Hsf1p gene transcriptions

Jump to navigation Jump to search

Associate Editor(s)-in-Chief: Henry A. Hoff

"In response to elevated temperatures, cells from many organisms rapidly transcribe a number of mRNAs. In Saccharomyces cerevisiae, this protective response involves two regulatory systems: the heat shock transcription factor (Hsf1) and the Msn2 and Msn4 (Msn2/4) transcription factors."[1]

"Yeast Hsf1 is an essential protein that binds to inverted repeats of nGAAn called heat shock elements (HSEs) within the promoters of many HSPs and activates their transcription."[1]

Human genes

Main article: Human genes

"In response to heat shock, mammalian HSF undergoes nuclear localization, trimerizes, and binds to HSEs."[1]

Interactions

Main article: Interaction gene transcriptions

Consensus sequences

Main article: Consensus sequence gene transcriptions

The upstream activating sequence (UAS) for the Hsf1p is 5'-NGAAN-3' or 5'-(A/C/G/T)GAA(A/C/G/T)-3'.[2]

Complement-inverse copies

Main article: Complement-inverse copy gene transcriptions

Recent "studies on the MDJ1 promoter identified a novel non-consensus HSE that consists of three separated nGAAn motifs, nTTCn-(11-bp)-nGAAn-(5-bp)-nGAAn (58). When we analyzed promoters of the genes induced by HSF for this non-consensus HSE, we found 2.9% of the genes contained this novel HSE."[1]

"Of the 90 heat-induced genes that contain HSEs in their promoters, there is an equal number of HSEs that start with nGAAn and nTTCn, but genes with a -fold change >5-fold have HSEs with the sequences nTTCnnGAAn or nTTCnnNNNnnTTC than any combination starting with nGAAn (66.7%). These findings suggest that the type of Hsf1 binding site is not as important as the topology of the HSE. Previous studies have revealed that all three DNA-binding domains of the trimeric Hsf1 bind to one face of the DNA (59), and our studies confirm that the orientation of the HSE with respect to the transcriptional start site can affect its transcriptional activity."[1]

Complement copies

Main article: Complement copy gene transcriptions

"To identify Hsf1 binding sites in the promoter sequences, we analyzed 1000 bp upstream of the start codon of the loci that represented verifiable [open reading frame] ORFs. Sequences were retrieved from the [Saccharomyces Genome Database] SGD (36, 37) and analyzed using a simple pattern-identification program. We defined three types of HSEs, each having three nGAAn repeats in Perfect (PFT), GAP (GAP), and STEP (STP) arrangements. The perfect HSE (PFT) consists of three contiguous, inverted repeats of the nGAAn sequence, either nGAAnnTTCnnGAAn or nTTCnnGAAnnTTCn. The GAP HSE consists of an nGAAn repeat, followed by any 5 bp and 2 inverted nGAAn repeats (nGAAn-(5-bp)-nGAAnnTTCn) and its complement (nGAAnnTTCn-(5-bp)-nTTCn), as well as the related sequences nTTCn-(5-bp)-nTTCnnGAAn and nTTC-nnGAAn-(5-bp)-nGAAn. The STP HSE has a 5-bp insert between each of the 3 nGAAn repeats, yielding the sequences nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn and nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn (30). As per previous studies (27, 30), we also allowed a single mismatch (nGAR) in one of the three nGAAn repeats for PFT or GAP."[1]

Inverse copies

Main article: Inverse copy gene transcriptions

"HSEs are composed of inverted, alternating repeats of the 5-bp sequence nGAAn, where n is any nucleotide (53, 54, 55, 56). The number of pentameric units in an HSE varies, but three to six units are thought to be required for heat regulation in vivo (30, 57). Deviations from the consensus in both sequence and/or the distance between the modules can be tolerated, but to what extent is unknown. To determine if there is a correlation between the different HSEs and the affinity of Hsf1 for the motif and, thereby, the level of transcription activation, we searched in the promoters of the genes for three types of HSEs. Each type contains three nGAAn core motifs, but the variants are distinguishable from each other by the location of the core motifs within the HSE [...]."[1]

Hypotheses

Main article: Hypotheses
  1. A1BG has no Hsf1s in either promoter.
  2. A1BG is not transcribed by an Hsf1.
  3. No Hsf1s participates in the transcription of A1BG.

HSE (Tang) samplings

Copying 5'-TGAAA-3' in "⌘F" yields twelve between ZSCAN22 and A1BG and 5'-CGAAC-3' one between ZNF497 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence NGAAN (starting with SuccessablesAAA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for NGAAN, 52, AGAAG at 4528, TGAAA at 4461, AGAAT at 4406, CGAAC at 4293, TGAAC at 4267, CGAAC at 4187, TGAAT at 4162, TGAAC at 4011, TGAAA at 3984, AGAAC at 3792, CGAAG at 3776, GGAAC at 3570, AGAAG at 3553, CGAAC at 3400, TGAAC at 3241, TGAAC at 3102, TGAAA at 3075, TGAAA at 3018, CGAAT at 2935, TGAAC at 2920, CGAAC at 2713, TGAAC at 2579, TGAAA at 2552, CGAAC at 2378, TGAAA at 2216, TGAAC at 2126, TGAAA at 2099, CGAAC at 1972, TGAAC at 1926, TGAAA at 1790, AGAAA at 1733, TGAAA at 1687, AGAAC at 1648, TGAAC at 1618, AGAAC at 1606, TGAAT at 1545, AGAAA at 1418, TGAAC at 1299, TGAAA at 1145, TGAAG at 1053, CGAAC at 1008, CGAAC at 842, TGAAA at 681, GGAAG at 619, TGAAA at 545, TGAAA at 408, AGAAA at 347, TGAAC at 327, GGAAT at 317, AGAAC at 280, AGAAA at 47, AGAAA at 25.
  2. negative strand, positive direction, looking for NGAAN, 62, GGAAC at 4443, GGAAG at 4263, GGAAG at 4248, AGAAG at 4197, TGAAA at 4091, AGAAC at 4067, AGAAC at 4047, TGAAC at 3936, TGAAA at 3926, AGAAA at 3918, GGAAG at 3871, GGAAC at 3855, AGAAG at 3851, TGAAC at 3837, AGAAT at 3833, GGAAA at 3794, TGAAT at 3780, GGAAG at 3762, GGAAG at 3667, TGAAA at 3596, GGAAT at 3565, TGAAT at 3443, GGAAT at 3439, GGAAT at 3365, AGAAG at 3216, GGAAA at 3165, AGAAC at 3093, AGAAT at 3067, TGAAA at 2917, AGAAT at 2839, GGAAA at 2831, GGAAG at 2784, AGAAC at 2775, GGAAG at 2748, AGAAT at 2723, AGAAA at 2629, GGAAA at 2623, GGAAC at 2578, AGAAT at 2241, AGAAC at 2224, AGAAG at 2192, TGAAA at 2146, AGAAC at 1950, AGAAC at 1810, AGAAG at 1633, GGAAG at 1594, AGAAT at 1418, AGAAT at 1318, AGAAG at 1231, GGAAA at 1089, AGAAG at 1063, TGAAG at 961, TGAAG at 861, CGAAG at 768, TGAAG at 727, AGAAG at 643, AGAAG at 559, CGAAC at 362, GGAAA at 290, TGAAG at 232, GGAAG at 209, AGAAG at 48.
  3. positive strand, negative direction, looking for NGAAN, 93, GGAAT at 4553, AGAAC at 4450, AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAG at 3936, TGAAA at 3922, GGAAG at 3909, TGAAC at 3783, GGAAC at 3723, GGAAT at 3677, AGAAC at 3667, GGAAA at 3663, GGAAG at 3610, AGAAA at 3591, TGAAA at 3507, GGAAC at 3459, AGAAG at 3407, AGAAA at 3376, AGAAA at 3342, TGAAC at 3244, AGAAT at 3235, TGAAA at 3146, AGAAT at 3002, GGAAA at 2967, GGAAA at 2957, GGAAA at 2926, AGAAA at 2838, AGAAA at 2831, AGAAG at 2828, AGAAA at 2821, AGAAA at 2814, AGAAG at 2811, AGAAA at 2804, AGAAA at 2800, TGAAA at 2746, GGAAG at 2730, TGAAC at 2716, TGAAT at 2707, TGAAA at 2619, TGAAG at 2595, GGAAG at 2557, AGAAA at 2505, GGAAA at 2458, TGAAC at 2381, AGAAT at 2372, TGAAA at 2282, CGAAA at 2157, AGAAA at 2055, TGAAC at 1955, AGAAT at 1946, TGAAA at 1855, GGAAT at 1693, GGAAC at 1684, GGAAA at 1676, GGAAA at 1660, AGAAG at 1655, GGAAA at 1642, AGAAA at 1630, TGAAA at 1625, TGAAA at 1582, CGAAG at 1555, AGAAC at 1551, AGAAT at 1520, AGAAT at 1413, TGAAC at 1302, AGAAT at 1293, TGAAA at 1212, TGAAC at 1011, AGAAT at 1002, TGAAC at 845, AGAAT at 836, CGAAA at 494, TGAAA at 473, TGAAG at 367, AGAAA at 357, GGAAG at 331, CGAAA at 312, AGAAA at 303, AGAAT at 291, AGAAC at 286, GGAAG at 241, AGAAA at 226, AGAAT at 196, AGAAA at 135, TGAAG at 132, TGAAA at 126, AGAAA at 102, GGAAG at 81, AGAAA at 52, TGAAT at 19.
  4. positive strand, positive direction, looking for NGAAN, 64, AGAAC at 4388, AGAAA at 4382, GGAAC at 4299, GGAAG at 4241, GGAAA at 4207, AGAAC at 4130, GGAAG at 4061, TGAAC at 4015, CGAAG at 3994, GGAAA at 3945, AGAAA at 3397, AGAAG at 3394, GGAAC at 3373, GGAAG at 3312, AGAAG at 3247, AGAAG at 3057, TGAAG at 3031, GGAAC at 3001, TGAAG at 2947, GGAAT at 2763, TGAAC at 2741, AGAAA at 2585, GGAAG at 2582, TGAAC at 2418, AGAAT at 2364, TGAAG at 2361, AGAAA at 2278, TGAAA at 2273, CGAAA at 2163, TGAAG at 2107, CGAAG at 2095, AGAAA at 1981, TGAAG at 1914, AGAAT at 1886, GGAAA at 1830, GGAAC at 1798, TGAAA at 1746, GGAAA at 1599, CGAAC at 1578, AGAAT at 1537, GGAAG at 1516, GGAAG at 1432, GGAAG at 1405, GGAAG at 1332, GGAAG at 1305, GGAAG at 1264, CGAAA at 1179, GGAAG at 1153, CGAAA at 1095, GGAAG at 1069, GGAAG at 1012, GGAAG at 928, GGAAG at 828, GGAAG at 760, GGAAG at 733, GGAAG at 676, CGAAC at 654, GGAAG at 592, TGAAC at 526, AGAAT at 522, GGAAG at 456, GGAAA at 134, TGAAC at 129, AGAAA at 110.
  5. complement, negative strand, negative direction, looking for NCTTN, 93, CCTTA at 4553, TCTTG at 4450, TCTTT at 4394, TCTTT at 4389, TCTTT at 4382, TCTTT at 4085, TCTTT at 4081, TCTTC at 3936, ACTTT at 3922, CCTTC at 3909, ACTTG at 3783, CCTTG at 3723, CCTTA at 3677, TCTTG at 3667, CCTTT at 3663, CCTTC at 3610, TCTTT at 3591, ACTTT at 3507, CCTTG at 3459, TCTTC at 3407, TCTTT at 3376, TCTTT at 3342, ACTTG at 3244, TCTTA at 3235, ACTTT at 3146, TCTTA at 3002, CCTTT at 2967, CCTTT at 2957, CCTTT at 2926, TCTTT at 2838, TCTTT at 2831, TCTTC at 2828, TCTTT at 2821, TCTTT at 2814, TCTTC at 2811, TCTTT at 2804, TCTTT at 2800, ACTTT at 2746, CCTTC at 2730, ACTTG at 2716, ACTTA at 2707, ACTTT at 2619, ACTTC at 2595, CCTTC at 2557, TCTTT at 2505, CCTTT at 2458, ACTTG at 2381, TCTTA at 2372, ACTTT at 2282, GCTTT at 2157, TCTTT at 2055, ACTTG at 1955, TCTTA at 1946, ACTTT at 1855, CCTTA at 1693, CCTTG at 1684, CCTTT at 1676, CCTTT at 1660, TCTTC at 1655, CCTTT at 1642, TCTTT at 1630, ACTTT at 1625, ACTTT at 1582, GCTTC at 1555, TCTTG at 1551, TCTTA at 1520, TCTTA at 1413, ACTTG at 1302, TCTTA at 1293, ACTTT at 1212, ACTTG at 1011, TCTTA at 1002, ACTTG at 845, TCTTA at 836, GCTTT at 494, ACTTT at 473, ACTTC at 367, TCTTT at 357, CCTTC at 331, GCTTT at 312, TCTTT at 303, TCTTA at 291, TCTTG at 286, CCTTC at 241, TCTTT at 226, TCTTA at 196, TCTTT at 135, ACTTC at 132, ACTTT at 126, TCTTT at 102, CCTTC at 81, TCTTT at 52, ACTTA at 19.
  6. complement, negative strand, positive direction, looking for NCTTN, 64, TCTTG at 4388, TCTTT at 4382, CCTTG at 4299, CCTTC at 4241, CCTTT at 4207, TCTTG at 4130, CCTTC at 4061, ACTTG at 4015, GCTTC at 3994, CCTTT at 3945, TCTTT at 3397, TCTTC at 3394, CCTTG at 3373, CCTTC at 3312, TCTTC at 3247, TCTTC at 3057, ACTTC at 3031, CCTTG at 3001, ACTTC at 2947, CCTTA at 2763, ACTTG at 2741, TCTTT at 2585, CCTTC at 2582, ACTTG at 2418, TCTTA at 2364, ACTTC at 2361, TCTTT at 2278, ACTTT at 2273, GCTTT at 2163, ACTTC at 2107, GCTTC at 2095, TCTTT at 1981, ACTTC at 1914, TCTTA at 1886, CCTTT at 1830, CCTTG at 1798, ACTTT at 1746, CCTTT at 1599, GCTTG at 1578, TCTTA at 1537, CCTTC at 1516, CCTTC at 1432, CCTTC at 1405, CCTTC at 1332, CCTTC at 1305, CCTTC at 1264, GCTTT at 1179, CCTTC at 1153, GCTTT at 1095, CCTTC at 1069, CCTTC at 1012, CCTTC at 928, CCTTC at 828, CCTTC at 760, CCTTC at 733, CCTTC at 676, GCTTG at 654, CCTTC at 592, ACTTG at 526, TCTTA at 522, CCTTC at 456, CCTTT at 134, ACTTG at 129, TCTTT at 110.
  7. complement, positive strand, negative direction, looking for NCTTN, 52, TCTTC at 4528, ACTTT at 4461, TCTTA at 4406, GCTTG at 4293, ACTTG at 4267, GCTTG at 4187, ACTTA at 4162, ACTTG at 4011, ACTTT at 3984, TCTTG at 3792, GCTTC at 3776, CCTTG at 3570, TCTTC at 3553, GCTTG at 3400, ACTTG at 3241, ACTTG at 3102, ACTTT at 3075, ACTTT at 3018, GCTTA at 2935, ACTTG at 2920, GCTTG at 2713, ACTTG at 2579, ACTTT at 2552, GCTTG at 2378, ACTTT at 2216, ACTTG at 2126, ACTTT at 2099, GCTTG at 1972, ACTTG at 1926, ACTTT at 1790, TCTTT at 1733, ACTTT at 1687, TCTTG at 1648, ACTTG at 1618, TCTTG at 1606, ACTTA at 1545, TCTTT at 1418, ACTTG at 1299, ACTTT at 1145, ACTTC at 1053, GCTTG at 1008, GCTTG at 842, ACTTT at 681, CCTTC at 619, ACTTT at 545, ACTTT at 408, TCTTT at 347, ACTTG at 327, CCTTA at 317, TCTTG at 280, TCTTT at 47, TCTTT at 25.
  8. complement, positive strand, positive direction, looking for NCTTN, 62, CCTTG at 4443, CCTTC at 4263, CCTTC at 4248, TCTTC at 4197, ACTTT at 4091, TCTTG at 4067, TCTTG at 4047, ACTTG at 3936, ACTTT at 3926, TCTTT at 3918, CCTTC at 3871, CCTTG at 3855, TCTTC at 3851, ACTTG at 3837, TCTTA at 3833, CCTTT at 3794, ACTTA at 3780, CCTTC at 3762, CCTTC at 3667, ACTTT at 3596, CCTTA at 3565, ACTTA at 3443, CCTTA at 3439, CCTTA at 3365, TCTTC at 3216, CCTTT at 3165, TCTTG at 3093, TCTTA at 3067, ACTTT at 2917, TCTTA at 2839, CCTTT at 2831, CCTTC at 2784, TCTTG at 2775, CCTTC at 2748, TCTTA at 2723, TCTTT at 2629, CCTTT at 2623, CCTTG at 2578, TCTTA at 2241, TCTTG at 2224, TCTTC at 2192, ACTTT at 2146, TCTTG at 1950, TCTTG at 1810, TCTTC at 1633, CCTTC at 1594, TCTTA at 1418, TCTTA at 1318, TCTTC at 1231, CCTTT at 1089, TCTTC at 1063, ACTTC at 961, ACTTC at 861, GCTTC at 768, ACTTC at 727, TCTTC at 643, TCTTC at 559, GCTTG at 362, CCTTT at 290, ACTTC at 232, CCTTC at 209, TCTTC at 48.
  9. inverse complement, negative strand, negative direction, looking for NTTCN, 89, TTTCT at 4505, ATTCT at 4409, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, GTTCG at 4184, GTTCT at 4179, ATTCC at 4165, TTTCT at 4083, GTTCT at 4028, GTTCT at 4020, CTTCA at 3937, TTTCT at 3924, CTTCT at 3910, ATTCT at 3893, GTTCG at 3845, GTTCT at 3759, TTTCT at 3665, GTTCT at 3635, CTTCC at 3611, ATTCC at 3474, TTTCC at 3441, CTTCA at 3408, TTTCT at 3378, GTTCT at 3374, TTTCC at 3345, GTTCT at 3340, GTTCT at 3307, GTTCT at 3274, GTTCC at 3141, ATTCG at 3032, GTTCC at 2964, ATTCC at 2954, ATTCG at 2915, TTTCT at 2892, TTTCA at 2858, TTTCT at 2836, CTTCT at 2829, TTTCT at 2824, TTTCT at 2819, CTTCT at 2812, TTTCT at 2807, TTTCT at 2802, TTTCT at 2798, CTTCA at 2731, CTTCT at 2596, CTTCC at 2558, ATTCT at 2503, TTTCG at 2478, TTTCG at 2472, GTTCC at 2245, TTTCT at 2175, TTTCT at 2053, GTTCT at 2023, GTTCC at 1818, TTTCG at 1678, CTTCC at 1656, TTTCC at 1639, TTTCT at 1628, ATTCT at 1593, CTTCC at 1556, TTTCT at 1549, GTTCG at 1497, TTTCT at 1400, ATTCT at 1365, TTTCC at 1107, TTTCG at 944, GTTCT at 875, ATTCC at 818, GTTCC at 693, GTTCT at 557, GTTCG at 455, GTTCT at 420, CTTCT at 368, CTTCA at 332, ATTCA at 320, CTTCT at 242, TTTCT at 224, ATTCT at 194, TTTCG at 185, ATTCC at 176, TTTCG at 137, CTTCT at 133, GTTCC at 115, TTTCC at 105, TTTCC at 94, CTTCA at 82, GTTCC at 71, TTTCT at 55.
  10. inverse complement, negative strand, positive direction, looking for NTTCN, 60, TTTCT at 4384, CTTCC at 4242, GTTCA at 4201, GTTCT at 4074, CTTCT at 4062, CTTCA at 3995, GTTCC at 3625, CTTCT at 3395, GTTCC at 3352, CTTCT at 3313, CTTCA at 3248, ATTCT at 3074, CTTCT at 3058, CTTCA at 3032, GTTCT at 2955, CTTCT at 2948, GTTCA at 2934, GTTCT at 2923, TTTCA at 2646, CTTCT at 2583, CTTCT at 2362, TTTCA at 2302, TTTCT at 2276, TTTCA at 2264, ATTCC at 2208, ATTCT at 2180, TTTCT at 2165, CTTCA at 2108, CTTCA at 2096, GTTCT at 1988, TTTCT at 1979, GTTCG at 1927, CTTCG at 1915, TTTCG at 1750, TTTCA at 1601, CTTCG at 1517, GTTCG at 1490, CTTCC at 1433, CTTCG at 1406, GTTCG at 1390, CTTCC at 1333, CTTCG at 1306, CTTCA at 1265, TTTCG at 1181, CTTCG at 1154, TTTCC at 1097, CTTCC at 1070, CTTCG at 1013, CTTCA at 929, CTTCA at 829, CTTCG at 761, CTTCC at 734, CTTCC at 677, CTTCG at 593, GTTCA at 509, CTTCG at 457, GTTCC at 306, TTTCT at 137, ATTCT at 117, GTTCT at 108.
  11. inverse complement, positive strand, negative direction, looking for NTTCN, 27, ATTCC at 4543, CTTCA at 4529, GTTCT at 4418, GTTCA at 4176, GTTCA at 4025, CTTCC at 3777, TTTCC at 3689, CTTCT at 3554, ATTCA at 3518, ATTCG at 3501, ATTCT at 3317, TTTCA at 2885, ATTCG at 2453, TTTCT at 1604, ATTCT at 1523, ATTCT at 1416, TTTCA at 1381, GTTCA at 1178, CTTCA at 1054, GTTCG at 720, CTTCT at 620, ATTCC at 537, GTTCT at 345, GTTCA at 254, GTTCT at 45, TTTCT at 23, ATTCT at 7.
  12. inverse complement, positive strand, positive direction, looking for NTTCN, 61, CTTCT at 4264, CTTCC at 4249, CTTCA at 4198, TTTCT at 3929, TTTCA at 3920, CTTCT at 3872, CTTCC at 3852, CTTCG at 3763, CTTCG at 3668, TTTCG at 3598, CTTCG at 3217, TTTCT at 3065, TTTCC at 2919, TTTCC at 2828, ATTCT at 2790, CTTCG at 2785, CTTCG at 2749, TTTCA at 2709, GTTCC at 2693, ATTCA at 2664, GTTCA at 2616, GTTCA at 2594, TTTCG at 2536, GTTCA at 2509, ATTCC at 2457, GTTCG at 2399, CTTCG at 2193, GTTCT at 2190, ATTCC at 2085, TTTCG at 2005, GTTCT at 1948, CTTCG at 1634, CTTCG at 1595, ATTCG at 1540, GTTCA at 1526, GTTCC at 1511, GTTCC at 1427, GTTCC at 1327, GTTCC at 1259, CTTCG at 1232, TTTCC at 1091, CTTCG at 1064, GTTCC at 1007, CTTCT at 962, GTTCC at 923, CTTCT at 862, GTTCC at 823, CTTCG at 769, GTTCA at 755, CTTCG at 728, GTTCC at 671, CTTCG at 644, GTTCC at 587, CTTCG at 560, GTTCC at 503, GTTCG at 339, CTTCT at 233, CTTCC at 210, GTTCT at 178, ATTCC at 123, CTTCT at 49.
  13. inverse negative strand, negative direction, looking for NAAGN, 27, TAAGG at 4543, GAAGT at 4529, CAAGA at 4418, CAAGT at 4176, CAAGT at 4025, GAAGG at 3777, AAAGG at 3689, GAAGA at 3554, TAAGT at 3518, TAAGC at 3501, TAAGA at 3317, AAAGT at 2885, TAAGC at 2453, AAAGA at 1604, TAAGA at 1523, TAAGA at 1416, AAAGT at 1381, CAAGT at 1178, GAAGT at 1054, CAAGC at 720, GAAGA at 620, TAAGG at 537, CAAGA at 345, CAAGT at 254, CAAGA at 45, AAAGA at 23, TAAGA at 7.
  14. inverse negative strand, positive direction, looking for NAAGN, 61, GAAGA at 4264, GAAGG at 4249, GAAGT at 4198, AAAGA at 3929, AAAGT at 3920, GAAGA at 3872, GAAGG at 3852, GAAGC at 3763, GAAGC at 3668, AAAGC at 3598, GAAGC at 3217, AAAGA at 3065, AAAGG at 2919, AAAGG at 2828, TAAGA at 2790, GAAGC at 2785, GAAGC at 2749, AAAGT at 2709, CAAGG at 2693, TAAGT at 2664, CAAGT at 2616, CAAGT at 2594, AAAGC at 2536, CAAGT at 2509, TAAGG at 2457, CAAGC at 2399, GAAGC at 2193, CAAGA at 2190, TAAGG at 2085, AAAGC at 2005, CAAGA at 1948, GAAGC at 1634, GAAGC at 1595, TAAGC at 1540, CAAGT at 1526, CAAGG at 1511, CAAGG at 1427, CAAGG at 1327, CAAGG at 1259, GAAGC at 1232, AAAGG at 1091, GAAGC at 1064, CAAGG at 1007, GAAGA at 962, CAAGG at 923, GAAGA at 862, CAAGG at 823, GAAGC at 769, CAAGT at 755, GAAGC at 728, CAAGG at 671, GAAGC at 644, CAAGG at 587, GAAGC at 560, CAAGG at 503, CAAGC at 339, GAAGA at 233, GAAGG at 210, CAAGA at 178, TAAGG at 123, GAAGA at 490.
  15. inverse positive strand, negative direction, looking for NAAGN, 89, AAAGA at 4505, TAAGA at 4409, AAAGA at 4392, AAAGA at 4387, AAAGA at 4380, CAAGC at 4184, CAAGA at 4179, TAAGG at 4165, AAAGA at 4083, CAAGA at 4028, CAAGA at 4020, GAAGT at 3937, AAAGA at 3924, GAAGA at 3910, TAAGA at 3893, CAAGC at 3845, CAAGA at 3759, AAAGA at 3665, CAAGA at 3635, GAAGG at 3611, TAAGG at 3474, AAAGG at 3441, GAAGT at 3408, AAAGA at 3378, CAAGA at 3374, AAAGG at 3345, CAAGA at 3340, CAAGA at 3307, CAAGA at 3274, CAAGG at 3141, TAAGC at 3032, CAAGG at 2964, TAAGG at 2954, TAAGC at 2915, AAAGA at 2892, AAAGT at 2858, AAAGA at 2836, GAAGA at 2829, AAAGA at 2824, AAAGA at 2819, GAAGA at 2812, AAAGA at 2807, AAAGA at 2802, AAAGA at 2798, GAAGT at 2731, GAAGA at 2596, GAAGG at 2558, TAAGA at 2503, AAAGC at 2478, AAAGC at 2472, CAAGG at 2245, AAAGA at 2175, AAAGA at 2053, CAAGA at 2023, CAAGG at 1818, AAAGC at 1678, GAAGG at 1656, AAAGG at 1639, AAAGA at 1628, TAAGA at 1593, GAAGG at 1556, AAAGA at 1549, CAAGC at 1497, AAAGA at 1400, TAAGA at 1365, AAAGG at 1107, AAAGC at 944, CAAGA at 875, TAAGG at 818, CAAGG at 693, CAAGA at 557, CAAGC at 455, CAAGA at 420, GAAGA at 368, GAAGT at 332, TAAGT at 320, GAAGA at 242, AAAGA at 224, TAAGA at 194, AAAGC at 185, TAAGG at 176, AAAGC at 137, GAAGA at 133, CAAGG at 115, AAAGG at 105, AAAGG at 94, GAAGT at 82, CAAGG at 71, AAAGA at 55.
  16. inverse positive strand, positive direction, looking for NAAGN, 60, AAAGA at 4384, GAAGG at 4242, CAAGT at 4201, CAAGA at 4074, GAAGA at 4062, GAAGT at 3995, CAAGG at 3625, GAAGA at 3395, CAAGG at 3352, GAAGA at 3313, GAAGT at 3248, TAAGA at 3074, GAAGA at 3058, GAAGT at 3032, CAAGA at 2955, GAAGA at 2948, CAAGT at 2934, CAAGA at 2923, AAAGT at 2646, GAAGA at 2583, GAAGA at 2362, AAAGT at 2302, AAAGA at 2276, AAAGT at 2264, TAAGG at 2208, TAAGA at 2180, AAAGA at 2165, GAAGT at 2108, GAAGT at 2096, CAAGA at 1988, AAAGA at 1979, CAAGC at 1927, GAAGC at 1915, AAAGC at 1750, AAAGT at 1601, GAAGC at 1517, CAAGC at 1490, GAAGG at 1433, GAAGC at 1406, CAAGC at 1390, GAAGG at 1333, GAAGC at 1306, GAAGT at 1265, AAAGC at 1181, GAAGC at 1154, AAAGG at 1097, GAAGG at 1070, GAAGC at 1013, GAAGT at 929, GAAGT at 829, GAAGC at 761, GAAGG at 734, GAAGG at 677, GAAGC at 593, CAAGT at 509, GAAGC at 457, CAAGG at 306, AAAGA at 137, TAAGA at 117, CAAGA at 108.

Hsf core promoters

Main article: Core promoter gene transcriptions

Negative strand, negative direction: AGAAG at 4528, TTTCT at 4505, TGAAA at 4461, and complements.

Positive strand, negative direction: GGAAT at 4553, ATTCC at 4543, CTTCA at 4529, AGAAC at 4450, GTTCT at 4418, and complements.

Negative strand, positive direction: GGAAC at 4443, TTTCT at 4384, and complements.

Positive strand, positive direction: AGAAC at 4388, AGAAA at 4382, GGAAC at 4299, CTTCT at 4264, and complements.

Hsf proximal promoters

Main article: Proximal promoter gene transcriptions

Negative strand, negative direction: ATTCT at 4409, AGAAT at 4406, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, CGAAC at 4293, TGAAC at 4267, and complements.

Positive strand, negative direction: GTTCT at 4418, AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, and complements.

Negative strand, positive direction: TTTCT at 4384, GGAAG at 4263, GGAAG at 4248, CTTCC at 4242, AGAAG at 4197, TGAAA at 4091, AGAAC at 4067, and complements.

Positive strand, positive direction: CTTCT at 4264, CTTCC at 4249, GGAAG at 4241, GGAAA at 4207, CTTCA at 4198, AGAAC at 4130, GGAAG at 4061, and complements.

Hsf distal promoters

Main article: Distal promoter gene transcriptions

Negative strand, negative direction: CGAAC at 4187, GTTCG at 4184, GTTCT at 4179, ATTCC at 4165, TGAAT at 4162, TTTCT at 4083, GTTCT at 4028, GTTCT at 4020, TGAAC at 4011, TGAAA at 3984, CTTCA at 3937, TTTCT at 3924, CTTCT at 3910, ATTCT at 3893, GTTCG at 3845, AGAAC at 3792, CGAAG at 3776, GTTCT at 3759, TTTCT at 3665, GTTCT at 3635, CTTCC at 3611, GGAAC at 3570, AGAAG at 3553, ATTCC at 3474, TTTCC at 3441, CTTCA at 3408, CGAAC at 3400, TTTCT at 3378, GTTCT at 3374, TTTCC at 3345, GTTCT at 3340, GTTCT at 3307, GTTCT at 3274, TGAAC at 3241, GTTCC at 3141, TGAAC at 3102, TGAAA at 3075, ATTCG at 3032, TGAAA at 3018, GTTCC at 2964, ATTCC at 2954, CGAAT at 2935, TGAAC at 2920, ATTCG at 2915, TTTCT at 2892, TTTCA at 2858, TTTCT at 2836, CTTCT at 2829, TTTCT at 2824, TTTCT at 2819, CTTCT at 2812, TTTCT at 2807, TTTCT at 2802, TTTCT at 2798, CTTCA at 2731, CGAAC at 2713, CTTCT at 2596, TGAAC at 2579, CTTCC at 2558, TGAAA at 2552, ATTCT at 2503, TTTCG at 2478, TTTCG at 2472, CGAAC at 2378, GTTCC at 2245, TGAAA at 2216, TTTCT at 2175, TGAAC at 2126, TGAAA at 2099, TTTCT at 2053, GTTCT at 2023, CGAAC at 1972, TGAAC at 1926, GTTCC at 1818, TGAAA at 1790, AGAAA at 1733, TGAAA at 1687, TTTCG at 1678, CTTCC at 1656, AGAAC at 1648, TTTCC at 1639, TTTCT at 1628, TGAAC at 1618, AGAAC at 1606, ATTCT at 1593, CTTCC at 1556, TTTCT at 1549, TGAAT at 1545, GTTCG at 1497, AGAAA at 1418, TTTCT at 1400, ATTCT at 1365, TGAAC at 1299, TGAAA at 1145, TTTCC at 1107, TGAAG at 1053, CGAAC at 1008, TTTCG at 944, GTTCT at 875, CGAAC at 842, ATTCC at 818, GTTCC at 693, TGAAA at 681, GGAAG at 619, GTTCT at 557, TGAAA at 545, GTTCG at 455, GTTCT at 420, TGAAA at 408, CTTCT at 368, AGAAA at 347, CTTCA at 332, TGAAC at 327, ATTCA at 320, GGAAT at 317, AGAAC at 280, CTTCT at 242, TTTCT at 224, ATTCT at 194, TTTCG at 185, ATTCC at 176, TTTCG at 137, CTTCT at 133, GTTCC at 115, TTTCC at 105, TTTCC at 94, CTTCA at 82, GTTCC at 71, TTTCT at 55, AGAAA at 47, AGAAA at 25, and complements.

Positive strand, negative direction: GTTCA at 4176, AGAAA at 4085, AGAAA at 4081, GTTCA at 4025, AGAAG at 3936, TGAAA at 3922, GGAAG at 3909, TGAAC at 3783, CTTCC at 3777, GGAAC at 3723, TTTCC at 3689, GGAAT at 3677, AGAAC at 3667, GGAAA at 3663, GGAAG at 3610, AGAAA at 3591, CTTCT at 3554, ATTCA at 3518, TGAAA at 3507, ATTCG at 3501, GGAAC at 3459, AGAAG at 3407, AGAAA at 3376, AGAAA at 3342, ATTCT at 3317, TGAAC at 3244, AGAAT at 3235, TGAAA at 3146, AGAAT at 3002, GGAAA at 2967, GGAAA at 2957, GGAAA at 2926, TTTCA at 2885, AGAAA at 2838, AGAAA at 2831, AGAAG at 2828, AGAAA at 2821, AGAAA at 2814, AGAAG at 2811, AGAAA at 2804, AGAAA at 2800, TGAAA at 2746, GGAAG at 2730, TGAAC at 2716, TGAAT at 2707, TGAAA at 2619, TGAAG at 2595, GGAAG at 2557, AGAAA at 2505, GGAAA at 2458, ATTCG at 2453, TGAAC at 2381, AGAAT at 2372, TGAAA at 2282, CGAAA at 2157, AGAAA at 2055, TGAAC at 1955, AGAAT at 1946, TGAAA at 1855, GGAAT at 1693, GGAAC at 1684, GGAAA at 1676, GGAAA at 1660, AGAAG at 1655, GGAAA at 1642, AGAAA at 1630, TGAAA at 1625, TTTCT at 1604, TGAAA at 1582, CGAAG at 1555, AGAAC at 1551, ATTCT at 1523, AGAAT at 1520, ATTCT at 1416, AGAAT at 1413, TTTCA at 1381, TGAAC at 1302, AGAAT at 1293, TGAAA at 1212, GTTCA at 1178, CTTCA at 1054, TGAAC at 1011, AGAAT at 1002, TGAAC at 845, AGAAT at 836, GTTCG at 720, CTTCT at 620, ATTCC at 537, CGAAA at 494, TGAAA at 473, TGAAG at 367, AGAAA at 357, GTTCT at 345, GGAAG at 331, CGAAA at 312, AGAAA at 303, AGAAT at 291, AGAAC at 286, GTTCA at 254, GGAAG at 241, AGAAA at 226, AGAAT at 196, AGAAA at 135, TGAAG at 132, TGAAA at 126, AGAAA at 102, GGAAG at 81, AGAAA at 52, GTTCT at 45, TTTCT at 23, TGAAT at 19, ATTCT at 7 and complements.

Negative strand, positive direction: GTTCA at 4201, GTTCT at 4074, CTTCT at 4062, AGAAC at 4047, CTTCA at 3995, TGAAC at 3936, TGAAA at 3926, AGAAA at 3918, GGAAG at 3871, GGAAC at 3855, AGAAG at 3851, TGAAC at 3837, AGAAT at 3833, GGAAA at 3794, TGAAT at 3780, GGAAG at 3762, GGAAG at 3667, GTTCC at 3625, TGAAA at 3596, GGAAT at 3565, TGAAT at 3443, GGAAT at 3439, CTTCT at 3395, GGAAT at 3365, GTTCC at 3352, CTTCT at 3313, CTTCA at 3248, AGAAG at 3216, GGAAA at 3165, AGAAC at 3093, ATTCT at 3074, AGAAT at 3067, CTTCT at 3058, CTTCA at 3032, GTTCT at 2955, CTTCT at 2948, GTTCA at 2934, GTTCT at 2923, TGAAA at 2917, AGAAT at 2839, GGAAA at 2831, GGAAG at 2784, AGAAC at 2775, GGAAG at 2748, AGAAT at 2723, TTTCA at 2646, AGAAA at 2629, GGAAA at 2623, CTTCT at 2583, GGAAC at 2578, CTTCT at 2362, TTTCA at 2302, TTTCT at 2276, TTTCA at 2264, AGAAT at 2241, AGAAC at 2224, ATTCC at 2208, AGAAG at 2192, ATTCT at 2180, TTTCT at 2165, TGAAA at 2146, CTTCA at 2108, CTTCA at 2096, GTTCT at 1988, TTTCT at 1979, AGAAC at 1950, GTTCG at 1927, CTTCG at 1915, AGAAC at 1810, TTTCG at 1750, AGAAG at 1633, TTTCA at 1601, GGAAG at 1594, CTTCG at 1517, GTTCG at 1490, CTTCC at 1433, AGAAT at 1418, CTTCG at 1406, GTTCG at 1390, CTTCC at 1333, AGAAT at 1318, CTTCG at 1306, CTTCA at 1265, AGAAG at 1231, TTTCG at 1181, CTTCG at 1154, TTTCC at 1097, GGAAA at 1089, CTTCC at 1070, AGAAG at 1063, CTTCG at 1013, TGAAG at 961, CTTCA at 929, TGAAG at 861, CTTCA at 829, CGAAG at 768, CTTCG at 761, CTTCC at 734, TGAAG at 727, CTTCC at 677, AGAAG at 643, CTTCG at 593, AGAAG at 559, GTTCA at 509, CTTCG at 457, CGAAC at 362, GTTCC at 306, GGAAA at 290, TGAAG at 232, GGAAG at 209, TTTCT at 137, ATTCT at 117, GTTCT at 108, AGAAG at 48, and complements.

Positive strand, positive direction: TGAAC at 4015, CGAAG at 3994, GGAAA at 3945, TTTCT at 3929, TTTCA at 3920, CTTCT at 3872, CTTCC at 3852, CTTCG at 3763, CTTCG at 3668, TTTCG at 3598, AGAAA at 3397, AGAAG at 3394, GGAAC at 3373, GGAAG at 3312, AGAAG at 3247, CTTCG at 3217, TTTCT at 3065, AGAAG at 3057, TGAAG at 3031, GGAAC at 3001, TGAAG at 2947, TTTCC at 2919, TTTCC at 2828, ATTCT at 2790, CTTCG at 2785, GGAAT at 2763, CTTCG at 2749, TGAAC at 2741, TTTCA at 2709, GTTCC at 2693, ATTCA at 2664, GTTCA at 2616, GTTCA at 2594, AGAAA at 2585, GGAAG at 2582, TTTCG at 2536, GTTCA at 2509, ATTCC at 2457, TGAAC at 2418, GTTCG at 2399, AGAAT at 2364, TGAAG at 2361, AGAAA at 2278, TGAAA at 2273, CTTCG at 2193, GTTCT at 2190, CGAAA at 2163, TGAAG at 2107, CGAAG at 2095, ATTCC at 2085, TTTCG at 2005, AGAAA at 1981, GTTCT at 1948, TGAAG at 1914, AGAAT at 1886, GGAAA at 1830, GGAAC at 1798, TGAAA at 1746, CTTCG at 1634, GGAAA at 1599, CTTCG at 1595, CGAAC at 1578, ATTCG at 1540, AGAAT at 1537, GTTCA at 1526, GGAAG at 1516, GTTCC at 1511, GGAAG at 1432, GTTCC at 1427, GGAAG at 1405, GGAAG at 1332, GTTCC at 1327, GGAAG at 1305, GGAAG at 1264, GTTCC at 1259, CTTCG at 1232, CGAAA at 1179, GGAAG at 1153, CGAAA at 1095, TTTCC at 1091, GGAAG at 1069, CTTCG at 1064, GGAAG at 1012, GTTCC at 1007, CTTCT at 962, GGAAG at 928, GTTCC at 923, CTTCT at 862, GGAAG at 828, GTTCC at 823, CTTCG at 769, GGAAG at 760, GTTCA at 755, GGAAG at 733, CTTCG at 728, GGAAG at 676, GTTCC at 671, CGAAC at 654, CTTCG at 644, GGAAG at 592, GTTCC at 587, CTTCG at 560, TGAAC at 526, AGAAT at 522, GTTCC at 503, GGAAG at 456, GTTCG at 339, CTTCT at 233, CTTCC at 210, GTTCT at 178, GGAAA at 134, TGAAC at 129, ATTCC at 123, AGAAA at 110, CTTCT at 49, and complements.

HSE1 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAnnTTCnnGAAn (starting with SuccessablesHSE1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAnnTTCnnGAAn, 0.
  2. negative strand, positive direction, looking for nGAAnnTTCnnGAAn, 0.
  3. positive strand, negative direction, looking for nGAAnnTTCnnGAAn, 0.
  4. positive strand, positive direction, looking for nGAAnnTTCnnGAAn, 0.
  5. complement, negative strand, negative direction, looking for nCTTnnAAGnnCTTn, 0.
  6. complement, negative strand, positive direction, looking for nCTTnnAAGnnCTTn, 0.
  7. complement, positive strand, negative direction, looking for nCTTnnAAGnnCTTn, 0.
  8. complement, positive strand, positive direction, looking for nCTTnnAAGnnCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCnnGAAnnTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCnnGAAnnTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCnnGAAnnTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCnnGAAnnTTCn, 0.
  13. inverse negative strand, negative direction, looking for nAAGnnCTTnnAAGn, 0.
  14. inverse negative strand, positive direction, looking for nAAGnnCTTnnAAGn, 0.
  15. inverse positive strand, negative direction, looking for nAAGnnCTTnnAAGn, 0.
  16. inverse positive strand, positive direction, looking for nAAGnnCTTnnAAGn, 0.

HSE2 (Eastmond) samplings

For the Basic programs testing consensus sequence nTTCnnGAAnnTTCn (starting with SuccessablesHSE2.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found: HSE2 is the inverse complement of HSE1.

HSE3 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAn-(5-bp)-nGAAnnTTCn (starting with SuccessablesHSE3.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 1, GGAATTCACATGAACCTTCA at 332.
  2. negative strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  3. positive strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  4. positive strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  5. complement, negative strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  6. complement, negative strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  7. complement, positive strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 1, CCTTAAGTGTACTTGGAAGT at 332.
  8. complement, positive strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  9. inverse complement, negative strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  13. inverse negative strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  14. inverse negative strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  15. inverse positive strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  16. inverse positive strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.

HSE3 distal promoters

Main article: Distal promoter gene transcriptions

Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332, and complement.

HSE4 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn (starting with SuccessablesHSE4.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn, 0.
  2. negative strand, positive direction, looking for nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn, 0.
  3. positive strand, negative direction, looking for nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn, 1, AGAAGAAAAAAGAAAAGAGAAGAAA at 2831.
  4. positive strand, positive direction, looking for nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn, 0.
  5. complement, negative strand, negative direction, looking for nCTTn-(5-bp)-nCTTn-(5-bp)-nCTTn, 1, TCTTCTTTTTTCTTTTCTCTTCTTT at 2831.
  6. complement, negative strand, positive direction, looking for nCTTn-(5-bp)-nCTTn-(5-bp)-nCTTn, 0.
  7. complement, positive strand, negative direction, looking for nCTTn-(5-bp)-nCTTn-(5-bp)-nCTTn, 0.
  8. complement, positive strand, positive direction, looking for nCTTn-(5-bp)-nCTTn-(5-bp)-nCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCn-(5-bp)-nTTCn-(5-bp)-nTTCn, 0.
  13. inverse negative strand, negative direction, looking for nAAGn-(5-bp)-nAAGn-(5-bp)-nAAGn, 0.
  14. inverse negative strand, positive direction, looking for nAAGn-(5-bp)-nAAGn-(5-bp)-nAAGn, 0.
  15. inverse positive strand, negative direction, looking for nAAGn-(5-bp)-nAAGn-(5-bp)-nAAGn, 0.
  16. inverse positive strand, positive direction, looking for nAAGn-(5-bp)-nAAGn-(5-bp)-nAAGn, 0.

HSE4 distal promoters

Main article: Distal promoter gene transcriptions

Positive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831, and complement.

HSE5 (Eastmond) samplings

For the Basic programs testing consensus sequence nTTCn-(5-bp)-nTTCnnGAAn (starting with SuccessablesHSE5.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nTTCn-(5-bp)-nTTCnnGAAn, 0.
  2. negative strand, positive direction, looking for AAAAAAAA, 0.
  3. positive strand, negative direction, looking for AAAAAAAA, 0.
  4. positive strand, positive direction, looking for AAAAAAAA, 0.
  5. complement, negative strand, negative direction, looking for TTTTTTTT, 0.
  6. complement, negative strand, positive direction, looking for TTTTTTTT, 0.
  7. complement, positive strand, negative direction, looking for TTTTTTTT, 0.
  8. complement, positive strand, positive direction, looking for TTTTTTTT, 0.
  9. inverse complement, negative strand, negative direction, looking for TTTTTTTT, 0.
  10. inverse complement, negative strand, positive direction, looking for TTTTTTTT, 0.
  11. inverse complement, positive strand, negative direction, looking for TTTTTTTT, 0.
  12. inverse complement, positive strand, positive direction, looking for TTTTTTTT, 0.
  13. inverse negative strand, negative direction, looking for AAAAAAAA, 0.
  14. inverse negative strand, positive direction, looking for AAAAAAAA, 0.
  15. inverse positive strand, negative direction, looking for AAAAAAAA, 0.
  16. inverse positive strand, positive direction, looking for AAAAAAAA, 0.

HSE5 core promoters

Main article: Core promoter gene transcriptions

HSE5 proximal promoters

Main article: Proximal promoter gene transcriptions

HSE5 distal promoters

Main article: Distal promoter gene transcriptions

HSE6 (Eastmond) samplings

For the Basic programs testing consensus sequence nTTCn-nnGAAn-(5-bp)-nGAAn (starting with SuccessablesAAA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for AAAAAAAA, 0.
  2. negative strand, positive direction, looking for AAAAAAAA, 0.
  3. positive strand, negative direction, looking for AAAAAAAA, 0.
  4. positive strand, positive direction, looking for AAAAAAAA, 0.
  5. complement, negative strand, negative direction, looking for TTTTTTTT, 0.
  6. complement, negative strand, positive direction, looking for TTTTTTTT, 0.
  7. complement, positive strand, negative direction, looking for TTTTTTTT, 0.
  8. complement, positive strand, positive direction, looking for TTTTTTTT, 0.
  9. inverse complement, negative strand, negative direction, looking for TTTTTTTT, 0.
  10. inverse complement, negative strand, positive direction, looking for TTTTTTTT, 0.
  11. inverse complement, positive strand, negative direction, looking for TTTTTTTT, 0.
  12. inverse complement, positive strand, positive direction, looking for TTTTTTTT, 0.
  13. inverse negative strand, negative direction, looking for AAAAAAAA, 0.
  14. inverse negative strand, positive direction, looking for AAAAAAAA, 0.
  15. inverse positive strand, negative direction, looking for AAAAAAAA, 0.
  16. inverse positive strand, positive direction, looking for AAAAAAAA, 0.

AAA core promoters

Main article: Core promoter gene transcriptions

AAA proximal promoters

Main article: Proximal promoter gene transcriptions

AAA distal promoters

Main article: Distal promoter gene transcriptions

HSE7 PFT1 (Eastmond) samplings

For the Basic programs testing consensus sequence nGARnnTTCnnGAAn (starting with SuccessablesHSE1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAnnTTCnnGAAn, 0.
  2. negative strand, positive direction, looking for nGAAnnTTCnnGAAn, 0.
  3. positive strand, negative direction, looking for nGAAnnTTCnnGAAn, 0.
  4. positive strand, positive direction, looking for nGAAnnTTCnnGAAn, 0.
  5. complement, negative strand, negative direction, looking for nCTTnnAAGnnCTTn, 0.
  6. complement, negative strand, positive direction, looking for nCTTnnAAGnnCTTn, 0.
  7. complement, positive strand, negative direction, looking for nCTTnnAAGnnCTTn, 0.
  8. complement, positive strand, positive direction, looking for nCTTnnAAGnnCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCnnGAAnnTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCnnGAAnnTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCnnGAAnnTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCnnGAAnnTTCn, 0.
  13. inverse negative strand, negative direction, looking for nAAGnnCTTnnAAGn, 0.
  14. inverse negative strand, positive direction, looking for nAAGnnCTTnnAAGn, 0.
  15. inverse positive strand, negative direction, looking for nAAGnnCTTnnAAGn, 0.
  16. inverse positive strand, positive direction, looking for nAAGnnCTTnnAAGn, 0.

HSE7 PFT2 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAnnTTCnnGARn (starting with SuccessablesHSE1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAnnTTCnnGAAn, 0.
  2. negative strand, positive direction, looking for nGAAnnTTCnnGAAn, 0.
  3. positive strand, negative direction, looking for nGAAnnTTCnnGAAn, 0.
  4. positive strand, positive direction, looking for nGAAnnTTCnnGAAn, 0.
  5. complement, negative strand, negative direction, looking for nCTTnnAAGnnCTTn, 0.
  6. complement, negative strand, positive direction, looking for nCTTnnAAGnnCTTn, 0.
  7. complement, positive strand, negative direction, looking for nCTTnnAAGnnCTTn, 0.
  8. complement, positive strand, positive direction, looking for nCTTnnAAGnnCTTn, 0.
  9. inverse complement, negative strand, negative direction, looking for nTTCnnGAAnnTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nTTCnnGAAnnTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nTTCnnGAAnnTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nTTCnnGAAnnTTCn, 0.
  13. inverse negative strand, negative direction, looking for nAAGnnCTTnnAAGn, 0.
  14. inverse negative strand, positive direction, looking for nAAGnnCTTnnAAGn, 0.
  15. inverse positive strand, negative direction, looking for nAAGnnCTTnnAAGn, 0.
  16. inverse positive strand, positive direction, looking for nAAGnnCTTnnAAGn, 0.

HSE8 GAP1 (Eastmond) samplings

For the Basic programs testing consensus sequence nGARn-(5-bp)-nGAAnnTTCn (starting with SuccessablesHSE3.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 1, GGAATTCACATGAACCTTCA at 332.
  2. negative strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  3. positive strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  4. positive strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  5. complement, negative strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  6. complement, negative strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  7. complement, positive strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 1, CCTTAAGTGTACTTGGAAGT at 332.
  8. complement, positive strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  9. inverse complement, negative strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  13. inverse negative strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  14. inverse negative strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  15. inverse positive strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  16. inverse positive strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.

HSE9 GAP2 (Eastmond) samplings

For the Basic programs testing consensus sequence nGAAn-(5-bp)-nGARnnTTCn (starting with SuccessablesHSE3.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 1, GGAATTCACATGAACCTTCA at 332.
  2. negative strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  3. positive strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  4. positive strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  5. complement, negative strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  6. complement, negative strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  7. complement, positive strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 1, CCTTAAGTGTACTTGGAAGT at 332.
  8. complement, positive strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  9. inverse complement, negative strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  13. inverse negative strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  14. inverse negative strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  15. inverse positive strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  16. inverse positive strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.

HSE10 (Eastmond) samplings

For the Basic programs testing consensus sequence nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn (starting with SuccessablesHSE3.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 1, GGAATTCACATGAACCTTCA at 332.
  2. negative strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  3. positive strand, negative direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  4. positive strand, positive direction, looking for nGAAn-(5-bp)-nGAAnnTTCn, 0.
  5. complement, negative strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  6. complement, negative strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  7. complement, positive strand, negative direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 1, CCTTAAGTGTACTTGGAAGT at 332.
  8. complement, positive strand, positive direction, looking for nCTTn-(5-bp)-nCTTnnAAGn, 0.
  9. inverse complement, negative strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  10. inverse complement, negative strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  11. inverse complement, positive strand, negative direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  12. inverse complement, positive strand, positive direction, looking for nGAAnnTTCn-(5-bp)-nTTCn, 0.
  13. inverse negative strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  14. inverse negative strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  15. inverse positive strand, negative direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.
  16. inverse positive strand, positive direction, looking for nCTTnnAAGn-(5-bp)-nAAGn, 0.

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

See also

References

  1. ↑ 1.0 1.1 1.2 1.3 1.4 1.5 1.6 Dawn L. Eastmond and Hillary C. M. Nelson (October 27, 2006). "Genome-wide Analysis Reveals New Roles for the Activation Domains of the Saccharomyces cerevisiae Heat Shock Transcription Factor (Hsf1) during the Transient Heat Shock Response". Journal of Biological Chemistry. 281 (43): P32909–32921. doi:10.1074/jbc.M602454200. Retrieved 19 January 2021.
  2. ↑ Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.

External links

Retrieved from "https://www.wikidoc.org/index.php?title=Hsf1p_gene_transcriptions&oldid=1684788"