Oaf1p gene transcriptions: Difference between revisions
m (→External links) |
|||
(36 intermediate revisions by the same user not shown) | |||
Line 1: | Line 1: | ||
{{AE}} Henry A. Hoff | {{AE}} Henry A. Hoff | ||
"In ''S. cerevisiae'', peroxisomal proteins are repressed by glucose and induced by oleate (361). It has been shown that derepression of such proteins is dependent on Adr1 and on the Snf1 complex (320–322). Induction by oleate depends on a “peroxisome box” (110), also called the oleate response element (92), which is an imperfect palindrome including the consensus sequence CGGNNNTNA. There is evidence that the transcription factor binding this sequence is a heterodimer containing the proteins Oaf1 and Oaf2/Pip2, which are both C<sub>6</sub> zinc cluster proteins (165, 201, 293)."<ref name=Gancedo>{{ cite journal | |||
|author=Juana M. Gancedo | |||
|title=Yeast Carbon Catabolite Repression | |||
|journal=Microbiology and Molecular Biology Reviews | |||
|date=June 1998 | |||
|volume=62 | |||
|issue=2 | |||
|pages=334–361 | |||
|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC98918/ | |||
|arxiv= | |||
|bibcode= | |||
|doi= | |||
|pmid=9618445 | |||
|accessdate=6 February 2021 }}</ref> | |||
Oleate-activated transcription factor 1 is abbreviated Oaf1.<ref name=Mast>{{ cite book | |||
|author=Fred D. Mast and John D. Aitchison | |||
|title=Characterization of Peroxisomal Regulation Networks, In: ''Proteomics of Peroxisomes. Subcellular Biochemistry'' | |||
|publisher=Springer | |||
|location=Singapore | |||
|volume=89 | |||
|date=31 October 2018 | |||
|editor=del Río L., Schrader M. | |||
|pages=367-382 | |||
|url=https://link.springer.com/chapter/10.1007/978-981-13-2233-4_16 | |||
|arxiv= | |||
|bibcode= | |||
|doi=10.1007/978-981-13-2233-4_16 | |||
|pmid= | |||
|isbn=978-981-13-2232-7 | |||
|accessdate=10 February 2021 }}</ref> | |||
==Human genes== | ==Human genes== | ||
Line 7: | Line 39: | ||
==Consensus sequences== | ==Consensus sequences== | ||
The upstream activating sequence (UAS) for the Oaf1p | The upstream activating sequence (UAS) for the Oaf1p is CGGN<sub>3</sub>TNAN<sub>9-12</sub>.<ref name=Tang>{{ cite journal | ||
|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling | |author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling | ||
|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae'' | |title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae'' | ||
Line 22: | Line 54: | ||
|accessdate=18 September 2020 }}</ref> | |accessdate=18 September 2020 }}</ref> | ||
== | ==Oaf samplings== | ||
Copying CGGN<sub>3</sub>TNAN<sub>9-12</sub>CCG in "⌘F" yields none between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs. | Copying CGGN<sub>3</sub>TNAN<sub>9-12</sub>CCG in "⌘F" yields none between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs. | ||
Line 44: | Line 76: | ||
# inverse negative strand, positive direction, looking for GCCN<sub>9-12</sub>ANTN<sub>3</sub>GGC, 0. | # inverse negative strand, positive direction, looking for GCCN<sub>9-12</sub>ANTN<sub>3</sub>GGC, 0. | ||
===Oaf1 distal promoters=== | ===Oaf negative direction distal promoters=== | ||
{{main| | |||
# Negative strand, negative direction, Oaf4: CGGTCATGAAACCCTCCGACTCCG at 2229. | |||
===Oaf positive direction distal promoters=== | |||
# Positive strand, positive direction, Oaf1: CGGACGTGAGACCGCTCTCCG at 1484, CGGACGTGAGACCGCTCTCCG at 1384. | |||
==Oaf1 random dataset samplings== | |||
# Oaf1r0: 0. | |||
# Oaf1r1: 0. | |||
# Oaf1r2: 0. | |||
# Oaf1r3: 0. | |||
# Oaf1r4: 0. | |||
# Oaf1r5: 1, CGGTGTTAAGCCGGCCCCCCG at 1087. | |||
# Oaf1r6: 0. | |||
# Oaf1r7: 0. | |||
# Oaf1r8: 0. | |||
# Oaf1r9: 0. | |||
# Oaf1r0ci: 1, CGGAGAAAGTCTTTATGTCCG at 3378. | |||
# Oaf1r1ci: 0. | |||
# Oaf1r2ci: 0. | |||
# Oaf1r3ci: 0. | |||
# Oaf1r4ci: 0. | |||
# Oaf1r5ci: 0. | |||
# Oaf1r6ci: 1, CGGTAGGGCAGCTTATTCCCG at 1492. | |||
# Oaf1r7ci: 0. | |||
# Oaf1r8ci: 0. | |||
# Oaf1r9ci: 0. | |||
==Oaf2 random dataset samplings== | |||
# Oaf2r0: 1, CGGCGATGAACTAGGCGCGCCG at 3240. | |||
# Oaf2r1: 0. | |||
# Oaf2r2: 0. | |||
# Oaf2r3: 0. | |||
# Oaf2r4: 0. | |||
# Oaf2r5: 0. | |||
# Oaf2r6: 0. | |||
# Oaf2r7: 0. | |||
# Oaf2r8: 0. | |||
# Oaf2r9: 0. | |||
# Oaf2r0ci: 0. | |||
# Oaf2r1ci: 0. | |||
# Oaf2r2ci: 0. | |||
# Oaf2r3ci: 0. | |||
# Oaf2r4ci: 0. | |||
# Oaf2r5ci: 0. | |||
# Oaf2r6ci: 0. | |||
# Oaf2r7ci: 0. | |||
# Oaf2r8ci: 0. | |||
# Oaf2r9ci: 0. | |||
==Oaf3 random dataset samplings== | |||
# Oaf3r0: 0. | |||
# Oaf3r1: 0. | |||
# Oaf3r2: 0. | |||
# Oaf3r3: 0. | |||
# Oaf3r4: 0. | |||
# Oaf3r5: 0. | |||
# Oaf3r6: 0. | |||
# Oaf3r7: 0. | |||
# Oaf3r8: 0. | |||
# Oaf3r9: 0. | |||
# Oaf3r0ci: 0. | |||
# Oaf3r1ci: 0. | |||
# Oaf3r2ci: 1, CGGACTTCTTTATCTGACCGCCG at 3584. | |||
# Oaf3r3ci: 0. | |||
# Oaf3r4ci: 0. | |||
# Oaf3r5ci: 0. | |||
# Oaf3r6ci: 0. | |||
# Oaf3r7ci: 0. | |||
# Oaf3r8ci: 0. | |||
# Oaf3r9ci: 0. | |||
==Oaf4 element random dataset samplings== | |||
# Oaf4r0: 0. | |||
# Oaf4r1: 0. | |||
# Oaf4r2: 0. | |||
# Oaf4r3: 0. | |||
# Oaf4r4: 0. | |||
# Oaf4r5: 0. | |||
# Oaf4r6: 0. | |||
# Oaf4r7: 0. | |||
# Oaf4r8: 0. | |||
# Oaf4r9: 0. | |||
# Oaf4r0ci: 0. | |||
# Oaf4r1ci: 0. | |||
# Oaf4r2ci: 0. | |||
# Oaf4r3ci: 0. | |||
# Oaf4r4ci: 0. | |||
# Oaf4r5ci: 0. | |||
# Oaf4r6ci: 0. | |||
# Oaf4r7ci: 0. | |||
# Oaf4r8ci: 0. | |||
# Oaf4r9ci: 0. | |||
==Oaf random dataset results== | |||
===Oafr arbitrary (evens) (4560-2846) UTRs=== | |||
# Oaf1r0ci: CGGAGAAAGTCTTTATGTCCG at 3378. | |||
# Oaf2r0: CGGCGATGAACTAGGCGCGCCG at 3240. | |||
# Oaf3r2ci: CGGACTTCTTTATCTGACCGCCG at 3584. | |||
===Oafr arbitrary negative direction (evens) (2596-1) distal promoters=== | |||
# Oaf1r6ci: CGGTAGGGCAGCTTATTCCCG at 1492. | |||
===Oafr alternate negative direction (odds) (2596-1) distal promoters=== | |||
# Oaf1r5: CGGTGTTAAGCCGGCCCCCCG at 1087. | |||
===Oafr arbitrary positive direction (odds) (4050-1) distal promoters=== | |||
# Oaf1r5: CGGTGTTAAGCCGGCCCCCCG at 1087. | |||
===Oafr alternate positive direction (evens) (4050-1) distal promoters=== | |||
# Oaf1r0ci: CGGAGAAAGTCTTTATGTCCG at 3378. | |||
# Oaf1r6ci: CGGTAGGGCAGCTTATTCCCG at 1492. | |||
# Oaf2r0: CGGCGATGAACTAGGCGCGCCG at 3240. | |||
# Oaf3r2ci: CGGACTTCTTTATCTGACCGCCG at 3584. | |||
==Oleate-activated transcription factor analysis and results== | |||
{{main|Complex locus A1BG and ZNF497#Oafs}} | |||
The upstream activating sequence (UAS) for the Oaf1p is CGGN<sub>3</sub>TNAN<sub>9-12</sub>.<ref name=Tang/> | |||
{|class="wikitable" | |||
|- | |||
! Reals or randoms !! Promoters !! direction !! Numbers !! Strands !! Occurrences !! Averages (± 0.1) | |||
|- | |||
| Reals || UTR || negative || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || UTR || arbitrary negative || 3 || 10 || 0.3 || 0.15 | |||
|- | |||
| Randoms || UTR || alternate negative || 0 || 10 || 0 || 0.15 | |||
|- | |||
| Reals || Core || negative || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || Core || arbitrary negative || 0 || 10 || 0 || 0 | |||
|- | |||
| Randoms || Core || alternate negative || 0 || 10 || 0 || 0 | |||
|- | |||
| Reals || Core || positive || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || Core || arbitrary positive || 0 || 10 || 0 || 0 | |||
|- | |||
| Randoms || Core || alternate positive || 0 || 10 || 0 || 0 | |||
|- | |||
| Reals || Proximal || negative || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || Proximal || arbitrary negative || 0 || 10 || 0 || 0 | |||
|- | |||
| Randoms || Proximal || alternate negative || 0 || 10 || 0 || 0 | |||
|- | |||
| Reals || Proximal || positive || 0 || 2 || 0 || 0 | |||
|- | |||
| Randoms || Proximal || arbitrary positive || 0 || 10 || 0 || 0 | |||
|- | |||
| Randoms || Proximal || alternate positive || 0 || 10 || 0 || 0 | |||
|- | |||
| Reals || Distal || negative || 1 || 2 || 0.5 || 0.5 ± 0.5 (--1,+-0) | |||
|- | |||
| Randoms || Distal || arbitrary negative || 1 || 10 || 0.1 || 0.1 | |||
|- | |||
| Randoms || Distal || alternate negative || 1 || 10 || 0.1 || 0.1 | |||
|- | |||
| Reals || Distal || positive || 2 || 2 || 1 || 1 ± 1 (-+0,++2) | |||
|- | |||
| Randoms || Distal || arbitrary positive || 1 || 10 || 0.1 || 0.25 | |||
|- | |||
| Randoms || Distal || alternate positive || 4 || 10 || 0.4 || 0.25 | |||
|} | |||
Comparison: | |||
The occurrences of real oleate-activated transcription factors are greater than the randoms. This suggests that the real oafs are likely active or activable. | |||
==See also== | ==See also== | ||
{{div col|colwidth=20em}} | {{div col|colwidth=20em}} | ||
* [[A1BG gene transcription core promoters]] | |||
* [[A1BG gene transcriptions]] | |||
* [[A1BG regulatory elements and regions]] | |||
* [[A1BG response element negative results]] | |||
* [[A1BG response element positive results]] | |||
* [[Complex locus A1BG and ZNF497]] | * [[Complex locus A1BG and ZNF497]] | ||
{{Div col end}} | {{Div col end}} | ||
Line 65: | Line 277: | ||
<!-- footer categories --> | <!-- footer categories --> | ||
Latest revision as of 17:45, 5 September 2023
Associate Editor(s)-in-Chief: Henry A. Hoff
"In S. cerevisiae, peroxisomal proteins are repressed by glucose and induced by oleate (361). It has been shown that derepression of such proteins is dependent on Adr1 and on the Snf1 complex (320–322). Induction by oleate depends on a “peroxisome box” (110), also called the oleate response element (92), which is an imperfect palindrome including the consensus sequence CGGNNNTNA. There is evidence that the transcription factor binding this sequence is a heterodimer containing the proteins Oaf1 and Oaf2/Pip2, which are both C6 zinc cluster proteins (165, 201, 293)."[1]
Oleate-activated transcription factor 1 is abbreviated Oaf1.[2]
Human genes
Interactions
Consensus sequences
The upstream activating sequence (UAS) for the Oaf1p is CGGN3TNAN9-12.[3]
Oaf samplings
Copying CGGN3TNAN9-12CCG in "⌘F" yields none between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
For the Basic programs testing consensus sequence CGGN3TNAN9-12CCG (starting with SuccessablesOaf1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
- negative strand, negative direction, looking for CGGN3TNAN12CCG, 1, CGGTCATGAAACCCTCCGACTCCG at 2229.
- positive strand, negative direction, looking for CGGN3TNAN9-12CCG, 0.
- positive strand, positive direction, looking for CGGN3TNAN9CCG, 2, CGGACGTGAGACCGCTCTCCG at 1484, CGGACGTGAGACCGCTCTCCG at 1384.
- negative strand, positive direction, looking for CGGN3TNAN9-12CCG, 0.
- complement, negative strand, negative direction, looking for GCCN3ANTN9-12GGC, 0.
- complement, positive strand, negative direction, looking for GCCN3ANTN12GGC, 1, GCCAGTACTTTGGGAGGCTGAGGC at 2229.
- complement, positive strand, positive direction, looking for GCCN3ANTN9-12GGC, 0.
- complement, negative strand, positive direction, looking for GCCN3ANTN9GGC, 2, GCCTGCACTCTGGCGAGAGGC at 1484, GCCTGCACTCTGGCGAGAGGC at 1384.
- inverse complement, negative strand, negative direction, looking for CGGN9-12TNAN3CCG, 0.
- inverse complement, positive strand, negative direction, looking for CGGN9-12TNAN3CCG, 0.
- inverse complement, positive strand, positive direction, looking for CGGN9-12TNAN3CCG, 0.
- inverse complement, negative strand, positive direction, looking for CGGN9-12TNAN3CCG, 0.
- inverse negative strand, negative direction, looking for GCCN9-12ANTN3GGC, 0.
- inverse positive strand, negative direction, looking for GCCN9-12ANTN3GGC, 0.
- inverse positive strand, positive direction, looking for GCCN9-12ANTN3GGC, 0.
- inverse negative strand, positive direction, looking for GCCN9-12ANTN3GGC, 0.
Oaf negative direction distal promoters
- Negative strand, negative direction, Oaf4: CGGTCATGAAACCCTCCGACTCCG at 2229.
Oaf positive direction distal promoters
- Positive strand, positive direction, Oaf1: CGGACGTGAGACCGCTCTCCG at 1484, CGGACGTGAGACCGCTCTCCG at 1384.
Oaf1 random dataset samplings
- Oaf1r0: 0.
- Oaf1r1: 0.
- Oaf1r2: 0.
- Oaf1r3: 0.
- Oaf1r4: 0.
- Oaf1r5: 1, CGGTGTTAAGCCGGCCCCCCG at 1087.
- Oaf1r6: 0.
- Oaf1r7: 0.
- Oaf1r8: 0.
- Oaf1r9: 0.
- Oaf1r0ci: 1, CGGAGAAAGTCTTTATGTCCG at 3378.
- Oaf1r1ci: 0.
- Oaf1r2ci: 0.
- Oaf1r3ci: 0.
- Oaf1r4ci: 0.
- Oaf1r5ci: 0.
- Oaf1r6ci: 1, CGGTAGGGCAGCTTATTCCCG at 1492.
- Oaf1r7ci: 0.
- Oaf1r8ci: 0.
- Oaf1r9ci: 0.
Oaf2 random dataset samplings
- Oaf2r0: 1, CGGCGATGAACTAGGCGCGCCG at 3240.
- Oaf2r1: 0.
- Oaf2r2: 0.
- Oaf2r3: 0.
- Oaf2r4: 0.
- Oaf2r5: 0.
- Oaf2r6: 0.
- Oaf2r7: 0.
- Oaf2r8: 0.
- Oaf2r9: 0.
- Oaf2r0ci: 0.
- Oaf2r1ci: 0.
- Oaf2r2ci: 0.
- Oaf2r3ci: 0.
- Oaf2r4ci: 0.
- Oaf2r5ci: 0.
- Oaf2r6ci: 0.
- Oaf2r7ci: 0.
- Oaf2r8ci: 0.
- Oaf2r9ci: 0.
Oaf3 random dataset samplings
- Oaf3r0: 0.
- Oaf3r1: 0.
- Oaf3r2: 0.
- Oaf3r3: 0.
- Oaf3r4: 0.
- Oaf3r5: 0.
- Oaf3r6: 0.
- Oaf3r7: 0.
- Oaf3r8: 0.
- Oaf3r9: 0.
- Oaf3r0ci: 0.
- Oaf3r1ci: 0.
- Oaf3r2ci: 1, CGGACTTCTTTATCTGACCGCCG at 3584.
- Oaf3r3ci: 0.
- Oaf3r4ci: 0.
- Oaf3r5ci: 0.
- Oaf3r6ci: 0.
- Oaf3r7ci: 0.
- Oaf3r8ci: 0.
- Oaf3r9ci: 0.
Oaf4 element random dataset samplings
- Oaf4r0: 0.
- Oaf4r1: 0.
- Oaf4r2: 0.
- Oaf4r3: 0.
- Oaf4r4: 0.
- Oaf4r5: 0.
- Oaf4r6: 0.
- Oaf4r7: 0.
- Oaf4r8: 0.
- Oaf4r9: 0.
- Oaf4r0ci: 0.
- Oaf4r1ci: 0.
- Oaf4r2ci: 0.
- Oaf4r3ci: 0.
- Oaf4r4ci: 0.
- Oaf4r5ci: 0.
- Oaf4r6ci: 0.
- Oaf4r7ci: 0.
- Oaf4r8ci: 0.
- Oaf4r9ci: 0.
Oaf random dataset results
Oafr arbitrary (evens) (4560-2846) UTRs
- Oaf1r0ci: CGGAGAAAGTCTTTATGTCCG at 3378.
- Oaf2r0: CGGCGATGAACTAGGCGCGCCG at 3240.
- Oaf3r2ci: CGGACTTCTTTATCTGACCGCCG at 3584.
Oafr arbitrary negative direction (evens) (2596-1) distal promoters
- Oaf1r6ci: CGGTAGGGCAGCTTATTCCCG at 1492.
Oafr alternate negative direction (odds) (2596-1) distal promoters
- Oaf1r5: CGGTGTTAAGCCGGCCCCCCG at 1087.
Oafr arbitrary positive direction (odds) (4050-1) distal promoters
- Oaf1r5: CGGTGTTAAGCCGGCCCCCCG at 1087.
Oafr alternate positive direction (evens) (4050-1) distal promoters
- Oaf1r0ci: CGGAGAAAGTCTTTATGTCCG at 3378.
- Oaf1r6ci: CGGTAGGGCAGCTTATTCCCG at 1492.
- Oaf2r0: CGGCGATGAACTAGGCGCGCCG at 3240.
- Oaf3r2ci: CGGACTTCTTTATCTGACCGCCG at 3584.
Oleate-activated transcription factor analysis and results
The upstream activating sequence (UAS) for the Oaf1p is CGGN3TNAN9-12.[3]
Reals or randoms | Promoters | direction | Numbers | Strands | Occurrences | Averages (± 0.1) |
---|---|---|---|---|---|---|
Reals | UTR | negative | 0 | 2 | 0 | 0 |
Randoms | UTR | arbitrary negative | 3 | 10 | 0.3 | 0.15 |
Randoms | UTR | alternate negative | 0 | 10 | 0 | 0.15 |
Reals | Core | negative | 0 | 2 | 0 | 0 |
Randoms | Core | arbitrary negative | 0 | 10 | 0 | 0 |
Randoms | Core | alternate negative | 0 | 10 | 0 | 0 |
Reals | Core | positive | 0 | 2 | 0 | 0 |
Randoms | Core | arbitrary positive | 0 | 10 | 0 | 0 |
Randoms | Core | alternate positive | 0 | 10 | 0 | 0 |
Reals | Proximal | negative | 0 | 2 | 0 | 0 |
Randoms | Proximal | arbitrary negative | 0 | 10 | 0 | 0 |
Randoms | Proximal | alternate negative | 0 | 10 | 0 | 0 |
Reals | Proximal | positive | 0 | 2 | 0 | 0 |
Randoms | Proximal | arbitrary positive | 0 | 10 | 0 | 0 |
Randoms | Proximal | alternate positive | 0 | 10 | 0 | 0 |
Reals | Distal | negative | 1 | 2 | 0.5 | 0.5 ± 0.5 (--1,+-0) |
Randoms | Distal | arbitrary negative | 1 | 10 | 0.1 | 0.1 |
Randoms | Distal | alternate negative | 1 | 10 | 0.1 | 0.1 |
Reals | Distal | positive | 2 | 2 | 1 | 1 ± 1 (-+0,++2) |
Randoms | Distal | arbitrary positive | 1 | 10 | 0.1 | 0.25 |
Randoms | Distal | alternate positive | 4 | 10 | 0.4 | 0.25 |
Comparison:
The occurrences of real oleate-activated transcription factors are greater than the randoms. This suggests that the real oafs are likely active or activable.
See also
References
- ↑ Juana M. Gancedo (June 1998). "Yeast Carbon Catabolite Repression". Microbiology and Molecular Biology Reviews. 62 (2): 334–361. PMID 9618445. Retrieved 6 February 2021.
- ↑ Fred D. Mast and John D. Aitchison (31 October 2018). del Río L., Schrader M., ed. Characterization of Peroxisomal Regulation Networks, In: Proteomics of Peroxisomes. Subcellular Biochemistry. 89. Singapore: Springer. pp. 367–382. doi:10.1007/978-981-13-2233-4_16. ISBN 978-981-13-2232-7. Retrieved 10 February 2021.
- ↑ 3.0 3.1 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check
|pmid=
value (help). Retrieved 18 September 2020.
External links