A1BG response element gene transcriptions: Difference between revisions

Revision as of 05:47, 22 August 2021

Associate Editor(s)-in-Chief: Henry A. Hoff

Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"^[1] are called response elements.

Hypotheses

A1BG has no response elements in either promoter.
A1BG is not transcribed by a response element.
Each response element does not participate in the transcription of A1BG.

Response element testing

Response element
Name of elements	Consensus sequences	Testing	Notes
Abbreviations	Variations	Present (Y), Absent (N)	Response element class
Authors			Random or likely active
1. ABA responsive elements (ABREs)	ACGTG(G/T)C	Y	WD-40 repeat family, random or likely?
2. novel ABA-response elements (ABREN, novel ABRE)	GATCGATC, CGATCGAT, GATCGAT	N	ABREN, CGATCGAT motif, and core of ABREN and CGATCGAT motif.^[2]
3. ABA-response element-like (ABRE-like)	ACGTGTCC	N	third highest scoring motif.^[2]
4. Activated B-cell Factor-1s (ABFs)	CGTNNNNN(A/G)(C/T)GA(C/T)	Y	all three regulatory factors are in the distal promoters, General Regulatory Factors, Likely
5. Abf1 regulatory factors	CGTCCTCTACGAT	N	CGTNNNNNACGAT.^[3]
6. A boxes	TACGTA	Y	Basic leucine zipper (bZIP), random or likely?
7. boxes A	TGACTCT	Y	bZIP, random or likely?
8. Abscisic acid-responsive elements (Pho4s), G boxes	CACGTG.^[4]	Y	bZIP, Basic helix-loop-helix (bHLH), random or likely?
9. ACGT-containing elements	ACGT	Y	bZIP, random or likely?
10. Activating protein 2 (AP2) (Cohen)	GCCTGGCC	Y	Basic helix-span-helix (bHSH), random or likely?
11. Activating protein 2 (Cohen)	TCCCCCGCCC	Y	bHSH, random or likely?
12. Activating protein 2 (Murata)	(C/G)CCN(3,4)GG(C/G)	Y	bHSH, random or likely?
13. Activating proteins (Murata)	GCCCACGGG	N	Activating protein 2.^[5]
14. Activating protein 2 (Yao)	TCTTCCC	Y	bHSH, random or likely?
15. Activating protein 2 (Yao)	CTCCCA	Y	bHSH, random or likely?
16. Activating proteins (AP-2) (Yao)	GGCCAA	N	Activating protein 2 (AP-2).^[6]
17. Activating transcription factors (Burton)	(A/C/G)TT(A/G/T)C(A/G)TCA	Y	bZIP, random or likely?
18. Activating transcription factors (Kilberg)	(A/G/T)TT(A/G/T)CATCA	Y	bZIP, random or likely?
19. Adenylate–uridylate rich elements (Bakheet)	(A/T)(A/T)(A/T)TATTTAT(A/T)(A/T)	Y	bZIP, random or likely?, Negative strand, negative direction: TTTTATTTATTA at 4076
20. Adr1ps	TTGG(A/G)G	Y	random or likely?, Saccharomyces cerevisiae
21. Aft1s	(C/T)(A/G)CACCC(A/G)	Y	random or likely?, Saccharomyces cerevisiae
22. AGC boxes	AGCCGCC	Y	random or likely?, Arabidopsis thaliana
23. AhR responsive element (AHRE-II)	CATGN₆C(A/T)TG	Y	bHLH, random or likely?
24. AhR-responsive elements (AHRE) (Yao)	(G/T)NGCGTG(A/C)(C/G)A	N	in the promoter region of AhR responsive genes
25. Alpha-amylase conserved elements	TATCCA	N	TATCCATCCATCC.^[7]
26. Amino acid response elements (AARE) (Maruyama)	ATTGCATCA	N	AARE1 (ATTGCATCA)^[8]
27. Amino acid response elements (AARE) (Broer)	TTTGCATCA	N	TTTGCATCA.^[9]^[10]
28. Amino acid response element-like (AARE-like)	TGGTGAAAG	N	AARE-like sequence (TGGTGAAAG, named AARE3).^[8]
29. Androgen response elements (AREs) (Kouhpayeh)	GGTACANNNTGTTCT	N	GGTACACGGTGTTCT.^[11]
30. Androgen response elements (Kouhpayeh)	GGTACAnnnTGTTCT	Y	Zinc finger DNA-binding domain, random or likely?, Nuclear receptor, Positive strand: TGTTCT at 45, Negative strand: TGTTCT at 108 Positive strand: GGTACA at 3901, GGTACA at 3336, GGTACA at 2474
31. Androgen response elements (Wilson)	AGAACANNNTGTTCT.^[12]	Y	Zinc finger DNA-binding domain, random or likely?, Nuclear receptor, Negative strand: TGTTCT at 3759, TGTTCT at 3635, TGTTCT at 3340, TGTTCT at 3307; AGAACA at 4068, AGAACA at 3094, TGTTCT at 108, AGAACA at 281 Positive strand: AGAACA at 3668, AGAACA at 287, TGTTCT at 45
32. Androgen response elements (AREs) (Wilson)	TGATTCGTGAG	N	AGAACANNNTGTTCT.^[12]
33. Antioxidant-electrophile responsive elements (Lacher)	GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A	Y	bHLH, random or likely?
34. Antioxidant-electrophile responsive elements (Otsuki)	GTGAGGTCGC	N	GTGAGGTCGC.^[13] or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A^[14], an antioxidant response element (ARE)
35. ATA boxes	AATAAA	Y	random or likely?
36. ATTTA elements (Siegel)	ATTTA	Y	random or likely?, Positive strand, negative direction: ATTTA at 4535
37. Auxin response factors (Stigliani)	(C/G/T)(A/C/T)(G/T)G(C/T)(C/T)(G/T)(C/G)(A/C/T)(A/G/T)	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: CAGGTTTCTG at 4506, TCGGTCTGCA at 4236, AACCAACCGG at 3948, TACAGACCTC at 3837, TAGGTCGGTA at 3685, TTTGTCTGTA at 2881
38. Auxin response factors (Ulmasov)	TGTCTC	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: TGTCTC at 4519, TGTCTC at 3673
39. Auxin response factors (Boer)	TGTCGG	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: TGTCGG at 3727
40. Auxin response factors (ARF5)	(C/G/T)N(G/T)GTC(G/T)	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: TTTGTCT at 4518, GGGGTCT at 4448, GAGGTCG at 4345
41. B-boxes (Johnson)	TGGGCA	Y	random or likely?
42. boxes B (Sanchez)	TGTCTCA	Y	random or likely?
43. B recognition elements (BRE^u)	(G/C)(G/C)(G/A)CGCC	Y	random or likely?
40. CAAT boxes	(C/T)(A/G)(A/G)CCAATC(A/G)	N	consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.
41. CadC binding domains	TTANNNNT	Y	random or likely?
42. Calcineurin-responsive transcription factors	TG(A/C)GCCNC	Y	random or likely?
43. Calcium-response elements	CTATTTCGAG	N	CaRE1 CTATTTCGAG.^[15]
44. Carbohydrate response elements (ChREs)	CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG	N	ChoRE1, ChoRE2.^[16]
45. Carbohydrate response elements	ChoRE1 ACCGG, ChoRE2 CCCAT	Y	random or likely?
46. Carbon source-responsive elements (CSREs)	CATTCATCCG	N	confers carbon source-dependent regulation
47. CAACTC regulatory elements (CAREs)	CAACTC	Y	random or likely?
48. cAMP-responsive elements (CREs), Aca1ps, Sko1ps	TGACGTCA	Y	bZIP, random or likely?, same as Root specific elements
49. CArG boxes	CCAAAAAT(G/A)G	Y	bHLH, random or likely?
50. Cat8ps	CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA	Y	-
51. CAT boxes	CATTCCT	Y	random or likely?
52. Cbf1 regulatory factors	TCACGTGA	N	strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end.
52. C-boxes (Johnson)	GAGGCCATCT	N	GAGGCCATCT.^[17]
53. C boxes (Samarsky)	AGTAGT	Y	bZIP, random or likely?
54. C-boxes (Song)	GACGTC	Y	bZIP, random or likely?
55. C/A hybrid boxes	TGACGTAT	N	TGACGTAT.^[18] A at the 12 position
56. hybrid C/G-boxes (Song)	TGACGTGT	Y	bZIP, random or likely?
57. C/T hybrid boxes	TGACGTTA	N	TGACGTTA.^[18] T at the 12 position
58. C boxes (Voronina)	GGTGATG	Y	bZIP, random or likely?
59. CCAAT-boxes-binding transcription factors (Hap4p)	CCAAT	Y	random or likely?
60. CCCTC-binding factors (CTCF)	NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T)	N	NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C).^[19]
61. C/EBP boxes	TTAGGACAT,^[20] or TAGCATT.^[6]	N	CCAAT-enhancer-binding site (C/EBP) is TAGCATT
62. Cell-cycle boxes (CCBs)	CACGAAAA	N	"cell cycle box" is functional in either orientation, acting as an enhancer
63. Cell-cycle box variants (CCBs)	CACGAAA, ACGAAA and C-CGAAA	Y	random or likely?, TTTCGTG at 3600, ACGAAA at 494, and TTTCGGG at 1752
62. Cell cycle regulation	CCCAACGGT^[7]	N	tomato genome-wide analysis
63. CENP-B boxes	TTTCGTTGGAAGCGGGA	N	specifically localized at the centromere
64. CGCG boxes	(A/C/G)CGCG(C/G/T)	Y	random or likely?
65. Circadian control elements	CAANNNNATC	Y	random or likely?
66. Class C DNA binding sites	CACGNG	Y	random or likely?, Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232
68. Cold-responsive elements	CCGAC	Y	random or likely?
69. Copper response elements (CuREs) (Quinn)	TTTGC(T/G)C(A/G)	Y	random or likely?, Positive strand, negative direction: CGCGCAAA at 163
70. Copper response elements (CuREs) (Park)	TGTGCTCA	Y	random or likely?, Negative strand, positive direction: TGAGCACA at 3740
71. Coupling elements (CE1)	TGCCACCGG^[2]	N	CE1 (Watanabe)
72. Coupling elements (CE3s) (Watanabe)	GCGTGTC	Y	random or likely?, Positive strand, positive direction: GCGTGTC at 1053, only one
73. Coupling elements (CE3s) (Ding)	CACGCG	Y	random or likely?, No CE3s in negative direction; positive strand, positive direction: CACGCG at 1726
74. Cytokinin response regulators (ARR1s)	AGATT(C/T)	Y	WD-40 repeat family, random or likely?, Positive strand, negative direction: AGATTC at 2452
75. Cytokinin response regulators (ARR10s)	(A/G)GATA(A/C)G	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: CGTATCC at 3447
76. Cytokinin response regulators (ARR12s)	(A/G)AGATA	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: TATCTT at 4080
77. Cytokinin response regulators (ARRs) (Ferreira)	(G/A)GGAT(T/C)	Y	WD-40 repeat family, random or likely?, Positive strand, negative direction: GATCCC at 4477, AGGATC at 4288, AGGATC at 4157, AGGATC at 4006, AATCCC at 3976, AATCCC at 3067
78. Cytokinin response regulators (ARRs) (Rashotte1)	GATCTT	Y	WD-40 repeat family, random or likely?, Positive strand, negative direction: AAGATC at 3276
79. Cytokinin response regulators (ARRs) (Rashotte2)	(G/A)GAT(T/C)	Y	WD-40 repeat family, random or likely?, Positive strand, negative direction: GATCC at 4476, AGATC at 4475
80. Cytoplasmic polyadenylation elements (CPEs)	TTTTTAT	Y	random or likely?, Negative strand, negative direction: TTTTTAT at 4220, TTTTTAT at 4070
81. DAF-16 binding elements	(A/G)(C/T)AAA(C/T)A	Y	random or likely?
82. DAF-16-associated elements (DAE)	TGATAAG	N	DAF-16-associated element (DAE).^[21]
83. D-boxes (Mracek1)	GTTGTATAAC	N	GTTGTATAAC.^[22]
77. D-boxes (Mracek)	CTTATGTAAA (Mracek2)	N	CTTATGTAAA.^[22]
78. D-boxes (Johnson)	TCTCACA	N	TCTCACATT(A/C)AATAAGTCA is a D-box.^[17]
79. D boxes (Samarsky)	AGTCTG	Y	random or likely?
80. D boxes (Voronina)	TCCTG	Y	random or likely?
81. D-boxes (Motojima)	TGAGTGG	Y	random or likely?
82. Dioxin-responsive elements (DREs)	TNGCGTG	Y	random or likely?
83. Defense and stress-responsive elements	ATTTTCTTCA	N	ATTTTCTTCA.^[7]
82. DNA damage response elements (DREs) (Smith)	TTTCAAT^[23]	N	in the upstream repression sequence (URS)
84. DNA damage response elements (DRE, core) (Sumrada)	CCGCC	Y	random or likely?
85. DNA damage response elements (DREs) (Sumrada)	TAGCCGCCG of TAGCCGCCGRRRR.^[24]	N	in the upstream repression sequence (URS)
86. DNA replication-related elements (DREs)	TATCGATA	N	DNA replication-related element (DRE).^[25]
87. Downstream B recognition elements	(A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T)	Y	random or likely?
88. Downstream core elements (DCEs)	CTTC...CTGT...AGC	Y	random or likely?
89. Downstream promoter elements (DPEs) (Juven-Gershon)	(A/G)G(A/T)(C/T)(A/C/G)T	Y	random or likely?, Negative strand, negative direction: AGGACC at 4546, AGTCCT at 4437, AGATGT at 4213, AGTTCT at 4179, GGTCCT at 4171, AGTCCT at 4139, GGACAT at 4122, AGATGT at 4063, AGTTCT at 4028, GGTTCT at 4020, GGTTGT at 3980, GGACAT at 3971, ACAACC at 3942, GGACCT at 3907, AGGACC at 3906, ACGACC at 3864, AGACCT at 3836, AGAACC at 3793, GGACCT at 3745, GGTCGT at 3732, AGGTCC at 3585, ATGACT at 3542, ATAACC at 3529, ACGTCT at 3431, GGTTCT at 3274, GGTCCT at 3250, AGTCCT at 3218, GGTTGT at 3138, AGTCCT at 3111, GGTCGT at 3071, GGACAT at 3062, AGATGT at 2989, ATATCT at 2903, GGTTAT at 2849 Positive strand, negative direction: AGACAT at 4508, AGATCC at 4476, AGAACC at 4451, AGTTCT at 4418, AGACGT at 4236, AGATGT at 3621, AGATAT at 3466, AGACAT at 3434, ATGTCT at 3833, AGGACT at 3640, ATGTCT at 2986, AGATAT at 2982, AGACAT at 2949, AGACAT at 2881
90. Downstream promoter elements (DPEs) (Kadonaga)	(A/G)G(A/T)CGTG	Y	random or likely?, Negative strand, negative direction: GGTCGTG at 3733, CACGTCT at 3431, GGTCGTG at 3072 Positive strand, negative direction: AGACGTG at 4237
88. Downstream promoter elements (DPEs) (Matsumoto)	AGTCTC	Y	random or likely?, Negative strand, negative direction: AGTCTC at 3645 Positive strand, negative direction: GAGACT at 4053
89. DREB boxes	TACCGACAT	N	CRT/DREB box
90. E2 boxes	(G/A)CAG(A/C/G/T)TG(A/C/G/T)	Y	random or likely?
91. EIF4E basal elements	TTACCCCCCCTT	N	poly(C) motif
92. EIN3 binding sites	A(C/T)G(A/T)A(C/T)CT	Y	random or likely?
93. Endoplasmic reticulum stress response elements (ERSE)	CCAAT	N	CCAATGGGCTGAAAC between ZNF497 and A1BG, compare CCAAT-box and ERSE below
94. Endoplasmic reticulum stress response elements	CCAAT-N9-CCACG, CCACG	Y	random or likely?
93. Endosperm expressions	TGTGTCA	Y	random or likely?
94. Enhancer boxes	CA(A/C/G/T)(A/C/G/T)TG	Y	bHLH, random or likely?
95. Estrogen response elements (EREs)	AGGTTA or GGTCAGGAT	N	AGGTTATTGCCTCCT or GGTCAGGATGAC
96. Ethylene responsive elements	ATTTCAAA	Y	WD-40 repeat family, random or likely?
97. F boxes	TGATAAG^[26]	N	F-box overlaps the I-box
98. Forkhead boxes	GTAAACAA^[27]	N	GTAAACAA FOXO1
99. Forkhead boxes	(A/G)(C/T)AAA(C/T)A	Y	random or likely?
100. GAAC elements	GAACT	Y	random or likely?
101. Gal4ps	CGGACCGC	N	CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG^[28]
102. γ-interferon activated sequences (GAS)	TTCCTAGAA	N	ALS-GAS1 between nt −633 and nt −625
103. Γ-interferon activated sequences (GAS), see STAT5	TTNCNNNAA	Y	random or likely?
104. GATA boxes	GATA	Y	Zinc finger DNA-binding domains, bHLH, random or likely?
105. G boxes	(G/T)CCACGTG(G/T)C	N	no "perfect palindrome" G boxes in either promoter
106. GC boxes (Briggs)	(G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T)	Y	random or likely?
107. GC boxes (Ye)	GGGCGG	Y	random or likely?, Negative strand, negative direction: CCGCCC at 4000, CCGCCC at 3091
108. GCC boxes	GCCGCC	Y	random or likely?
109. General control nonderepressible 4 protein binding site (GCRE, GCN4)	TGA(C/G/T)T(A/C/G)(A/T)	Y	bZIP, random or likely?
110. GCN4 motifs	TGACTCA, TGAGTCA	N	ACGT motif
111. Gcn4ps	ATGACTCTT^[28]	N	GCN4 motifs
112. GGC triplets	CCGNNNNCGG	Y	random or likely?, Negative strand, negative direction: CCGAGTACGG at 4118
112. Gibberellic acid responsive elements (GAREs)	TAACAAA	Y	WD-40 repeat family, random or likely?
113. Gibberellin responsive elements (GAREs) (Sharma)	AAACAGA^[7]	Y	WD-40 repeat family, random or likely?
114. GARE-like 1 (Fan)	TAACA(A/G)A^[29]	Y	WD-40 repeat family, random or likely?
115. Gibberellin responsive element-like 2 (GARE-like 2) (Fan)	TAACGTA^[29]	N	"in the promoters of hydrolase genes".^[29]
116. GLM boxes	(G/A)TGA(G/C)TCA(T/C)	N	GCN4-like motif
117. G-protein-coupled receptors (GCR1s), CT boxes	CTTCC	Y	random or likely?
118. Glucocorticoid response elements	AGAACA	Y	bHLH, random or likely?
119. Grainy head transcription factor binding sites	AACCGGTT	N	also GACTGGTT
120. GT boxes (Motojima)	TGGGTGGGGCT	N	(-78 to -69)
121. GT boxes (Sato)	GGGG(T/A)GGGG	Y	random or likely?, Negative strand, Positive direction: GGGGAGGGG at 2291
122. Hac1 KAR2	CAGCGTG	Y	random or likely?, Positive strand, negative direction: CAGCGTG at 740, Negative strand, positive direction: CACGCTG at 778
123. H and ACA boxes	AGAGGA	Y	random or likely?
124. Hapless motifs	CCAATCA	N	heterotrimeric transcription factor, HAP2/3/4.^[30]
125. H-boxes (Lindsay)	CCTACC	Y	random or likely?
126. H box (Mitchell)	ANANNA	Y	random or likely?
127. H box (Rozhdestvensky)	ACACCA	Y	random or likely?
128. Heat-responsive elements	AAAAAATTTC	N	four nGAAn motifs
129. Heat shock elements (HSEs) (Eastmond)	nGAAn-(5-bp)-nGAAnnTTCn	Y	random or likely?, Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
130. Heat shock elements (HSEs) (Eastmond)	nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP)	Y	random or likely?, Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
131. Heat shock elements (HSEs) (Eastmond)	nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP)	Y	random or likely?, Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332
132. Heat shock elements (HSEs) (Eastmond)	nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn	Y	random or likely?, Postive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831
133. Heat shock elements (HSE1) (Eastmond)	nGAAnnTTCnnGAAn	N	HSE1
134. Heat shock elements (HSE2) (Eastmond)	nTTCnnGAAnnTTCn	N	HSE2 is the inverse complement of HSE1
135. Heat shock elements (HSE5) (Eastmond)	nTTCn-(5-bp)-nTTCnnGAAn	N	HSE5
136. Heat shock elements (HSE6) (Eastmond)	nTTCn-nnGAAn-(5-bp)-nGAAn	N	HSE6
137. Heat shock elements (HSE7) (Eastmond)	nGA(A/G)nnTTCnnGAAn	N	HSE7 PFT1
138. Heat shock elements (HSE) (Eastmond)	nGAAnnTTCnnGA(A/G)n	N	HSE7 PFT2
139. Heat shock elements (HSE10) (Eastmond)	nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn	N	HSE10
140. Hex sequences	TGACGTGGC	Y	random or likely?, Positive strand, positive direction: TGACGTGGC at 4344
141. High Mobility Group boxes (HMG boxes)	(A/T)(A/T)CAAAG	Y	random or likely?, Positive strand, negative direction: ATCAAAG at 2891
142. HNF6s	(A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T)	Y	random or likely?, Positive strand, negative direction: TTATTAATTC at 4542, TTATTAATCG at 4229, TAGTTGATAA at 3527
143. Homeoboxes	CAAG	Y	random or likely?
144. HY boxes	TG(A/T)GGG	Y	random or likely?, Negative strand, negative direction: CCCTCA at 4498, CCCTCA at 3889, CCCACA at 3184 Positive strand, negative direction: TGAGGG at 4558, TGTGGG at 3712, TGAGGG at 3652
145. Hypoxia-inducible factors (HIF-1)	GCCCTACGTGCTGTCTCA^[31]	N	composed of HIF-1α and HIF-1β
146. Hypoxia-inducible factors	ACGTG	Y	random or likely?, Negative strand: ACGTG at 4339, CACGT at 3429, ACGTG at 3288, CACGT at 2863 Positive strand: ACGTG at 4237
147. Hypoxia response elements	CACGC	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: CACGC at 2196, CACGC at 447, CACGC at 379
148. I boxes	GATAAG	N	GGATGAGATAAGA
149. Initiator elements (Inrs)	YYANWYY	Y	random or likely?, Negative strand, negative direction: TTACTCC at 4557, TCACACT at 4361, TCGGACC at 4349, CCAGTTT at 4309, TCGGACC at 4300, GGTCCGA at 4255, CTGCACC at 4238, TCGGTCT at 4233 Positive strand, negative direction: GGAATGA at 4555, TTAATTC at 4542, TCACATT at 4533, AGTCCAA at 4502, CCACTTT at 4461, CCACTCC at 4425, CCACTCC at 4425, CCAGTTC at 4417, AGTGTGA at 4361, CTGCACT at 4340, CCGGACT at 4327, AAAATAA at 4221
150. Initiator elements (Inrs)	BBCABW	Y	random or likely?, Negative strand, negative direction: TCTGGG at 4366, GTCACA at 4359, CCCACT at 4353, TGTGAC at 4336, GTCACT at 4319, TCCAGT at 4307, TCTGCA at 4236 Positive strand, negative direction: AATGAG at 4556, TTCACA at 4531, CCCACT at 4485, TCCACT at 4459, CCCAGA at 4448, TCCACT at 4423, GCCAGT at 4415, TGCACT at 4340, TGCAGT at 4317, GCCAGA at 4233
150. Initiator-like elements	TTCTCT	Y	random or likely?, Negative strand: AGAGAA at 4527, TTCTCT at 3380
151. Inositol/choline-responsive elements (ICRE) (Case)	CANNTGAAAT	N	version of Lopes, see below
152. Inositol/choline-responsive elements (ICRE) (Case, Lopes)	CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991)	Y	random or likely?
153. Inositol/choline-responsive elements (ICRE) (Lopes)	ATGTGAAAT	N	using ANNTGAAAT
154. Inositol/choline-responsive elements (ICREs) (Schwank)	TYTTCACATGY contains the core sequence CANNTG	Y	random or likely?
155. Interferon regulatory factor (IRF3)	GCTTTCC	Y	random or likely?
156. Interferon-stimulated response elements (ISREs)	AGTTTCN₂TTTCN	N	consensus sequence AGTTTCN₂TTTCN.^[32]
157. IFN-stimulated response elements (ISREs) (Lu)	GAAANNGAAA	Y	random or likely?, Negative strand, positive direction: GAAATAGAAA at 2629
158. IRS consensus (Fujii)	AANNGAAA	Y	random or likely?, Positive strand, negative direction: AAAAGAAA at 4394, AAAAGAAA at 4389, AAAAGAAA at 4382, AATAGAAA at 4081
159. Tryptophan residues (Lu)	GAAA	Y	random or likely?, Negative strand, negative direction: TTTC at 4504, GAAA at 4461
160. Jasmonic acid-responsive elements (JAREs)	TGACG	Y	random or likely?
161. Kozak sequences	GCCGCC(A/G)CCATGG	N	GCCGCC(A/G)CCATGG^[33]
162. Kozak sequences (Matsumoto)	GAAAATGG	N	GAAAATGG^[34]
163. Krüppel-like factors	GGGNN(G/T)(G/T)(G/T)	Y	random or likely?
164. L boxes	AAATTAACCAA	N	AAATTAACCAA^[35]
165. Leu3 transcription factors	(C/G)C(G/T)NNNN(A/C)G(C/G)	Y	random or likely?, Negative strand, negative direction: GCGAACTCGG at 4297, CCGAGTACGG at 4118, CCGACTCCGC at 3998, CCGTCGTAGG at 3903, CCTGGTCCGG at 3873, CCGACTCCGC at 3089
166. -35 sequence	TTGACA	Y	random or likely?, Negative strand: TTGACA at 4399
167. Maf recognition element (MAREs)	TGCTGA(G/C)TCAGCA	N	and TGCTGA(GC/CG)TCAGCA^[36]
168. M boxes	GTCATGTGCT	N	or AGTCATGTGCT^[37]
169. Mcm1 regulatory factors	TT(A/T)CCNN(A/T)TNGG(A/T)AA	N	Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.^[3]
170. Mcm1 regulatory factors (Rossi)	TTNCCNNNTNNGGNAA	N	Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.^[3]
171. Met31ps	AAACTGTG^[38]	Y	random or likely?, Positive strand, negative direction: AAACTGTG at 4400
172. Metal responsive elements (MRE)	TGC(A/G)C(A/C/G/T)C	Y	random or likely?, Positive strand: TGCACTC at 4341, TGCACTC at 3290, GTGTGCA at 2863
173. Middle sporulation element (MSE) (Branco)	ACACAAA	Y	random or likely?, Negative strand, negative direction: TTTGTGT at 3513
171. Midsporulation element (MSE) (Ozsarac)	C(A/G)CAAA(A/T)	Y	random or likely?, Negative strand, negative direction: TTTTGTG at 3512 Positive strand, negative direction: CACAAAA at 3767
172. Multicopy inhibitor of the GAL1 promoter (MIG1)	(C/G)(C/T)GGGG	Y	random or likely?, Negative strand, negative direction: GTGGGG at 4445, GTGGGG at 3058 Positive strand, negative direction: CCCCAG at 4447, CTGGGG at 3037
173. Motif ten elements	C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G)	N	Gene ID: 6309
174. Musashi binding elements (MBEs)	(G/A)U_1–3AGU	Y	random or likely?, Positive strand, positive direction: GTAGT at 4362.
175. Myeloblastosis recognition element (MRE)	A(A/C)C(A/T)A(A/C)C	Y	random or likely?, Negative strand: GGTAGGT at 4457, ACCAACC at 3946, ACCAACC at 3606, GGTTGTT at 3139
176. Myocyte enhancer factors (MEFs)	(C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G)	Y	random or likely?, Negative strand, negative direction: TTATTATTAA at 4226
177. Nanos/Pumilio response elements (PREs)	TGTAAAT	Y	random or likely?, Negative strand, negative direction: TGTAAAT at 4535
178. N-boxes (Lee)	CCGGAA	Y	random or likely?, Negative strand, positive direction: TTCCGG at 4244
179. N-boxes (Bai)	CACGAG	Y	random or likely?, Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232
180. N-boxes (Gao)	CACGGC or CACGAC, CACG(A/G)C	Y	random or likely?, Negative strand, negative direction: CACGAC at 3956, GTCGTG at 3733, GTCGTG at 3072
180. N-boxes (Leal)	CACNAG	Y	random or likely?, Positive strand, negative direction: CACGAG at 4472, CACAAG at 3634, CACTAG at 3493, CACTAG at 3369, CACGAG at 3232
181. Non-DiTyrosine 80 transcription factor DNA binding domain (Ndt80)	(A/G/T)NC(A/G)CAAA(A/T)	Y	random or likely?, Negative strand, negative direction: TTTTGTGTT at 3514 Positive strand: ACCACAAAA at 3767
182. NF‐κB/Rel family of eukaryotic transcription factors	CCCCTAAGGGG	N	NF-κB
183. Nuclear factor 1 (NF-1)	TTGGCNNNNNGCCAA	N	palindromic sequence
184. Nuclear factor of activated T cells (NFATs)	GGAAAA	Y	random or likely?, Negative strand, negative direction: TTTTCC at 3441, TTTTCC at 3345 Positive strand, negative direction: GGAAAA at 2968, GGAAAA at 2927
185. Nuclear factor Ys	CCAATGG(A/C)(A/G)	N	NF-Y is a trimeric complex
186. Nutrient-sensing response element 1	GTTTCATCA	Y	random or likely?
183. Oaf1 transcription factor	CGGN₃TNAN_9-12CCG	Y	random or likely?
184. ORESARA1 (ORE1) (Matallana)	(A/C/G)(A/C)GT(A/G)N_5,6(C/T)AC(A/G)	Y	random or likely?, Negative strand, negative direction: GCGTAGAAGACACA at 3558, AAGTAGTTTCTACG at 2895
185. ORESARA1 (ORE1) (Olsen)	T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)	Y	random or likely?, Negative strand, negative direction: TGACGTGAG at 4341, TAACGTGAG at 3290 Positive strand, negative direction: ATCACGCCA at 3282
186. p53 response elements	(A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T)	Y	random or likely?, Positive strand, negative direction: AGACAAGCTT at 4186
187. p53 response elements (Long1)	CAGGCCC	Y	random or likely?, Positive strand, positive direction: GGGCCTG at 745
188. p53 response elements (Long2)	GGGCGTG	Y	random or likely?, Positive strand, negative direction: GGGCGTG at 3046
189. p63 DNA binding sites	(A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T)	N	RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
190. P-box (Mena)	(A/T)AAAG	Y	random or likely?, Negative strand, negative direction: CTTTT at 4395, CTTTT at 4390, CTTTT at 4383, TAAAG at 3688, TAAAG at 2884 Positive strand, negative direction: AAAAG at 4391, AAAAG at 4386, AAAAG at 4379, AAAAG at 3440, AAAAG at 3344, CTTTT at 3019, TAAAG at 2857
191. P-box (Motojima)	TGAGTTCA	Y	random or likely?
192. P-box (Yu)	GTAA(T/C)	Y	random or likely?, Negative strand, negative direction: ATTAC at 3658, GTAAT at 3436, GTAAC at 3285, GTAAT at 2951 Positive strand, negative direction: GTAAT at 3973, ATTAC at 3469, GTAAT at 3064
191. Pdr1p/Pdr3ps	TCCGCGGA	N	Pdr1p/Pdr3p response elements (PDREs)
192. Peroxisome proliferator-activated receptor alpha	CGACCCC	Y	random or likely?, Negative strand, negative direction: CGACCCC at 3037
193. Peroxisome proliferator hormone response elements (PPREs)	AGGTCANAGGTCA	N	PPARs/RXRs heterodimers bind to PPRE
194. Pho4ps	CAC(A/G)T(T/G)	Y	bHLH, random or likely?, Negative strand, negative direction: TTACAC at 4091, AACGTG at 3288, CACGTT at 2864 Positive strand, negative direction: CACATT at 4533
195. Pollen1 elements	AGAAA	Y	random or likely?, Negative strand, negative direction: TTTCT at 4505, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, TTTCT at 4083, TTTCT at 3924, TTTCT at 3665, TTTCT at 3378, TTTCT at 2892 Positive strand, negative direction: AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAA at 3591, AGAAA at 3376, AGAAA at 3342
196. Pollen1 with TCCACCATA	AGAAANNNNTCCACCATA	N	adjacent co-dependent regulatory element TCCACCATA
197. Polycomb response elements	CGCCAT(A/T)TT	N	CGCCATTT
198. Polycomb response elements (PRE)	GCCAT	Y	random or likely?, Positive strand, negative direction: GCCAT at 3685, ATGGC at 3629, GCCAT at 3283, ATGGC at 3005, ATGGC at 2907
199. Pribnow boxes	TATAAT	Y	random or likely?, Negative strand, negative direction: TATAAT at 3468, TATAAT at 3454
200. Prolamin boxes	TG(A/T)AAAG	Y	random or likely?, Negative strand, negative direction: TGTAAAG at 2884
201. Pyrimidine boxes	CCTTTT	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: CCTTTT at 2968, CCTTTT at 2927 Positive strand, negative direction: AAAAGG at 3441, AAAAGG at 3345
202. Q elements See Retinoic acid response element	AGGTCA	Y	random or likely?, Positive strand, negative direction: AGGTCA at 4307
203. Quinone reductase response element (QRDRE) (Yao)	TCCCCT of TCCCCTTGCGTG	Y	random or likely?
204. Rap1 regulatory factors	ACCC(A/G)N(A/G)CA	N	"(ACCCRnRCA), less than half of the sites were detectably bound"^[3]
205. Rap1 reduced consensus	(A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C)	Y	WD-40 repeat family, random or likely?, Positive strand, positive direction: GAACCCACACCTC at 1807
206. Reb1 bound and exact occurrences	TTACCC(G/T)	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: TTACCCT at 3661
207. Extended Reb1	ATTACCCGAA	N	"extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."^[3]
208. Retinoic acid response element	AG(A/G)TCA	Y	random or likely?, Negative strand, negative direction: TGATCT at 3463
209. Glucose transporter gene repressor (Rgt1)	CGG(A/G)(A/T)N(A/T)(A/T)	Y	random or likely?, Negative strand, negative direction: ATTTTCCG at 3442
210. Rlm1ps	CTATATATAG	N	CTA(T/A)₄TAG
211. classic RORE motif (RORE)	A(A/T)NTAGGTCA	Y	random or likely?
212. variant RORE motif	C(T/A)(G/A)GGNCA	Y	random or likely?, Negative strand, negative direction: CTGGGACA at 4369, CTGGGACA at 4208
213. Rox1ps	RRRTAACAAGAG	N	Heme-dependent repressor of hypoxic genes.^[28]
214. Rpn4ps	GGTGGCAAA	N	proteasome genes
215. R response elements (RRE)	CATCTG	Y	random or likely?, Negative strand, negative direction: CAGATG at 4212, CAGATG at 2988 Positive strand, negative direction: CAGATG at 3919, CAGATG at 3627, CAGATG at 3620
216. Seed-specific elements	CATGCATG	N	SRE consensus: CAGCAGATTGCG is none
217. Serum response elements (SRE) see CArG boxes	ACAGGATGT	Y	bHLH-ZIP, random or likely?, Negative strand, positive direction: ACAGGATGT at 3575
218. Servenius sequences	GGACCCT	Y	random or likely?, Negative strand, negative direction: GGACCCT at 4548, GGACCCT at 4496, GGACCCT at 4302
219. Shoot specific elements	GATAATGATG	N	SRE consensus: CAGCAGATTGCG is none
220. Sip4ps	CC(C/G)T(C/T)C(C/G)TCCG	N	CC(C/G)T(C/T)C(C/G)TCCG^[28]
221. Smp1ps	ACTACTA(A/T)(A/T)(A/T)(A/T)TAG	N	ACTACTA(T/A)₄TAG^[28]
222. SP1 (Zhang)	(G/T)GGGCGG(G/A)(G/A)(C/T)	Y	see GC boxes above, random or likely?
223. SP1-box 1 (Motojima)	GGGGCT	Y	random or likely?, Positive strand, negative direction: GGGGCT at 3039
224. SP1-box 2 (Motojima)	CTGCCC	Y	random or likely?, Positive strand, negative direction: CTGCCC at 3853
225. SP-1 (Sato)	CCGCCCC	Y	random or likely?, Negative strand, positive direction: GGGGCGG at 4439, GGGGCGG at 4429
226. SP1 (Long)	GGGGCGGGCC	N	GGGGCGGGCC^[16]
227. SP1 (Yao)	GCGGC	Y	random or likely?, Negative strand, negative direction: GCCGC at 2726 Positive strand, negative direction: GCGGC at 2725
228. STAT5	TTCNNNGAA	Y	Positive strand, negative direction: TTCCCTGAA at 3782, TTCGTTGAA at 3506
229. Sterol response elements (Branco)	TCGTATA	N	perhaps plant specific
229. Sterol response elements (Yao)	AGCAGATTGCG	N	liver specific
230. Stress-response elements (STREs)	CCCCT	Y	random or likely?, Negative strand, negative direction: CCCCT at 2924 Positive strand, negative direction: CCCCT at 3059
231. Sucrose boxes	NNAATCA	Y	random or likely?, Negative strand, negative direction: TGATTCC at 3474, TGATTTT at 3163, TGATTCG at 3032, TGATTCG at 2915
232. TACTAAC boxes	TACTAA(C/T)	Y	random or likely?, Positive strand, positive direction: TACTAAT at 4157, ATTAGTA at 4148
233. TAGteams	CAGGTAG	Y	random or likely?, Negative strand, positive direction: CAGGTAG at 4035, CTACCTG at 1198
234. Tapetum boxes	TCGTGT	Y	random or likely?, Negative strand, negative direction: ACACGA at 4402, TCGTGT at 3915
235. TATA boxes	TATA(A/T)A(A/T)(A/G)	Y	random or likely?, Negative strand, negative direction: TTTATATA at 2871 Positive strand, negative direction: TATATAAA at 2874
236. TAT Boxes (Yang)	TATAAAA	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: TATAAAA at 2853
237. TAT Boxes {Fan)	TATCCAT	Y	WD-40 repeat family, random or likely?, Negative strand, negative direction: ATGGATA at 2996
238. TATCCAC boxes	TATCCAC	N	GA responsive complex component
239. Tbf1 regulatory factors	A(A/G)CCCTAA	Y	Saccharomyces cerevisiae, random or likely?, General Regulatory Factors
239. T boxes (Conlon)	TCACACCT	Y	bZIP, random or likely?, positive strand: TCACACCT at 3968, TCACACCT at 1129
240. T boxes (Zhang)	AACGTT	Y	bZIP, random or likely?, positive strand: AACGTT at 2691, AACGTT at 1614
241. TCCACCATA elements	TCCACCATA	N	adjacent co-dependent regulatory element of POLLEN1
242. TEA consensus sequences	CATTCY	Y	random or likely?, Positive strand, negative direction: GGAATG at 4554, AGAATG at 3003
243. Tec1ps	GAATGT	Y	random or likely?, Ste12p cofactor
244. Telomeric repeat DNA-binding factors (TRFs)	TTAGGG	Y	random or likely?, Negative strand, negative direction: TTAGGG at 3976, TTAGGG at 3067
245. Tetradecanoylphorbol-13-acetate response elements (TREs)	TGA(G/C)TCA	N	cis-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
245. TGF-β control elements (TCEs)	GAGTGGGGCG	N	in mouse and rat, GCGTGGGGGA in humans
246. TGF-β inhibitory elements (TIEs)	GAGTGGTGA	N	in the rat transin/stromelysin promoter
247. Thyroid hormone response elements (TREs)(THRs)	AGGTCA	Y	random or likely?, See VDREs, X boxes, Positive strand, negative direction: AGGTCA at 4307
248. Transcription factor 3 (TCF3)	GTCTGGT	Y	random or likely?, Negative strand, negative direction: GTCTGGT at 2122
249. Translational control sequences (TCSs)	AUUAUCU (Wee1 TCS1), AUUGUCU (Wee1 TCS2) and UUUGUCU (Mos and PCM-1 TCS)	Y	random or likely?, Negative strand, negative direction: TTTGTCT at 4518, ATTATCT at 4079, TTTGTCT at 2878.
250. Unfolded protein response element (URE) (UPRE-1)	CANCNTG	Y	random or likely?, Positive strand, negative direction: CAGCCTG at 4348, CATGGTG at 4109, CAGCCTG at 4036, CATCCTG at 3905, CACCCTG at 3743, CAGCCTG at 3297, CAAGGTG at 3143, CAGCCTG at 3127
251. Unfolded protein response elements (UPREs)	TGACGTG(G/A)	Y	random or likely?, XBP1 binds to UPRE, Negative strand, negative direction: TGACGTGA at 4340
252. Upstream stimulating factors (USFs)	GCC(A/T)NN(C/G/T)(A/G)	Y	random or likely?, Negative strand, negative direction: CGGTCCAC at 3953 Positive strand, negative direction: CAGATGGC at 3629
252. UUA rich elements (Siegel)	TTATTTA(A/T)(A/T)	Y	random or likely?, Negative strand, negative direction: TTATTTATT at 4075
253. V boxes	(A/G)TT(A/T)(C/T)	Y	random or likely?, Negative strand, negative direction: ATAAT at 4538, AAAAT at 4512, GTTTC at 4504, GAAAC at 4462, GTTTT at 4376, GTTTT at 4310, ATTAT at 4223, GTTTT at 4216 Positive strand, negative direction: ATTTT at 4511, AAAAC at 4396, AAAAC at 4311, ATAAT at 4225, ATAAT at 4222, AAAAT at 4219
254. Vhr1ps (VHR1)	AATCA-N₈-TGA(C/T)T	N	Response to low biotin concentrations
255. Vitamin D response elements (VDREs)	(A/G)G(G/T)(G/T)CA	Y	random or likely?, Negative strand, negative direction: TGAACC at 4268, TGAACT at 4012, TGACCC at 3750, TGAACT at 3242, TGAACT at 3103, TGAACC at 2921
256. Vitamin D response elements (VDREs)	A/GGG/TTCAnnnA/GGG/TTCA	N	(A/G)G(G/T)TCANNN(A/G)G(G/T)TCA
257. W boxes	(C/T)TGAC(C/T)	Y	random or likely?, Negative strand, negative direction: GGTCAA at 4416, GGTCAA at 4308, CTGACC at 3749
258. X boxes	GTTGGCATGGCAAC^[4]	N	X2 box is AGGTCCA not ⌘F
259. X-boxes	GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC^[39]	N	includes GTTNCCATGGNAAC
260. Xbp1ps	GcCTCGA(G/A)G(C/A)g(a/g)	N	Transcriptional repressor
261. X core promoter elements	(A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C)	Y	random or likely?, Negative strand, negative direction: TGGTGGGACC at 3744
262. Xenobiotic response elements (XREs)	GCGTG	Y	bHLH, random or likely?, Positive strand, negative direction: CACGC at 3280, GCGTG at 3046
263. Xenobiotic response elements (XREs)	(T/G)NGCGTG(A/C)(G/C)A	N	contains the core sequence GCGTG, see AHRE above
264. Yap recognition sequences	TTACTAA	Y	random or likely?, Yap1, Yap2, Yap3, and Yap5
265. Y boxes	(A/G)CTAACC(A/G)(A/G)(C/T)	N	inverted CAAT box
266. YY1 binding sites	CCATCTT	Y	Negative strand, negative direction: CCATCTT at 1654
267. Zap1ps	ACCCTCA	N	ACC(C/T)(C/T)(A/C/G/T)AAGGT
268. Z boxes	A(C/T)A(C/G)GT(A/G)T	Y	random or likely?, Positive strand, negative direction: ACACCTGT at 3970, ATACCTAT at 2996
269. Zinc responsive elements (ZREs)	MHHAACCBYNMRGGT	N	(A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

References

↑ MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.
↑ ^2.0 ^2.1 ^2.2 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
↑ ^3.0 ^3.1 ^3.2 ^3.3 ^3.4 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
↑ ^4.0 ^4.1 Z G E, Zhang YP, Zhou JH, Wang L (16 April 2014). "Mini review roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: name (help)
↑ Takayuki Murata; Chieko Noda; Yohei Narita1; Takahiro Watanabe; Masahiro Yoshida; Keiji Ashio; Yoshitaka Sato; Fumi Goshima; Teru Kanda; Hironori Yoshiyama; Tatsuya Tsurumi; Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.
↑ ^6.0 ^6.1 Yao EF; Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.
↑ ^7.0 ^7.1 ^7.2 ^7.3 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.
↑ ^8.0 ^8.1 Ryuto Maruyama; Makoto Shimizu; Juan Li, Jun Inoue; Ryuichiro Sato (24 March 2016). "Fibroblast growth factor 21 induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region". Bioscience, Biotechnology, and Biochemistry. 80 (5): 929–934. doi:10.1080/09168451.2015.1135045. Retrieved 4 October 2020.
↑ Angelika Bröer; Gregory Gauthier-Coles; Farid Rahimi; Michelle van Geldermalsen; Dieter Dorsch􏰀; Ansgar Wegener; Jeff Holst; Stefan Bröer (March 15, 2019). "Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells" (PDF). Journal of Biological Chemistry. 294 (11): 4012–4026. doi:10.1074/jbc.RA118.006378. Retrieved 4 October 2020.
↑ Alisa A. Garaeva; Irina E. Kovaleva; Peter M. Chumakov; Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.
↑ S Kouhpayeh; AR Einizadeh; Z Hejazi; M Boshtam; L Shariati; M Mirian; L Darzi; M Sojoudi; H Khanahmad; A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.
↑ ^12.0 ^12.1 Stephen Wilson; Jianfei Qi; Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.
↑ Akihito Otsuki; Mikiko Suzuki; Fumiki Katsuoka; Kouhei Tsuchida; Hiromi Suda; Masanobu Morita; Ritsuko Shimizu; Masayuki Yamamoto (February 2016). "Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection". Free Radical Biology and Medicine. 91: 45–57. doi:10.1016/j.freeradbiomed.2015.12.005. PMID 26677805. Retrieved 21 August 2020.
↑ Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.
↑ Xu Tao; Anne E. West; Wen G. Chen; Gabriel Corfas; Michael E. Greenberg (2002). "A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF". Neuron. 33: 383–95. doi:10.1016/S0896-6273(01)00561-X. PMID 11832226. Retrieved 2 September 2020.
↑ ^16.0 ^16.1 Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.
↑ ^17.0 ^17.1 PA Johnson; D Bunick; NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.
↑ ^18.0 ^18.1 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.
↑ Hideharu Hashimoto; Dongxue Wang; John R. Horton; Xing Zhang; Victor G. Corces; Xiaodong Cheng (1 June 2017). "Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA". Molecular Cell. 66 (5): 711–720.e3. doi:10.1016/j.molcel.2017.05.004. PMID 28529057. Retrieved 28 August 2020.
↑ Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
↑ Yan-Hui Li; Gai-Gai Zhang (12 April 2016). "Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in Caenorhabditis elegans". Oncotarget. 7 (15): 19185–19192. doi:10.18632/oncotarget.8313. PMID 2702736. Retrieved 27 August 2020.
↑ ^22.0 ^22.1 Philipp Mracek; Cristina Santoriello; M. Laura Idda; Cristina Pagano; Zohar Ben-Moshe; Yoav Gothilf; Daniela Vallone; Nicholas S. Foulkes (December 6, 2012). "Regulation of per and cry Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression". PLoS ONE. 7 (12): e51278. doi:10.1371/journal.pone.0051278. Retrieved 10 February 2019.
↑ Joshua J. Smith, Eric S. Cole, Daniel P. Romero (15 July 2004). "Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila". Nucleic Acids Research. 32 (14): 4313–4321. doi:10.1093/nar/gkh771. PMID 15304567. Retrieved 4 September 2020.
↑ Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.
↑ Fumiko Hirose; Masamitsu Yamaguchi; Akio Matsukage (September 1999). "Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc". Molecular and Cellular Biology. 19 (9): 6020–6028. doi:10.1128/MCB.19.9.6020. PMID 10454549. Retrieved 4 September 2020.
↑ Annkatrin Rose, Iris Meier and Udo Wienand (28 October 1999). "The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins". The Plant Journal. 20 (6): 641–652. doi:10.1046/j.1365-313X.1999.00638.x. Retrieved 8 November 2018.
↑ Eiji Yoshihara (18 August 2020). "TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis". Antioxidants. 9 (8): 765–84. doi:10.3390/antiox9080765. PMID 32824669 Check |pmid= value (help). Retrieved 5 September 2020.
↑ ^28.0 ^28.1 ^28.2 ^28.3 ^28.4 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.
↑ ^29.0 ^29.1 ^29.2 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.
↑ Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.
↑ Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
↑ Agata Michalska, Katarzyna Blaszczyk, Joanna Wesoly and Hans A. R. Bluyssen (28 May 2018). "A Positive Feedback Amplifier Circuit That Regulates Interferon (IFN)-Stimulated Gene Expression and Controls Type I and Type II IFN Responses". Frontiers in Immunology. 9: 1135. doi:10.3389/fimmu.2018.01135. Retrieved 18 March 2021.
↑ Marilyn Kozak (October 1987). "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs". Nucleic Acids Research. 15 (20): 8125–8148. doi:10.1093/nar/15.20.8125. PMID 3313277.
↑ Takuya Matsumoto; Saemi Kitajima; Chisato Yamamoto; Mitsuru Aoyagi; Yoshiharu Mitoma; Hiroyuki Harada; Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
↑ Robert G. K. Donald and Anthony R. Cashmore (1990). "Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS‐1A promoter". The EMBO Journal. 9 (6): 1717–1726. doi:10.1002/j.1460-2075.1990.tb08295.x. Retrieved 8 November 2018.
↑ Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto (13 February 2004). "Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique". Genes to Cells. 9 (2). doi:10.1111/j.1356-9597.2004.00711.x. Retrieved 8 September 2020.
↑ Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.
↑ Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. Retrieved 4 February 2021.
↑ Eduardo Moreno, Maša Lenuzzi, Christian Rödelsperger, Neel Prabh, Hanh Witte, Waltraud Roeseler, Metta Riebesell, Ralf J. Sommer (November 2018). "DAF‐19/RFX controls ciliogenesis and influences oxygen‐induced social behaviors in Pristionchus pacificus". Evolution & Development. 20 (6): 233–243. doi:10.1111/ede.12271. Retrieved 9 March 2021.

External links

{{Phosphate biochemistry}}

[MeSHD020218-1] MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.

[Watanabe-2] 2.0 ^2.1 ^2.2 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.

[Rossi-3] 3.0 ^3.1 ^3.2 ^3.3 ^3.4 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.

[Zhang-4] 4.0 ^4.1 Z G E, Zhang YP, Zhou JH, Wang L (16 April 2014). "Mini review roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137. Vancouver style error: name (help)

[Murata-5] Takayuki Murata; Chieko Noda; Yohei Narita1; Takahiro Watanabe; Masahiro Yoshida; Keiji Ashio; Yoshitaka Sato; Fumi Goshima; Teru Kanda; Hironori Yoshiyama; Tatsuya Tsurumi; Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.

[Yao-6] 6.0 ^6.1 Yao EF; Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.

[Sharma-7] 7.0 ^7.1 ^7.2 ^7.3 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.

[Maruyama-8] 8.0 ^8.1 Ryuto Maruyama; Makoto Shimizu; Juan Li, Jun Inoue; Ryuichiro Sato (24 March 2016). "Fibroblast growth factor 21 induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region". Bioscience, Biotechnology, and Biochemistry. 80 (5): 929–934. doi:10.1080/09168451.2015.1135045. Retrieved 4 October 2020.

[Broer-9] Angelika Bröer; Gregory Gauthier-Coles; Farid Rahimi; Michelle van Geldermalsen; Dieter Dorsch􏰀; Ansgar Wegener; Jeff Holst; Stefan Bröer (March 15, 2019). "Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells" (PDF). Journal of Biological Chemistry. 294 (11): 4012–4026. doi:10.1074/jbc.RA118.006378. Retrieved 4 October 2020.

[Garaeva-10] Alisa A. Garaeva; Irina E. Kovaleva; Peter M. Chumakov; Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.

[Kouhpayeh-11] S Kouhpayeh; AR Einizadeh; Z Hejazi; M Boshtam; L Shariati; M Mirian; L Darzi; M Sojoudi; H Khanahmad; A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.

[Wilson-12] 12.0 ^12.1 Stephen Wilson; Jianfei Qi; Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.

[Otsuki-13] Akihito Otsuki; Mikiko Suzuki; Fumiki Katsuoka; Kouhei Tsuchida; Hiromi Suda; Masanobu Morita; Ritsuko Shimizu; Masayuki Yamamoto (February 2016). "Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection". Free Radical Biology and Medicine. 91: 45–57. doi:10.1016/j.freeradbiomed.2015.12.005. PMID 26677805. Retrieved 21 August 2020.

[Lacher-14] Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.

[Tao-15] Xu Tao; Anne E. West; Wen G. Chen; Gabriel Corfas; Michael E. Greenberg (2002). "A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF". Neuron. 33: 383–95. doi:10.1016/S0896-6273(01)00561-X. PMID 11832226. Retrieved 2 September 2020.

[Long-16] 16.0 ^16.1 Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.

[Johnson-17] 17.0 ^17.1 PA Johnson; D Bunick; NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.

[Song-18] 18.0 ^18.1 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.

[Hashimoto-19] Hideharu Hashimoto; Dongxue Wang; John R. Horton; Xing Zhang; Victor G. Corces; Xiaodong Cheng (1 June 2017). "Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA". Molecular Cell. 66 (5): 711–720.e3. doi:10.1016/j.molcel.2017.05.004. PMID 28529057. Retrieved 28 August 2020.

[Misra-20] Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.

[Li-21] Yan-Hui Li; Gai-Gai Zhang (12 April 2016). "Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in Caenorhabditis elegans". Oncotarget. 7 (15): 19185–19192. doi:10.18632/oncotarget.8313. PMID 2702736. Retrieved 27 August 2020.

[Mracek-22] 22.0 ^22.1 Philipp Mracek; Cristina Santoriello; M. Laura Idda; Cristina Pagano; Zohar Ben-Moshe; Yoav Gothilf; Daniela Vallone; Nicholas S. Foulkes (December 6, 2012). "Regulation of per and cry Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression". PLoS ONE. 7 (12): e51278. doi:10.1371/journal.pone.0051278. Retrieved 10 February 2019.

[Smith-23] Joshua J. Smith, Eric S. Cole, Daniel P. Romero (15 July 2004). "Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila". Nucleic Acids Research. 32 (14): 4313–4321. doi:10.1093/nar/gkh771. PMID 15304567. Retrieved 4 September 2020.

[Sumrada-24] Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.

[Hirose-25] Fumiko Hirose; Masamitsu Yamaguchi; Akio Matsukage (September 1999). "Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc". Molecular and Cellular Biology. 19 (9): 6020–6028. doi:10.1128/MCB.19.9.6020. PMID 10454549. Retrieved 4 September 2020.

[Rose-26] Annkatrin Rose, Iris Meier and Udo Wienand (28 October 1999). "The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins". The Plant Journal. 20 (6): 641–652. doi:10.1046/j.1365-313X.1999.00638.x. Retrieved 8 November 2018.

[Yoshihara-27] Eiji Yoshihara (18 August 2020). "TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis". Antioxidants. 9 (8): 765–84. doi:10.3390/antiox9080765. PMID 32824669 Check |pmid= value (help). Retrieved 5 September 2020.

[Tang-28] 28.0 ^28.1 ^28.2 ^28.3 ^28.4 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.

[Fan-29] 29.0 ^29.1 ^29.2 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.

[Ozsarac-30] Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.

[Li2020-31] Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.

[Michalska-32] Agata Michalska, Katarzyna Blaszczyk, Joanna Wesoly and Hans A. R. Bluyssen (28 May 2018). "A Positive Feedback Amplifier Circuit That Regulates Interferon (IFN)-Stimulated Gene Expression and Controls Type I and Type II IFN Responses". Frontiers in Immunology. 9: 1135. doi:10.3389/fimmu.2018.01135. Retrieved 18 March 2021.

[Kozak1987-33] Marilyn Kozak (October 1987). "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs". Nucleic Acids Research. 15 (20): 8125–8148. doi:10.1093/nar/15.20.8125. PMID 3313277.

[Matsumoto-34] Takuya Matsumoto; Saemi Kitajima; Chisato Yamamoto; Mitsuru Aoyagi; Yoshiharu Mitoma; Hiroyuki Harada; Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.

[Donald-35] Robert G. K. Donald and Anthony R. Cashmore (1990). "Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS‐1A promoter". The EMBO Journal. 9 (6): 1717–1726. doi:10.1002/j.1460-2075.1990.tb08295.x. Retrieved 8 November 2018.

[Kyo-36] Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto (13 February 2004). "Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique". Genes to Cells. 9 (2). doi:10.1111/j.1356-9597.2004.00711.x. Retrieved 8 September 2020.

[Bertolotto-37] Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.

[Blaiseau-38] Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. Retrieved 4 February 2021.

[Moreno-39] Eduardo Moreno, Maša Lenuzzi, Christian Rödelsperger, Neel Prabh, Hanh Witte, Waltraud Roeseler, Metta Riebesell, Ralf J. Sommer (November 2018). "DAF‐19/RFX controls ciliogenesis and influences oxygen‐induced social behaviors in Pristionchus pacificus". Evolution & Development. 20 (6): 233–243. doi:10.1111/ede.12271. Retrieved 9 March 2021.

[1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

v t e Gene project
Articles	Complex locus A1BG and ZNF497 Grainyhead-like Genes in Regulating Development and Genetic Defects Lysenin Lysine: biosynthesis, catabolism and roles RIG-I like receptors ShK toxin: history, structure and therapeutic applications for autoimmune diseases
Categories	Biochemistry Biology Genetics Medicine
Laboratories	AGC box gene transcription laboratory ATA box gene transcription laboratory C and D boxes gene transcription laboratory CArG box gene transcription laboratory CGCG box gene transcription laboratory CRE box gene transcription laboratory E2 box gene transcription laboratory Enhancer box gene transcription laboratory Factor II B recognition element gene transcription laboratory GA responsive complex gene transcription laboratory GC box gene transcription laboratory H box gene transcription laboratory HNF6 gene transcription laboratory HY box gene transcription laboratory Initiator element gene transcription laboratory Metal responsive element gene transcription laboratory STAT5 gene transcription laboratory TATA box gene transcription laboratory
Lessons	A1BG gene transcription programming Amino Acids Enzymes Enzyme catalysis Enzyme structure and function Eukaryotic transcription Gene regulation in prokaryotes
Lists	Biomolecules
Modules	Module:Infobox gene Module:InfoboxImage
Original research	Gene project
Projects	Biochemistry Gene project History of biology Molecular Biology Molecular evolution Topobiology
Proposals	Gene expressions/Cost sharing and research products Gene expressions in human exploration beyond low earth orbits Gene expressions/Project narrative
Resources	5' cap Acid-base homeostasis Actins Adenines Allergies Alpha-1-B glycoprotein Ammonoids Original research/Amino acids Amphiphiles Anabolism Animal physiology Anomeric carbons Autocatalytic reactions Autonomously replicating sequences Base pairs Biology Biodegradation Biosynthesis Biosynthesis of a human protein Biosynthesis of amino acids Blood Bodily fluids Botany Brain box Calcium signaling Capping enzymes Carbohydrates Carcinoembryonic antigen gene family Catabolism Catalysis Cells Cell signaling Centrosomes Chromatins Chromoboxes Coactivators Corepressors Cofactors Consensus sequences Cytogenetics Cytokinesis Cytosines Deoxyribonucleic acids Digestion Disaccharides Dispersed promoters Dominant group metagenomes Downregulations Endochondral ossification Enzyme inhibitors Enzymology Epigenetics Epigenomes Esters Esterification Eukaryotes Eukaryotic initiation factors Evolution Exaptation Excision repair cross-complementing Factors Fatty acids Ferredoxin Foldings Foods Forkhead boxes Functional groups Genome surveillance complexes Genealogy Genes Genetics Gene transcriptions Genomes Genomics Glycoproteins Glycosides Glycosidic bond Guanines Hair color gene expressions Helicases Heredity History of agriculture Greek and Roman histories of biology Homeostasis Human amino acid synthesis Human DNAs Human genes Human RNA Human teeth Human temperatures Immunoglobulin domain cl11960 Immunoglobulin domain genes Immunoglobulin like domain cd05751 Immunoglobulin like domain pfam13895 Immunoglobulin like domain smart00410 Immunoglobulin receptor superfamily genes Immunoglobulin supergene family Inhibitory peptides Insulators Intranuclear localizations Introduction to Cell Biology Introduction to polymer chemistry Lamarckism Leucine zipper Localization Major histocompatibility complex class I gene family Major histocompatibility complex class II gene family Major histocompatibility complex class III gene family Mammalogy Mathematical molecular biology Mediator complexes Medicine Melanocytes Membranes Metagenomes Molecular biology Molecular genetics Nitrogen metabolism Nucleotide Synthesis Origin of life Orthomolecular medicine Osteoarthritis Paleanthropology Paleontology Phosphate biochemistry Phosphate budgets Phosphate reactions Post translational modifications Principles of biosynthesis Protein isoform Proteins Proteomics Regulations Ribonucleotides Ribosomes RNA polymerases RNA polymerase II holoenzymes RNA polymerase II holoenzyme complexes RNA translations Salinity Stroke management Teeth TFIIA Transports Vascular endothelial growth factor A What is a human? Upregulations Upstream and downstream ZSCAN22 Zoology
Transcription resources	A1BG gene transcription core promoters A1BG gene transcriptions A1BG regulatory elements and regions A1BG response element gene transcriptions A1BG response element negative results A1BG response element positive results ABA-response element gene transcriptions Abf1 regulatory factor gene transcriptions A box gene transcriptions ACGT-containing element gene transcriptions Activating protein gene transcriptions Activating transcription factor gene transcriptions Adenylate–uridylate rich element gene transcriptions Adr1p gene transcriptions Aft1p gene transcriptions AGC box gene transcriptions AGCE gene transcriptions Alpha-amylase conserved element gene transcriptions Amino acid response element gene transcriptions AARE-like Androgen response element gene transcriptions Angiotensinogen core promoter element gene transcriptions Antioxidant-electrophile responsive element gene transcriptions ATA box gene transcriptions Auxin response factor gene transcriptions B box gene transcriptions Bioinformatics tool gene transcriptions Box gene transcriptions Bridge gene transcriptions CAAT box gene transcriptions CadC binding domain gene transcriptions Calcineurin-responsive transcription factor gene transcriptions Calcium-response element gene transcriptions cAMP response element gene transcriptions C and D boxes gene transcriptions Carbohydrate response element gene transcriptions Carbon source-responsive element gene transcriptions Carcinoembryonic antigen gene family CARE gene transcriptions CArG box gene transcriptions CAT box gene transcriptions Cat8p gene transcriptions Cbf1 regulatory factor gene transcriptions C box gene transcriptions CCCTC-binding factor gene transcriptions C-EBP box gene transcriptions Cell-cycle box gene transcriptions Cell cycle regulation gene transcriptions CENP-B box gene transcriptions CGCG box gene transcriptions Circadian control element gene transcriptions Cold-responsive element gene transcriptions Complement copy gene transcriptions Complement-inverse copy gene transcriptions Consensus sequence gene transcriptions Copper response element gene transcriptions Core promoter gene transcriptions Coupling element gene transcriptions CRE box gene transcriptions Cytokinin response regulator gene transcriptions Cytoplasmic polyadenylation element gene transcriptions DAF-16-associated element gene transcriptions DAF-16 binding element gene transcriptions D box gene transcriptions Defense and stress-responsive element gene transcriptions Degenerate nucleotide gene transcriptions Dispersed promoter gene transcriptions Distal promoter gene transcriptions DNA melting gene transcriptions DNA damage response element gene transcriptions DNA replication-related element gene transcriptions Downstream core element gene transcriptions Downstream promoter element gene transcriptions Downstream TFIIB recognition element gene transcriptions DREB box gene transcriptions E2 box gene transcriptions EIF4E basal element gene transcriptions EIN3 binding site gene transcriptions Enhancer activity copy gene transcriptions E box gene transcriptions Element gene transcriptions Endoplasmic reticulum stress response element gene transcriptions Endosperm expression gene transcriptions Enhancer box gene transcriptions Estrogen response element gene transcriptions Ethylene responsive element gene transcriptions Factor II B recognition element gene transcriptions F box gene transcriptions Focused promoter gene transcriptions Forkhead box gene transcriptions Fur box gene transcriptions GAAC element gene transcriptions Gal4p gene transcriptions Γ-interferon activated sequence gene transcriptions GARE gene transcriptions GA responsive complex gene transcriptions GATA gene transcriptions G box gene transcriptions GC box gene transcriptions GCC box gene transcriptions Gcn4p gene transcriptions Gcr1p gene transcriptions Gene expressions General factor II D gene transcriptions General regulatory factors General transcription factor II A gene transcriptions General transcription factor II B gene transcriptions General transcription factor II D gene transcriptions General transcription factor II F gene transcriptions General transcription factor II H gene transcriptions General transcription factor gene transcriptions Gene transcriptions GGC triplet gene transcriptions Gibberellin responsive element gene transcriptions GLM box gene transcriptions Glucocorticoid response element gene transcriptions Grainy head gene transcriptions Grainy head transcription factor gene transcriptions Growth hormone response element gene transcriptions GT boxes Hac1p gene transcriptions Hair color gene expressions H and ACA box gene transcriptions H box gene transcriptions Heat-responsive element gene transcriptions Hex sequence gene transcriptions HMG box gene transcriptions HNF gene transcriptions Homeobox gene transcriptions Hsf1p gene transcriptions HY box gene transcriptions Hybrid C, A boxes Hybrid C, G boxes Hybrid C, T boxes Hypoxia-inducible factor gene transcriptions Hypoxia response elements I box gene transcriptions Initiator element gene transcriptions Initiator-like element gene transcriptions Inositol/choline-responsive elements Interaction gene transcriptions Interferon regulatory factors Inverse copy gene transcriptions Jasmonic acid-responsive element gene transcriptions K-boxes Kozak sequence gene transcriptions Kruppel-associated box gene transcriptions Krüppel-like factor gene transcriptions L box gene transcriptions Leu3 gene transcriptions M35 box gene transcriptions MADS box gene transcriptions Maf recognition element gene transcriptions M box gene transcriptions Mcm1 regulatory factor gene transcriptions Met31p box gene transcriptions Metal responsive element gene transcriptions Middle sporulation element gene transcriptions Mig1p gene transcriptions Model samplings Motif ten element gene transcriptions Msn2,4p gene transcriptions Musashi binding element gene transcriptions MYB recognition element gene transcriptions Myelocytomatosis transcription factor gene transcriptions Myocyte enhancer factor gene transcriptions N-boxes Ndt80p gene transcriptions Nuclear factor 1 Nuclear factor 𝜿B Nuclear factor gene transcriptions Nuclear factor of activated T cell gene transcriptions (NFAT) Nuclear factor Y gene transcriptions Nutrient-sensing response element gene transcriptions Oaf1p gene transcriptions ORE1 binding site gene transcriptions p53 response element gene transcriptions P63 DNA-binding site gene transcriptions P box gene transcriptions Pdr1,3p gene transcriptions Peroxisome proliferator hormone response element gene transcriptions Phosphate starvation-response transcription factor gene transcriptions Pollen1 element gene transcriptions Polycomb response element gene transcriptions Preinitiation complex Preinitiation complex gene transcriptions Pribnow box gene transcriptions Prolamin box gene transcriptions Promoter gene transcriptions Proximal promoter gene transcriptions Promoter occurrence gene transcriptions Pyrimidine box gene transcriptions Q element gene transcriptions Rap1 regulatory factor gene transcriptions Reb1 general regulatory factor gene transcriptions Retinoblastoma control element gene transcriptions Retinoic acid response element gene transcriptions Rgt1p gene transcriptions Rlm1p gene transcriptions RNA polymerase II gene transcriptions RNA polymerase II holoenzyme complex Root specific element gene transcriptions ROR-response element gene transcriptions Rox1p gene transcriptions Rpn4p gene transcriptions R response element gene transcriptions SARE gene transcriptions Seed-specific element gene transcriptions Serum response element gene transcriptions Servenius sequence gene transcriptions Shoot specific element gene transcriptions Sip4p gene transcriptions Smp1p gene transcriptions Sp1 gene transcriptions Spaceflight gene expressions Specificity protein gene transcriptions STAT gene transcriptions Ste12p gene transcriptions Sterol response element gene transcriptions Sucrose box gene transcriptions Synaptic Activity-Responsive Elements TACTAAC box gene transcriptions TAGteam gene transcriptions Tapetum box gene transcriptions TATA binding protein associated factor gene transcriptions TATA binding protein gene transcriptions TATA box gene transcriptions TAT box gene transcriptions TATC box gene transcriptions Tbf1 regulatory factor gene transcriptions T box gene transcriptions TCCACCATA element gene transcriptions TC element gene transcriptions TCT gene transcriptions TEA consensus sequence gene transcriptions Tec1p gene transcriptions Telomeric repeat DNA-binding factor gene transcriptions Tetradecanoylphorbol-13-acetate response element gene transcriptions TGF-β control elements (TCEs) TGF-β inhibitory elements (TIEs) Thyroid hormone response element gene transcriptions Transcriptional regulation Transcription bubble gene transcriptions Transcription factor gene transcriptions Transcription factor 3 gene transcriptions Transcription factory gene transcriptions Transcription start site gene transcriptions Translational control sequence gene transcriptions U box gene transcriptions Unfolded protein response element gene transcriptions Upstream response element gene transcriptions Upstream stimulatory factor gene transcriptions UTR promoter gene transcriptions V and P box gene transcriptions V box gene transcriptions Vhr1p gene transcriptions Vitamin D response element gene transcriptions W box gene transcriptions X box gene transcriptions Xbp1p gene transcriptions X core promoter element gene transcriptions Xenobiotic response element gene transcriptions Xenobiotic responsive element gene transcriptions Yap1p,2p gene transcriptions Y box gene transcriptions YY1 gene transcriptions Zap1p gene transcriptions Z box gene transcriptions Zinc responsive element gene transcriptions