAA β-Scaffold factors with minor groove contacts Y

T

likely active or activable
202. Stress-response elements

(STREs)

CCCCT ? Y

T

likely active or activable, positive cores overlap randoms

Positive strand, negative direction: CCCCT at 3059

203. Sucrose boxes NNAATCA ? Y

T

likely active or activable
204. TACTAAC boxes TACTAA(C/T) ? Y

T

likely active or activable
205. TAGteams CAGGTAG ? Y

T

likely active or activable
206. Tapetum boxes TCGTGT ? Y

T

likely active or activable
207. metazoan TATA boxes TATA(A/T)AA(A/G) β-Scaffold factors with minor groove contacts Y

T

likely active or activable
208. TATA boxes TATA(A/T)A(A/T)(A/G) β-Scaffold factors with minor groove contacts Y

T

likely active or activable
209. TAT Boxes

(Yang)

TATAAAA WD40 repeat family Y

T

likely active or activable
210. TAT Boxes

(Fan)

TATCCAT WD40 repeat family Y

T

likely active or activable
211. Tbf1 regulatory factors A(A/G)CCCTAA General Regulatory Factors Y

T

Saccharomyces cerevisiae, likely active or activable
212. T boxes

(Conlon)

TCACACCT bZIP Y

T

likely active or activable
213. T boxes

(Zhang)

AACGTT bZIP Y

T

likely active or activable
214. TEA consensus sequences CATTCY ? Y

T

likely active or activable
215. Tec1ps GAATGT ? Y

T

likely random, Ste12p cofactor
216. Telomeric repeat DNA-binding factors

(TRFs)

TTAGGG ? Y

T

likely active or activable
217. Thyroid hormone response elements

(TREs)(THRs)

AGGTCA ? Y

T

likely active or activable
218. Transcription factor 3

(TCF3)

GTCTGGT ? Y

T

likely active or activable
219. Translational control sequences

(TCSs)

(A/T)TT(A/G)TCT ? Y

T

likely active or activable
220. Unfolded protein response element

(URE) (UPRE-1)

CANCNTG ? Y

T

likely active or activable
221. Unfolded protein response elements

(UPREs)

TGACGTG(G/A) bZIP Y

T

likely active or activable
222. Upstream repressor site 1

(URS1, core)

(Sumrada)

CCGCC ? Y

T

likely active or activable, negative direction proximals are within randoms
223. Upstream stimulating factors

(USFs)

GCC(A/T)NN(C/G/T)(A/G) bHLH-ZIP Y

T

likely active or activable, cores overlap lower randoms
224. UUA rich elements

(Chen)

TTATTTA(A/T)(A/T) ? Y

T

likely active or activable
225. V boxes (A/G)TT(A/T)(C/T) ? Y

T

likely active or activable
226. Vitamin D response elements

(VDREs)

(A/G)G(G/T)(G/T)CA ? Y

T

likely active or activable
227. W boxes (C/T)TGAC(C/T) WRKY Y

T

likely active or activable
228. X core promoter elements (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) ? Y

T

likely active or activable
229. Xenobiotic response elements

(XREs)

GCGTG bHLH

aryl hydrocarbon receptor pathways

Y

T

likely active or activable
230. Yap recognition sequences TTACTAA ? Y

T

likely active or activable
231. YY1 binding sites CCATCTT Cys
2His
2		 Y

T

likely active or activable
232. Z boxes

NSoSp form

A(C/T)A(C/G)G(G/T)(A/G/T)T ? Y

T

likely active or activable, negative direction distals within randoms
233. Z boxes

ZboxG

A(C/T)A(C/G)GT(A/G)T ? Y

T

likely active or activable
234. Z boxes

ZboxSp

CAGGT(A/G) ? Y

T

likely active or activable

Totals

Of 376 response elements, there are 121 Ns for not present (absent) in either A1BG promoter and 255 Ys for (present) or transcription factors that occur in the promoters on either side A1BG. There are 255 likely active or activable (67.82 %). With 4560 nts considered between ZSCAN22 and A1BG, halfway would be at 2280. Less than 2280 suggests the nearest other gene. In the positive direction, 4445 nts considered between ZNF497 and A1BG, halfway would be 2222 for another nearest gene. Less than 2222 suggests the nearest other gene.

Number of non-degenerate nucleotides per response element

see Non-degenerate nucleotides per response element

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

See also

References

  1. ↑ MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.
  2. ↑ 2.0 2.1 Angelika Bröer; Gregory Gauthier-Coles; Farid Rahimi; Michelle van Geldermalsen; Dieter Dorsch􏰀; Ansgar Wegener; Jeff Holst; Stefan Bröer (March 15, 2019). "Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells" (PDF). Journal of Biological Chemistry. 294 (11): 4012–4026. doi:10.1074/jbc.RA118.006378. Retrieved 4 October 2020.
  3. ↑ 3.0 3.1 Alisa A. Garaeva; Irina E. Kovaleva; Peter M. Chumakov; Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.
  4. ↑ 4.0 4.1 Akihito Otsuki; Mikiko Suzuki; Fumiki Katsuoka; Kouhei Tsuchida; Hiromi Suda; Masanobu Morita; Ritsuko Shimizu; Masayuki Yamamoto (February 2016). "Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection". Free Radical Biology and Medicine. 91: 45–57. doi:10.1016/j.freeradbiomed.2015.12.005. PMID 26677805. Retrieved 21 August 2020.
  5. ↑ 5.0 5.1 Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.
  6. ↑ 6.0 6.1 Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
  7. ↑ 7.0 7.1 Yao EF; Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.
  8. ↑ 8.0 8.1 8.2 8.3 8.4 8.5 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
  9. ↑ 9.0 9.1 9.2 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
  10. ↑ Takayuki Murata; Chieko Noda; Yohei Narita1; Takahiro Watanabe; Masahiro Yoshida; Keiji Ashio; Yoshitaka Sato; Fumi Goshima; Teru Kanda; Hironori Yoshiyama; Tatsuya Tsurumi; Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.
  11. ↑ 11.0 11.1 11.2 11.3 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.
  12. ↑ 12.0 12.1 Ryuto Maruyama; Makoto Shimizu; Juan Li, Jun Inoue; Ryuichiro Sato (24 March 2016). "Fibroblast growth factor 21 induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region". Bioscience, Biotechnology, and Biochemistry. 80 (5): 929–934. doi:10.1080/09168451.2015.1135045. Retrieved 4 October 2020.
  13. ↑ S Kouhpayeh; AR Einizadeh; Z Hejazi; M Boshtam; L Shariati; M Mirian; L Darzi; M Sojoudi; H Khanahmad; A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.
  14. ↑ Stephen Wilson, Jianfei Qi & Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.
  15. ↑ Xu Tao; Anne E. West; Wen G. Chen; Gabriel Corfas; Michael E. Greenberg (2002). "A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF". Neuron. 33: 383–95. doi:10.1016/S0896-6273(01)00561-X. PMID 11832226. Retrieved 2 September 2020.
  16. ↑ 16.0 16.1 Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.
  17. ↑ 17.0 17.1 PA Johnson; D Bunick; NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.
  18. ↑ 18.0 18.1 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.
  19. ↑ Hideharu Hashimoto; Dongxue Wang; John R. Horton; Xing Zhang; Victor G. Corces; Xiaodong Cheng (1 June 2017). "Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA". Molecular Cell. 66 (5): 711–720.e3. doi:10.1016/j.molcel.2017.05.004. PMID 28529057. Retrieved 28 August 2020.
  20. ↑ Yan-Hui Li; Gai-Gai Zhang (12 April 2016). "Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in Caenorhabditis elegans". Oncotarget. 7 (15): 19185–19192. doi:10.18632/oncotarget.8313. PMID 2702736. Retrieved 27 August 2020.
  21. ↑ 21.0 21.1 Philipp Mracek; Cristina Santoriello; M. Laura Idda; Cristina Pagano; Zohar Ben-Moshe; Yoav Gothilf; Daniela Vallone; Nicholas S. Foulkes (December 6, 2012). "Regulation of per and cry Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression". PLoS ONE. 7 (12): e51278. doi:10.1371/journal.pone.0051278. Retrieved 10 February 2019.
  22. ↑ Joshua J. Smith, Eric S. Cole, Daniel P. Romero (15 July 2004). "Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila". Nucleic Acids Research. 32 (14): 4313–4321. doi:10.1093/nar/gkh771. PMID 15304567. Retrieved 4 September 2020.
  23. ↑ Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.
  24. ↑ Fumiko Hirose; Masamitsu Yamaguchi; Akio Matsukage (September 1999). "Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc". Molecular and Cellular Biology. 19 (9): 6020–6028. doi:10.1128/MCB.19.9.6020. PMID 10454549. Retrieved 4 September 2020.
  25. ↑ Annkatrin Rose, Iris Meier and Udo Wienand (28 October 1999). "The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins". The Plant Journal. 20 (6): 641–652. doi:10.1046/j.1365-313X.1999.00638.x. Retrieved 8 November 2018.
  26. ↑ Eiji Yoshihara (18 August 2020). "TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis". Antioxidants. 9 (8): 765–84. doi:10.3390/antiox9080765. PMID 32824669 Check |pmid= value (help). Retrieved 5 September 2020.
  27. ↑ 27.0 27.1 27.2 27.3 27.4 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.
  28. ↑ 28.0 28.1 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.
  29. ↑ Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.
  30. ↑ Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
  31. ↑ Agata Michalska, Katarzyna Blaszczyk, Joanna Wesoly and Hans A. R. Bluyssen (28 May 2018). "A Positive Feedback Amplifier Circuit That Regulates Interferon (IFN)-Stimulated Gene Expression and Controls Type I and Type II IFN Responses". Frontiers in Immunology. 9: 1135. doi:10.3389/fimmu.2018.01135. Retrieved 18 March 2021.
  32. ↑ Marilyn Kozak (October 1987). "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs". Nucleic Acids Research. 15 (20): 8125–8148. doi:10.1093/nar/15.20.8125. PMID 3313277.
  33. ↑ Takuya Matsumoto; Saemi Kitajima; Chisato Yamamoto; Mitsuru Aoyagi; Yoshiharu Mitoma; Hiroyuki Harada; Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
  34. ↑ Robert G. K. Donald and Anthony R. Cashmore (1990). "Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS‐1A promoter". The EMBO Journal. 9 (6): 1717–1726. doi:10.1002/j.1460-2075.1990.tb08295.x. Retrieved 8 November 2018.
  35. ↑ Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto (13 February 2004). "Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique". Genes to Cells. 9 (2). doi:10.1111/j.1356-9597.2004.00711.x. Retrieved 8 September 2020.
  36. ↑ 36.0 36.1 Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. Retrieved 4 February 2021.
  37. ↑ Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.
  38. ↑ XIAN-YANG ZHANG, NABILA JABRANE-FERRAT, CLEMENT K. ASIEDU, SANJA SAMAC, B. MATIJA PETERLIN, AND MELANIE EHRLICH (November 1993). "The Major Histocompatibility Complex Class II Promoter-Binding Protein RFX (NF-X) Is a Methylated DNA-Binding Protein" (PDF). MOLECULAR AND CELLULAR BIOLOGY. 13 (11): 6810–8. Retrieved 2017-04-05.
  39. ↑ Eduardo Moreno, Maša Lenuzzi, Christian Rödelsperger, Neel Prabh, Hanh Witte, Waltraud Roeseler, Metta Riebesell, Ralf J. Sommer (November 2018). "DAF‐19/RFX controls ciliogenesis and influences oxygen‐induced social behaviors in Pristionchus pacificus". Evolution & Development. 20 (6): 233–243. doi:10.1111/ede.12271. Retrieved 9 March 2021.
  40. ↑ Andrew C. Cuming (5 December 2019). "Evolution of ABA signaling pathways". Advances in Botanical Research. 92: 281–313. doi:10.1016/bs.abr.2019.06.003. Retrieved 15 May 2023.

External links

{{Phosphate biochemistry}}


Retrieved from "https://www.wikidoc.org/index.php?title=A1BG_response_element_gene_transcriptions&oldid=1737160"