All public logs
Jump to navigation
Jump to search
Combined display of all available logs of wikidoc. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
- 18:02, 3 March 2024 Marshallsumter talk contribs created page Non-degenerate nucleotides per response element (Created page with " {| class="wikitable sortable" |+ Number of non-degenerate nucleotides versus number of response elements |- ! Number of nucleotides !! Letters of nucleotides !! Number of response elements !! Average ± deviation !! Order of list |- | 1 || A || 295 || 295.0 ± 0.0 || 1 |- | 1 || T || 285 || - || 1 |- | 1 || G || 286 || - || 3 |- | 1(4) || C || 300 || 291.5 ± 6 || 5 |- | 2 || AA || 105 || 105 ± 0.0 || 1 |- | 2 || AT || 105 || 105 ± 0.0 || 1 |- | 2 || TA || 74 |...")
- 23:23, 23 July 2023 Marshallsumter talk contribs created page Initiator-like element gene transcriptions (Created page with " Consensus sequence for an Inr-like/TCT is TTCTCT.<ref name=Matsumoto>{{ cite journal |author=Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima |title=Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes'' |journal=Fisheries Science |date=9 August 2020 |volume=86 |issue= |pages=873-887 |url=https://researchmap.jp/hiroyukihar...")
- 07:39, 5 April 2023 Marshallsumter talk contribs created page ''Asparagaceae'' (Created page with "Asparagaceae, known as the asparagus family, is a family of flowering plants, placed in the order Asparagales of the monocots.<ref name="APG3">{{Cite journal |last=Angiosperm Phylogeny Group III|year=2009 |title=An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III |journal=Botanical Journal of the Linnean Society|volume=161 |issue=2|pages=105–121|doi=10.1111/j.1095-8339.2009....")
- 07:09, 5 April 2023 Marshallsumter talk contribs created page Remedy (Created page with "thumb|upright|Modern drug ampoules are shown. Credit: [[c:user:Ignis|ignis.]] {{AE}} Henry A. Hoff '''Def.''' "a medicine, application, or treatment that relieves or cures a disease"<ref name=RemedyWikt>{{ cite web |author=Deekayen |title=remedy |publisher=Wikimedia Foundation, Inc |location=San Francisco, California |date=19 April 2005 |url=http://en.wiktionary.org/wiki/remedy |accessdate=2013-06-17 }}</ref> is called a '''remedy'''. {{cl...")
- 14:33, 19 February 2023 Marshallsumter talk contribs created page User talk:Jose Loyola (Created page with "==Autoblock== Hi Jose Loyola! My IP was blocked for 24 hours: "Your IP address has been automatically blocked because it was used by another user, who was blocked by Jose Loyola. The reason given is: Autoblocked because your IP address has been recently used by "Sara Zand"." I sent you an email that stated my IP and it's not the one in the email. "The reason given for Sara Zand's block is "Intimidating behavior/harassment: Removing content from pages" Start of...")
- 06:37, 13 November 2022 Marshallsumter talk contribs created page General regulatory factors (Created page with ""General regulatory factors (GRFs), such as Reb1, Abf1, Rap1, Mcm1, and Cbf1, positionally organize yeast chromatin through interactions with a core consensus DNA sequence."<ref name=Rossi>{{ cite journal |author=Matthew J. Rossi |author2=William K.M. Lai |author3=B. Franklin Pugh |title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors |journal=Genome Research |date=21 March 2018 |volume=28 |issue= |pages=497-508 |url=https://genome...")
- 21:43, 21 August 2021 Marshallsumter talk contribs created page Helix-turn-helix transcription factors (Created page with "200px|thumb|The λ repressor of [[bacteriophage lambda employs two helix-turn-helix motifs (left; green) to bind DNA (right; blue and r...")
- 15:52, 14 August 2021 Marshallsumter talk contribs created page WD-40 repeat family (Created page with "{{AE}} Henry A. Hoff "Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During ''Phaseolus vulgaris'' root d...")
- 00:43, 27 July 2021 Marshallsumter talk contribs created page Basic helix–loop–helix (Created page with "{{AE}} Henry A. Hoff {{distinguish|text=helix-turn-helix domains, a motif similar in shape and function}} {{Pfam_box | Symbol = bHLH | Name = basic helix–loop–helix DN...")
- 01:36, 9 June 2021 Marshallsumter talk contribs created page Tbf1 regulatory factor gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Ribosome biogenesis in ''Saccharomyces cerevisiae'' involves a regulon of >200 genes (Ribi genes) coordinately regulated in response to nutrient availab...")
- 05:04, 7 May 2021 Marshallsumter talk contribs created page Hypoxia response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "We recently discovered a strongly conserved distal 5' [hypoxia response element] HRE and suggested that it might contribute to oxygen-regulated [Erythro...")
- 04:53, 27 April 2021 Marshallsumter talk contribs created page Cytokinin response regulator gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Cytokinin fulfills its diverse roles in planta through a series of transcriptional responses."<ref name=Xiel>{{ cite journal |author=Mingtang Xie1, Hong...")
- 04:58, 22 April 2021 Marshallsumter talk contribs created page TEA consensus sequence gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The TEA/ATTS transcription factor family consists of mammalian, avian, nematode, insect and fungal members that share a conserved TEA domain. The TEA do...")
- 06:32, 21 April 2021 Marshallsumter talk contribs created page GGC triplet gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins), and they recognize highly re...")
- 05:23, 20 April 2021 Marshallsumter talk contribs created page Translational control sequence gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Maternal mRNAs are translationally regulated during early development. Zar1 and its closely related homolog, Zar2, are both crucial in early development...")
- 17:14, 19 April 2021 Marshallsumter talk contribs created page Cell-cycle box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The 5' non-coding part contains the sequence elements characteristic for eukaryotic promoters such as TATA and CAAT boxes as well as an inverted motif t...")
- 02:22, 18 April 2021 Marshallsumter talk contribs created page Musashi binding element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The 24-nt ''Xenopus'' Mos [polyadenylation response element] PRE (Charlesworth ''et al'', 2002) contained a match to the SELEX-derived murine Musashi RN...")
- 20:10, 17 April 2021 Marshallsumter talk contribs created page Cytoplasmic polyadenylation element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The most well-understood mechanism for controlling cytoplasmic polyadenylation is regulation of mRNAs containing the cytoplasmic polyadenylation element...")
- 15:36, 1 April 2021 Marshallsumter talk contribs created page Copper response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "''Chlamydomonas reinhardtii'' activates the transcription of the ''Cyc6'' and the ''Cpx1'' genes (encoding cytochrome ''c<sub>6</sub>'' and coprogen oxi...")
- 05:05, 24 March 2021 Marshallsumter talk contribs created page Adenylate–uridylate rich element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Functionally defined and derived adenylate–uridylate rich element (ARE) consensus sequences have been shown to exist in the 3′UTR of selected mRNAs...")
- 18:42, 19 March 2021 Marshallsumter talk contribs created page N box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Human pColQ1a carries consensus sequences for transcriptional factors E-protein (E-box, CANNTG), NFAT (GGAAA), c-Ets transcription factor [c-Ets, (C/A)G...")
- 20:35, 17 March 2021 Marshallsumter talk contribs created page K-box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "In fact, the ''groE'' genes were greatly induced upon heat shock in the ''hrcA'' mutant which was dark-treated prior to the heat shock in order to keep...")
- 03:32, 12 March 2021 Marshallsumter talk contribs created page YY1 gene transcriptions (Created page with "{{AE}} Henry A. Hoff "To further explore how [high-glucose] HG regulates ''Tug1'' transcription, we retrieved the promoter region of the murine ''Tug1'' gene to identify pote...")
- 20:35, 8 March 2021 Marshallsumter talk contribs created page Vhr1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Transcription of the ''Saccharomyces cerevisiae'' vitamin H transporter gene VHT1 is enhanced by low extracellular biotin."<ref name=Weider>{{ cite jour...")
- 14:24, 7 March 2021 Marshallsumter talk contribs created page Transcription factor 3 gene transcriptions (Created page with "{{AE}} Henry A. Hoff Transcription factor 3 (E2A immunoglobulin enhancer-binding factors E12/E47) (TCF3), is a protein that in humans is encoded by the ''TCF3'' gen...")
- 18:27, 6 March 2021 Marshallsumter talk contribs created page UTR promoter gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} ==Gene expressions== {{main|Gene expressions}} ==Interactions== {{main|Interaction gene transcriptions}} ==Consen...")
- 02:42, 2 March 2021 Marshallsumter talk contribs created page Sucrose box gene transcriptions (Created page with "{{AE}} Henry A. Hoff Manual "scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 19...")
- 02:55, 25 February 2021 Marshallsumter talk contribs created page Sip4p gene transcriptions (Created page with "{{AE}} Henry A. Hoff The UAS sequence for the transcription factor Sip4p is CCRTYCRTCCG, which occurs in the promoters of ''FBP1, PKC1, ICL1'' genes in ''S. cerevisiae'', wit...")
- 19:37, 24 February 2021 Marshallsumter talk contribs created page A1BG response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff '''Def.''' nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to v...")
- 03:27, 24 February 2021 Marshallsumter talk contribs created page Bioinformatics tool gene transcriptions (Created page with "{{AE}} Henry A. Hoff '''Def.''' a "field of science in which biology, computer science, and information technology merge into a single discipline to analyse biological inform...")
- 01:55, 24 February 2021 Marshallsumter talk contribs created page Complement copy gene transcriptions (Created page with "{{AE}} Henry A. Hoff '''Def.''' a "nucleotide sequence in which each base is replaced by the complementary base of the given sequence: adenine (A) by thymine (T) or uracil (U...")
- 22:16, 23 February 2021 Marshallsumter talk contribs created page Serum response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box,...")
- 22:10, 23 February 2021 Marshallsumter talk contribs created page Inverse copy gene transcriptions (Created page with "{{AE}} Henry A. Hoff '''Def.''' "a state in which something has been turned (properly) upside down or (loosely) inside out or backwards"<ref name=InverseWikt>{{ cite web |aut...")
- 18:54, 22 February 2021 Marshallsumter talk contribs created page Rox1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "All promoters recognized by pol-II may require one or more UASs for regulated gene expression [36,37]."<ref name=Tang/> ==Human genes== {{main|Human ge...")
- 19:43, 21 February 2021 Marshallsumter talk contribs created page Leu3 gene transcriptions (Created page with "{{AE}} Henry A. Hoff With ''HAS1'' ending at zero and ''TDA1'' beginning at above 1000 bp, Leu3 is from 536 - 545 nts yielding consensus sequences (C/G)C(G/T)NNNN(A/C)G(C/G),...")
- 04:21, 21 February 2021 Marshallsumter talk contribs created page Rgt1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Using MAP-C [Mutation Analysis in Pools by Chromosome conformation capture], we show that inducible interchromosomal pairing between ''HAS1pr-TDA1pr'' a...")
- 03:01, 16 February 2021 Marshallsumter talk contribs created page Xenobiotic responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff The classical recognition motif of the AhR/ARNT complex, referred to as either the AhR-, dioxin- or xenobiotic- responsive element (AHRE, DRE or XRE), co...")
- 04:22, 11 February 2021 Marshallsumter talk contribs created page ORE1 binding site gene transcriptions (Created page with "{{AE}} Henry A. Hoff "As a transcription factor, ORE1 was reported to bind to consensus DNA sequences of [ACG][CA]GT[AG]N{5,6}[CT]AC[AG] [29] or T[TAG][GA]CGT[GA][TCA][TAG] [...")
- 02:09, 11 February 2021 Marshallsumter talk contribs created page Zinc responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "A robust set of genes that responded consistently to Zn limitation was identified, and the set enabled the definition of the Zn-specific Zap1p regulon,...")
- 03:12, 10 February 2021 Marshallsumter talk contribs created page Carbon source-responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Deletion analysis of the ICL1 promoter led to the identification of an upstream activating sequence element, UASICL1 (5' CATTCATCCG 3'), necessary and s...")
- 05:03, 7 February 2021 Marshallsumter talk contribs created page Msn2,4p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "[msn2p] is a transcription factor that binds to stress-response elements (STREs) resulting in the induction of more than 200 genes.10,11 STRE has a core...")
- 00:32, 5 February 2021 Marshallsumter talk contribs created page Met31p box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The transcriptional regulation of the sulfur amino acid pathway in Saccharomyces cerevisiae depends on a single activator, Met4p, whose function require...")
- 03:59, 14 January 2021 Marshallsumter talk contribs created page Hex sequence gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} ==Consensus sequences== {{main|Consensus sequence gene transcriptions}} The Hex sequence has the consensus (TGACGTG...")
- 18:35, 3 January 2021 Marshallsumter talk contribs created page Gene project (Created page with "Each of the gene infoboxes on WikiDoc display "VALUE_ERROR (nil)" at the top instead of the gene name followed by answers obtained from WikiData for each entry. Compare ZSCAN...")
- 04:26, 28 December 2020 Marshallsumter talk contribs created page Ethylene responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} ==Consensus sequences== {{main|Consensus sequence gene transcriptions}} Ethylene responsive elements (ATTTCAAA).<re...")
- 05:35, 26 December 2020 Marshallsumter talk contribs created page Endosperm expression gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} ==Gene expressions== {{main|Gene expressions}} ==Consensus sequences== {{main|Consensus sequence gene transcriptio...")
- 03:02, 21 December 2020 Marshallsumter talk contribs created page EIN3 binding site gene transcriptions (Created page with "{{AE}} Henry A. Hoff "We scanned the ORE1 promoter and found a putative EIN3 binding site (EBS), ATGAACCT, located 1056~1064 bp upstream from the start codon (ATG) of the gen...")
- 23:18, 30 November 2020 Marshallsumter talk contribs created page Coupling element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the cou...")
- 02:37, 30 November 2020 Marshallsumter talk contribs created page Circadian control element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The circadian control element (circadian; Anderson ''et al.'', 1994) was found in 10 FvTCP genes."<ref name=Wei>{{ cite journal |author=Wei Wei, Yang Hu...")
- 02:52, 28 November 2020 Marshallsumter talk contribs created page A1BG response element positive results (Created page with "{{AE}} Henry A. Hoff '''Def.''' nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to v...")
- 16:41, 26 November 2020 Marshallsumter talk contribs created page A1BG response element negative results (Created page with "{{AE}} Henry A. Hoff '''Def.''' nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to v...")
- 02:03, 23 November 2020 Marshallsumter talk contribs created page Cold-responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff A "putative cold-responsive element (CRE) [...] is specified by a conserved 5-bp core sequence (CCGAC) typical for C-repeat (CRT)/dehydration-responsive...")
- 18:31, 11 November 2020 Marshallsumter talk contribs created page Auxin response factor gene transcriptions (Created page with "{{AE}} Henry A. Hoff The "genome binding of two [auxin response factors] ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferre...")
- 04:15, 9 November 2020 Marshallsumter talk contribs created page Interferon regulatory factor gene transcriptions (Created page with "{{AE}} Henry A. Hoff Interferon regulatory factors (IRF) are proteins which regulate transcription of interferons (see regulation of gene expression).<ref name="pmid1...")
- 20:07, 7 November 2020 Marshallsumter talk contribs created page Carbohydrate response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff A high glucose "HG environment promotes [carbohydrate response element-binding protein] ChREBP translocation to the nucleus leading to formation of a het...")
- 05:14, 7 November 2020 Marshallsumter talk contribs created page Calcium-response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} Gene ID: 106736470 is LOC106736470 PTH negative calcium response element (nCARE) region on chromosome 11: "This regi...")
- 06:49, 6 November 2020 Marshallsumter talk contribs created page CadC binding domain gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Dimerization of [cadaverine C-terminal] CadC enables the binding of two DBDs to the two Cad1 consensus target sites."<ref name=Schlundt/> ==Consensus s...")
- 03:30, 2 November 2020 Marshallsumter talk contribs created page Androgen response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Androgen receptors (ARs) (NR3C4; nuclear receptor subfamily 3,group C, member 4) have a crucial role in the development,function and homeostasis of PCa...")
- 00:10, 1 November 2020 Marshallsumter talk contribs created page Amino acid response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Many amino acid transporters contain an amino acid response element (AARE) in their promoters (27). [...] Inspection of the regulatory elements of ASCT1...")
- 20:30, 31 October 2020 Marshallsumter talk contribs created page Alpha-amylase conserved element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "A few genes were also noticed with the shoot (GATAatGATG) and root (TGACGTCA) specific elements, cell cycle regulation (CCCAACGGT), seed-specific elemen...")
- 01:48, 31 October 2020 Marshallsumter talk contribs created page Adr1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "''Saccharomyces cerevisiae'' Alcohol dehydrogenase repressor 1 (Adr1p, YDR216W) is the transcription activator of the ADH2 gene (alcohol dehydrogenase 2...")
- 23:20, 30 October 2020 Marshallsumter talk contribs created page A1BG regulatory elements and regions (Created page with "It may be still fair to say that in the apparent present era of functional genomics, the challenge is to elucidate gene function such as that of A1BG, its likely regulatory ne...")
- 02:57, 25 October 2020 Marshallsumter talk contribs created page Activating transcription factor gene transcriptions (Created page with "{{AE}} Henry A. Hoff Activating transcription factor (ATF) is a group of bZIP transcription factors, which act as homodimers or heterodimers with a range...")
- 01:23, 25 October 2020 Marshallsumter talk contribs created page Activating protein gene transcriptions (Created page with "{{AE}} Henry A. Hoff Activating Protein 2 (AP-2) is a family of closely related transcription factors<ref name="pmid1998122">{{ cite journal |vauthors =Williams T, Tjian...")
- 17:47, 10 October 2020 Marshallsumter talk contribs created page Abf1 regulatory factor gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} Gene ID: 9242 is MSC musculin on 8q13.3 aka ABF1; MYOR; ABF-1; bHLHa22: "The protein encoded by this gene is a trans...")
- 03:06, 8 October 2020 Marshallsumter talk contribs created page ABA-response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The key ''cis''-elements in [non-yellow coloring 1] ''NYC1'' promoter, namely, ABA-response element (ABRE) (ACGTG), ACGT, GCCcore (GCCGCC), and ''ethyle...")
- 03:04, 7 October 2020 Marshallsumter talk contribs created page Antioxidant-electrophile responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Consensus sequences== 5'-GTGAGGTCGC-3'<ref name=Otsuki>{{ cite journal |author=Akihito Otsuki, Mikiko Suzuki, Fumiki Katsuoka, Kouhei Tsuchida, Hiromi...")
- 03:34, 3 October 2020 Marshallsumter talk contribs created page DNA replication-related element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The promoters of ''Drosophila'' genes encoding DNA replication-related proteins contain transcription regulatory elements consisting of an 8-bp palindro...")
- 03:31, 3 October 2020 Marshallsumter talk contribs created page DAF-16 binding element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "DAF-16 binding element (DBE), GTAAACA or TGTTTAC, and DAF-16-associated element (DAE), TGATAAG or CTTATCA, enriched in DAF-16 regulated genes [2, 4, 13,...")
- 03:00, 3 October 2020 Marshallsumter talk contribs created page DAF-16-associated element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "DAF-16 binding element (DBE), GTAAACA or TGTTTAC, and DAF-16-associated element (DAE), TGATAAG or CTTATCA, enriched in DAF-16 regulated genes [2, 4, 13,...")
- 02:46, 3 October 2020 Marshallsumter talk contribs created page Cell cycle regulation gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Consensus sequences== Cell cycle regulation (CCCAACGGT).<ref name=Sharma>{{ cite journal |author=Bhaskar Sharma & Joemar Taganna |title=Genome-wide a...")
- 02:40, 3 October 2020 Marshallsumter talk contribs created page C-EBP box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "ATF4 regulates transcription of its target genes through the formation of homodimers or heterooligomers with the transcription factors Jun, AP-1 and C/E...")
- 02:09, 3 October 2020 Marshallsumter talk contribs created page CCCTC-binding factor gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Consensus sequences== "Experiments using chromatin immunoprecipitation exonuclease (ChIP-exo) uncovered a broad CTCF-binding motif that contains a 12...")
- 02:12, 2 October 2020 Marshallsumter talk contribs created page Defense and stress-responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Consensus sequences== Defense and stress-responsive elements (ATTTTCTTCA).<ref name=Sharma>{{ cite journal |author=Bhaskar Sharma & J...")
- 02:01, 2 October 2020 Marshallsumter talk contribs created page Endoplasmic reticulum stress response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Consensus sequences== "The released aminoterminal of ATF6 (ATF6-N) then migrates to the nucleus and binds to the ER stress response e...")
- 03:15, 1 October 2020 Marshallsumter talk contribs created page Estrogen response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Consensus sequences== "The [...] estrogen response element (ERE) [was] located on [...] −94 to −80 "AGGTTATTGCCTCCT" on the trans...")
- 16:33, 29 September 2020 Marshallsumter talk contribs created page Kozak sequence gene transcriptions (Created page with "{{AE}} Henry A. Hoff The Kozak sequence is a nucleic acid motif that functions as the protein translation initiation site in most eukaryotic mRNA transcripts.<ref nam...")
- 02:58, 23 September 2020 Marshallsumter talk contribs created page Gcr1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Consensus sequences== The upstream activating sequence (UAS) for Gcr1p is 5'-CTTCC-3' for the transcriptional activator involved in t...")
- 04:36, 22 September 2020 Marshallsumter talk contribs created page Rlm1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Consensus sequences== The upstream activating sequence (UAS) for Rlm1p is 5'-CTA(T/A)(T/A)(T/A)(T/A)TAG-3' regarding maintenance of c...")
- 04:17, 22 September 2020 Marshallsumter talk contribs created page Smp1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Consensus sequences== The upstream activating sequence (UAS) for Smp1p is 5'-ACTACTA(T/A)<sub>4</sub>TAG-3' in the promoters of ''STL...")
- 04:02, 22 September 2020 Marshallsumter talk contribs created page Zap1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Consensus sequences== The upstream activating sequence (UAS) for Zap1p is 5'-ACC(C/T)(C/T)(A/C/G/T)AAGGT-3' in the promoters of ''ZRT...")
- 01:08, 22 September 2020 Marshallsumter talk contribs created page Xbp1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for the Xbp1p is 5'-GcCTCGA(G/A)G(C/A)g(a/g)-3'.<ref n...")
- 13:05, 20 September 2020 Marshallsumter talk contribs created page Ndt80p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for the Ndt80p is 5'-DNCRCAAAW-3'.<ref name=Tang>{{ ci...")
- 12:54, 20 September 2020 Marshallsumter talk contribs created page Rpn4p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for the Rpn4p is 5'-GGTGGCAAA-3'.<ref name=Tang>{{ cit...")
- 02:48, 20 September 2020 Marshallsumter talk contribs created page Pdr1,3p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for the Pdr1p/Pdr3p is 5'-TCCGCGGA-3'.<ref name=Tang>{...")
- 02:09, 20 September 2020 Marshallsumter talk contribs created page Oaf1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for the Oaf1p transcription factor is 5'-CGGN<sub>3</s...")
- 01:41, 20 September 2020 Marshallsumter talk contribs created page Mig1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for the Mig1p transcription factor is 5'-SYGGGG-3' or...")
- 01:09, 20 September 2020 Marshallsumter talk contribs created page Hsf1p gene transcriptions (a/c/g/t)
- 00:36, 20 September 2020 Marshallsumter talk contribs created page Hac1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for Hac1p is 5'-CAGCGTG-3'.<ref name=Tang>{{ cite jour...")
- 00:21, 20 September 2020 Marshallsumter talk contribs created page Tec1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for Tec1p is 5'-GAATGT-3'.<ref name=Tang>{{ cite journ...")
- 22:28, 19 September 2020 Marshallsumter talk contribs created page Ste12p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for Ste12p is 5'-TGAAAC-3'.<ref name=Tang>{{ cite jour...")
- 21:43, 19 September 2020 Marshallsumter talk contribs created page Aft1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for Aft1p is 5'-PyPuCACCCPu-3' or 5'-(C/T)(A/G)CACCC(...")
- 20:05, 19 September 2020 Marshallsumter talk contribs created page Cat8p gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence (UAS) for Cat8p is 5'-CGGNBNVMHGGA-3', where N = A, C, G, T,...")
- 18:19, 19 September 2020 Marshallsumter talk contribs created page Calcineurin-responsive transcription factor gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== The upstream activating sequence for the calcineurin-responsive transcription factor (Crz1p)...")
- 17:10, 19 September 2020 Marshallsumter talk contribs created page Yap1p,2p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The activity of the native ''TRX2'' promoter, which is regulated by the transcription factor Yap1p, can be altered by sensing NADPH/NADP<sup>+</sup> rat...")
- 03:35, 19 September 2020 Marshallsumter talk contribs created page Gcn4p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The saturation mutagenesis of the transcription factor Gcn4p’s binding site (5′-ATGACTCTT-3′) within the ''HIS3'' promoter found that almost all m...")
- 03:05, 19 September 2020 Marshallsumter talk contribs created page Gal4p gene transcriptions (Created page with "{{AE}} Henry A. Hoff P<sub>GAL1</sub> is often used repeatedly for the expression of different enzymes in the construction of metabolic pathways [13], so the gene copy number...")
- 01:37, 18 September 2020 Marshallsumter talk contribs created page Inositol, choline-responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "When fused to the DNA-binding domain of [𝛃-galactosidase (Gal)] Gal4p, Ino2p but not Ino4p was able to activate a [upstream activation site] UAS<sub>...")
- 02:15, 17 September 2020 Marshallsumter talk contribs created page Forkhead box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Forkhead box (Fox) proteins are a superfamily of evolutionarily conserved transcriptional regulators, which control a wide spectrum of biological proces...")
- 12:34, 16 September 2020 Marshallsumter talk contribs created page Gibberellin responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== ==Interactions== ==Consensus sequences== Gibberellin responsive elements (CCTTTTG, AAACAGA).<ref name=Sharma>{{ cite journal |author=...")