User contributions for Marshallsumter
Jump to navigation
Jump to search
6 March 2021
- 02:3802:38, 6 March 2021 diff hist −280 m A1BG regulatory elements and regions →Telomeric repeat DNA-binding factors
- 02:3002:30, 6 March 2021 diff hist +460 m Telomeric repeat DNA-binding factor gene transcriptions →TRF samplings
5 March 2021
- 18:4018:40, 5 March 2021 diff hist +2,095 m Telomeric repeat DNA-binding factor gene transcriptions →Samplings
- 17:4617:46, 5 March 2021 diff hist 0 m Template:Gene project No edit summary
- 17:4317:43, 5 March 2021 diff hist −2 m A1BG response element negative results →Response element negative results
- 17:4117:41, 5 March 2021 diff hist −3 m A1BG response element gene transcriptions →Response element testing
- 17:3917:39, 5 March 2021 diff hist −3 m A1BG regulatory elements and regions →External links
- 17:3817:38, 5 March 2021 diff hist +1,544 m TC element gene transcriptions →TCE samplings
- 04:3704:37, 5 March 2021 diff hist +116 m A1BG response element positive results →Response element positive results
- 04:0804:08, 5 March 2021 diff hist +2 m A1BG response element gene transcriptions →Response element testing
4 March 2021
- 14:4014:40, 4 March 2021 diff hist −3 m A1BG response element gene transcriptions →Response element testing
- 14:3914:39, 4 March 2021 diff hist +129 m A1BG regulatory elements and regions →T boxes
- 14:3714:37, 4 March 2021 diff hist −80 m A1BG response element negative results →Response element negative results
- 14:3514:35, 4 March 2021 diff hist −139 m Tec1p gene transcriptions →Tec1 samplings
- 04:4504:45, 4 March 2021 diff hist −4 m Tec1p gene transcriptions →Tec1 samplings
- 04:2804:28, 4 March 2021 diff hist +1,806 m Tec1p gene transcriptions →Samplings
3 March 2021
- 23:1523:15, 3 March 2021 diff hist +255 m A1BG response element gene transcriptions →Response element testing
- 22:5522:55, 3 March 2021 diff hist +146 m A1BG response element positive results →Response element positive results
- 22:4922:49, 3 March 2021 diff hist −37 m T box gene transcriptions →T box (Zhang) samplings
- 16:1716:17, 3 March 2021 diff hist +167 m A1BG response element positive results →Response element positive results
- 16:1216:12, 3 March 2021 diff hist +34 m T box gene transcriptions →T box (Conlon) samplings
- 16:1216:12, 3 March 2021 diff hist −236 m A1BG regulatory elements and regions →T boxes
- 06:0706:07, 3 March 2021 diff hist +2,048 m T box gene transcriptions →Acknowledgements
- 06:0206:02, 3 March 2021 diff hist +423 m T box gene transcriptions →Consensus sequences
- 05:5705:57, 3 March 2021 diff hist +9 m T box gene transcriptions →T box samplings
- 05:2505:25, 3 March 2021 diff hist +293 m T box gene transcriptions →See also
- 05:2305:23, 3 March 2021 diff hist +5 m T box gene transcriptions →T box samplings
- 05:2105:21, 3 March 2021 diff hist +2,042 m T box gene transcriptions →Acknowledgements
- 04:4604:46, 3 March 2021 diff hist +4,498 m TAT box gene transcriptions No edit summary
- 04:4504:45, 3 March 2021 diff hist +385 m A1BG response element positive results →Response element positive results
- 04:3304:33, 3 March 2021 diff hist +132 m A1BG response element gene transcriptions →Response element testing
- 02:3602:36, 3 March 2021 diff hist +134 m A1BG response element gene transcriptions →Response element testing
- 01:5701:57, 3 March 2021 diff hist +146 m A1BG response element gene transcriptions →Response element testing
- 01:2501:25, 3 March 2021 diff hist 0 m Tapetum box gene transcriptions →TAP distal promoters
- 01:2501:25, 3 March 2021 diff hist +244 m A1BG response element positive results →Response element positive results
- 00:3900:39, 3 March 2021 diff hist +184 m Tapetum box gene transcriptions →Tapetum box Samplings
2 March 2021
- 19:4919:49, 2 March 2021 diff hist +1,819 m Tapetum box gene transcriptions →Samplings
- 19:3819:38, 2 March 2021 diff hist −202 m A1BG regulatory elements and regions →Tapetum boxes
- 19:3719:37, 2 March 2021 diff hist −3 m A1BG response element gene transcriptions →External links
- 19:3619:36, 2 March 2021 diff hist +140 m A1BG response element gene transcriptions →Response element testing
- 19:3119:31, 2 March 2021 diff hist −3 m A1BG response element positive results →External links
- 19:3019:30, 2 March 2021 diff hist −77 m TAGteam gene transcriptions →TAGteam samplings
- 19:3019:30, 2 March 2021 diff hist +141 m A1BG response element positive results →Response element positive results
- 18:1518:15, 2 March 2021 diff hist +645 m TAGteam gene transcriptions No edit summary
- 18:1318:13, 2 March 2021 diff hist +1,814 m TAGteam gene transcriptions →Samplings
- 04:2804:28, 2 March 2021 diff hist −404 m A1BG regulatory elements and regions →Synaptic Activity-Responsive Elements
- 04:2704:27, 2 March 2021 diff hist +772 m Synaptic Activity-Responsive Elements →Acknowledgements current
- 04:0604:06, 2 March 2021 diff hist +666 m A1BG response element positive results →Response element positive results
- 03:5803:58, 2 March 2021 diff hist −3 m User:Marshallsumter →External links
- 03:5703:57, 2 March 2021 diff hist +183 m A1BG response element gene transcriptions →Response element testing
- 03:5103:51, 2 March 2021 diff hist +1,510 m Sucrose box gene transcriptions →Sucrose box samplings
- 02:4202:42, 2 March 2021 diff hist +4,321 N Sucrose box gene transcriptions Created page with "{{AE}} Henry A. Hoff Manual "scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 19..."
1 March 2021
- 03:2403:24, 1 March 2021 diff hist +128 m A1BG response element negative results No edit summary
- 03:2203:22, 1 March 2021 diff hist −233 m Sterol response element gene transcriptions →SRE (Yao) samplings current
28 February 2021
- 19:2819:28, 28 February 2021 diff hist +139 m A1BG response element gene transcriptions →Response element testing
- 19:2419:24, 28 February 2021 diff hist +4 m A1BG response element negative results →Response element negative results
- 19:0019:00, 28 February 2021 diff hist −293 m Sterol response element gene transcriptions →SRE (Branco) samplings
- 18:2718:27, 28 February 2021 diff hist +4,285 m Sterol response element gene transcriptions No edit summary
- 17:2517:25, 28 February 2021 diff hist +561 m A1BG response element positive results →Response element positive results
- 17:1717:17, 28 February 2021 diff hist −124 m A1BG regulatory elements and regions →Ste12p
- 17:1617:16, 28 February 2021 diff hist −69 m Ste12p gene transcriptions →STE samplings
- 17:1517:15, 28 February 2021 diff hist +688 m Ste12p gene transcriptions No edit summary
- 16:5416:54, 28 February 2021 diff hist +3,854 m Ste12p gene transcriptions No edit summary
- 04:2304:23, 28 February 2021 diff hist +1,289 m A1BG response element positive results →Response element positive results
- 03:4803:48, 28 February 2021 diff hist 0 m Specificity protein gene transcriptions No edit summary
- 03:4603:46, 28 February 2021 diff hist +190 m A1BG response element gene transcriptions →Response element testing
- 03:4103:41, 28 February 2021 diff hist +1,947 m Specificity protein gene transcriptions →Sp1 (Yao) samplings
- 02:0302:03, 28 February 2021 diff hist +286 m A1BG response element gene transcriptions →Response element testing
- 02:0102:01, 28 February 2021 diff hist +248 m Specificity protein gene transcriptions No edit summary
- 01:2701:27, 28 February 2021 diff hist +418 m Specificity protein gene transcriptions →Consensus sequences
- 00:2800:28, 28 February 2021 diff hist +374 m Specificity protein gene transcriptions →Sp-1 (Sato) samplings
27 February 2021
- 22:0622:06, 27 February 2021 diff hist +2,867 m Specificity protein gene transcriptions No edit summary
- 19:3519:35, 27 February 2021 diff hist +817 m A1BG response element positive results →Response element positive results
- 18:4918:49, 27 February 2021 diff hist +148 m A1BG response element gene transcriptions No edit summary
- 18:0518:05, 27 February 2021 diff hist +539 m Specificity protein gene transcriptions →Sp1-box 2 (Motojima) Samplings
- 05:5905:59, 27 February 2021 diff hist +99 m Specificity protein gene transcriptions →Sp1-box 2 (Motojima) Samplings
- 04:5904:59, 27 February 2021 diff hist +412 m Specificity protein gene transcriptions No edit summary
- 04:5704:57, 27 February 2021 diff hist +2,047 m Specificity protein gene transcriptions →SP1 (Motojima) Samplings
- 04:5304:53, 27 February 2021 diff hist +147 m A1BG response element gene transcriptions →Response element testing
- 04:4504:45, 27 February 2021 diff hist +867 m Specificity protein gene transcriptions →Samplings
- 03:4003:40, 27 February 2021 diff hist +1,051 m Bioinformatics tool gene transcriptions No edit summary current
- 01:2401:24, 27 February 2021 diff hist +554 m A1BG response element positive results No edit summary
26 February 2021
- 18:3618:36, 26 February 2021 diff hist +66 m A1BG response element gene transcriptions →Response element testing
- 18:3218:32, 26 February 2021 diff hist +75 m GC box gene transcriptions →GC box samplings
- 18:1418:14, 26 February 2021 diff hist +54 m GC box gene transcriptions →Samplings (Ye)
- 18:1218:12, 26 February 2021 diff hist +1,129 m GC box gene transcriptions →Samplings
- 17:2217:22, 26 February 2021 diff hist +2,036 m GC box gene transcriptions →Acknowledgement examples
- 17:2017:20, 26 February 2021 diff hist +78 m A1BG response element gene transcriptions →Response element testing
- 17:1717:17, 26 February 2021 diff hist +12 m A1BG response element gene transcriptions →Response element testing
- 16:0416:04, 26 February 2021 diff hist +921 m GC box gene transcriptions No edit summary
- 05:2805:28, 26 February 2021 diff hist +1,793 m Specificity protein gene transcriptions →Samplings
- 05:0005:00, 26 February 2021 diff hist −174 m Sp1 gene transcriptions →External links
- 05:0005:00, 26 February 2021 diff hist +33 m Sp1 gene transcriptions →See also
- 04:5304:53, 26 February 2021 diff hist +61 m Smp1p gene transcriptions No edit summary current
- 03:2403:24, 26 February 2021 diff hist +168 m Smp1p gene transcriptions No edit summary
- 00:2100:21, 26 February 2021 diff hist +48 m User:Marshallsumter No edit summary
- 00:2100:21, 26 February 2021 diff hist +648 m Smp1p gene transcriptions No edit summary
- 00:1800:18, 26 February 2021 diff hist −1 m A1BG response element gene transcriptions →Response element testing
- 00:1700:17, 26 February 2021 diff hist +46 m A1BG response element gene transcriptions →Response element testing
- 00:1400:14, 26 February 2021 diff hist +48 m Template:Gene project No edit summary
25 February 2021
- 23:4323:43, 25 February 2021 diff hist −53 m Smp1p gene transcriptions →Samplings
- 05:0305:03, 25 February 2021 diff hist +1,514 m Smp1p gene transcriptions →Samplings
- 02:5702:57, 25 February 2021 diff hist +12 m A1BG response element gene transcriptions →Response element testing
- 02:5502:55, 25 February 2021 diff hist +4,370 N Sip4p gene transcriptions Created page with "{{AE}} Henry A. Hoff The UAS sequence for the transcription factor Sip4p is CCRTYCRTCCG, which occurs in the promoters of ''FBP1, PKC1, ICL1'' genes in ''S. cerevisiae'', wit..."
- 01:5501:55, 25 February 2021 diff hist +16 m A1BG response element gene transcriptions →Response element testing
- 00:4300:43, 25 February 2021 diff hist −43 m P53 response element gene transcriptions →p53 response element UTRs
- 00:3500:35, 25 February 2021 diff hist 0 m P53 response element gene transcriptions →p53 response element UTRs
- 00:3300:33, 25 February 2021 diff hist +7 m A1BG response element gene transcriptions →Response element testing
- 00:3200:32, 25 February 2021 diff hist +34 m A1BG response element positive results →Response element positive results
- 00:2800:28, 25 February 2021 diff hist +17,362 m A1BG response element gene transcriptions →Response element testing
24 February 2021
- 19:3719:37, 24 February 2021 diff hist +39,749 N A1BG response element gene transcriptions Created page with "{{AE}} Henry A. Hoff '''Def.''' nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to v..."
- 16:1916:19, 24 February 2021 diff hist +600 m Shoot specific element gene transcriptions No edit summary
- 15:1315:13, 24 February 2021 diff hist +4 m Shoot specific element gene transcriptions →SHOOT samplings
- 15:1315:13, 24 February 2021 diff hist −265 m Shoot specific element gene transcriptions →SHOOT samplings
- 05:3405:34, 24 February 2021 diff hist +8 m Shoot specific element gene transcriptions →SHOOT samplings
- 03:4303:43, 24 February 2021 diff hist +1,835 m Shoot specific element gene transcriptions →Samplings
- 03:3403:34, 24 February 2021 diff hist +35 m Serum response element gene transcriptions →See also
- 03:2703:27, 24 February 2021 diff hist +2,787 N Bioinformatics tool gene transcriptions Created page with "{{AE}} Henry A. Hoff '''Def.''' a "field of science in which biology, computer science, and information technology merge into a single discipline to analyse biological inform..."
- 03:1603:16, 24 February 2021 diff hist +46 m Template:Gene project No edit summary
- 03:1103:11, 24 February 2021 diff hist +309 m A1BG response element positive results →Response element positive results
- 03:0303:03, 24 February 2021 diff hist +2,195 m Servenius sequence gene transcriptions →Samplings
- 02:0602:06, 24 February 2021 diff hist −209 m A1BG regulatory elements and regions →Servenius sequences
- 02:0402:04, 24 February 2021 diff hist +349 m Template:Gene project No edit summary
- 01:5501:55, 24 February 2021 diff hist −74 m User:Marshallsumter No edit summary
- 01:5501:55, 24 February 2021 diff hist +1,689 N Complement copy gene transcriptions Created page with "{{AE}} Henry A. Hoff '''Def.''' a "nucleotide sequence in which each base is replaced by the complementary base of the given sequence: adenine (A) by thymine (T) or uracil (U..." current
- 01:3601:36, 24 February 2021 diff hist +217 m A1BG response element positive results No edit summary
23 February 2021
- 23:3023:30, 23 February 2021 diff hist −94 m Serum response element gene transcriptions →SER samplings
- 22:3722:37, 23 February 2021 diff hist +1,088 m Serum response element gene transcriptions No edit summary
- 22:1622:16, 23 February 2021 diff hist −676 m User:Marshallsumter No edit summary
- 22:1622:16, 23 February 2021 diff hist +4,216 N Serum response element gene transcriptions Created page with "{{AE}} Henry A. Hoff The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box,..."
- 22:1122:11, 23 February 2021 diff hist +39 m Template:Gene project No edit summary
- 22:1022:10, 23 February 2021 diff hist +2,080 N Inverse copy gene transcriptions Created page with "{{AE}} Henry A. Hoff '''Def.''' "a state in which something has been turned (properly) upside down or (loosely) inside out or backwards"<ref name=InverseWikt>{{ cite web |aut..." current
- 21:4421:44, 23 February 2021 diff hist −3 m A1BG response element negative results →Response element negative results
- 20:1820:18, 23 February 2021 diff hist +1,522 m Seed-specific element gene transcriptions No edit summary current
- 17:0917:09, 23 February 2021 diff hist +332 m A1BG response element positive results →Response element positive results
- 17:0117:01, 23 February 2021 diff hist +461 m MYB recognition element gene transcriptions →RRE samplings
- 05:1905:19, 23 February 2021 diff hist +88 m MYB recognition element gene transcriptions →RRE samplings
- 04:3804:38, 23 February 2021 diff hist +2,013 m MYB recognition element gene transcriptions →Acknowledgements
- 04:1804:18, 23 February 2021 diff hist −205 m A1BG regulatory elements and regions →R response elements
- 03:2403:24, 23 February 2021 diff hist −2 m A1BG response element negative results →Response element negative results
- 03:1503:15, 23 February 2021 diff hist +1,555 m Rpn4p gene transcriptions →Samplings current
22 February 2021
- 21:5721:57, 22 February 2021 diff hist +16 m A1BG response element negative results →Response element negative results
- 21:5021:50, 22 February 2021 diff hist −17 m Rox1p gene transcriptions →Samplings current
- 20:0620:06, 22 February 2021 diff hist +11 m A1BG response element positive results →Response element positive results
- 19:4719:47, 22 February 2021 diff hist +2,949 m Element gene transcriptions No edit summary current
- 18:5418:54, 22 February 2021 diff hist +5,329 N Rox1p gene transcriptions Created page with "{{AE}} Henry A. Hoff "All promoters recognized by pol-II may require one or more UASs for regulated gene expression [36,37]."<ref name=Tang/> ==Human genes== {{main|Human ge..."
- 06:4006:40, 22 February 2021 diff hist −109 m A1BG response element negative results →Response element negative results
- 05:5505:55, 22 February 2021 diff hist +1,403 m Rlm1p gene transcriptions →Samplings current
- 05:0805:08, 22 February 2021 diff hist +329 m ROR-response element gene transcriptions →External links
- 05:0705:07, 22 February 2021 diff hist +293 m A1BG response element positive results →Response element positive results
- 04:5304:53, 22 February 2021 diff hist +436 m ROR-response element gene transcriptions →RORE variant samplings
- 02:1002:10, 22 February 2021 diff hist +182 m ROR-response element gene transcriptions →See also
- 02:0902:09, 22 February 2021 diff hist +71 m ROR-response element gene transcriptions →Samplings
- 02:0502:05, 22 February 2021 diff hist +2,036 m ROR-response element gene transcriptions →Acknowledgements
- 02:0502:05, 22 February 2021 diff hist +136 m ROR-response element gene transcriptions →See also
- 02:0402:04, 22 February 2021 diff hist +166 m A1BG response element positive results No edit summary
- 01:5001:50, 22 February 2021 diff hist −23 m ROR-response element gene transcriptions →RORE samplings
21 February 2021
- 23:3823:38, 21 February 2021 diff hist +1,911 m ROR-response element gene transcriptions →Samplings
- 23:3123:31, 21 February 2021 diff hist +387 m A1BG response element positive results No edit summary
- 23:0323:03, 21 February 2021 diff hist +424 m Retinoic acid response element gene transcriptions →RARE samplings
- 20:1120:11, 21 February 2021 diff hist +642 m Retinoic acid response element gene transcriptions No edit summary
- 20:0820:08, 21 February 2021 diff hist +1,803 m Retinoic acid response element gene transcriptions →Samplings
- 20:0420:04, 21 February 2021 diff hist −33 m Retinoic acid response element gene transcriptions →Human genes
- 19:4519:45, 21 February 2021 diff hist +31 m Template:Gene project No edit summary
- 19:4319:43, 21 February 2021 diff hist +6,472 N Leu3 gene transcriptions Created page with "{{AE}} Henry A. Hoff With ''HAS1'' ending at zero and ''TDA1'' beginning at above 1000 bp, Leu3 is from 536 - 545 nts yielding consensus sequences (C/G)C(G/T)NNNN(A/C)G(C/G),..."
- 18:4318:43, 21 February 2021 diff hist +36 m Rgt1p gene transcriptions No edit summary
- 18:4218:42, 21 February 2021 diff hist +5 m Mig1p gene transcriptions →See also
- 18:4218:42, 21 February 2021 diff hist +70 m Mig1p gene transcriptions →Consensus sequences
- 18:4018:40, 21 February 2021 diff hist +487 m Mig1p gene transcriptions →Consensus sequences
- 06:3106:31, 21 February 2021 diff hist +378 m A1BG response element positive results →Response element positive results
- 06:1706:17, 21 February 2021 diff hist +836 m Rgt1p gene transcriptions →Samplings
- 04:2104:21, 21 February 2021 diff hist +5,161 N Rgt1p gene transcriptions Created page with "{{AE}} Henry A. Hoff "Using MAP-C [Mutation Analysis in Pools by Chromosome conformation capture], we show that inducible interchromosomal pairing between ''HAS1pr-TDA1pr'' a..."
- 02:4402:44, 21 February 2021 diff hist +244 m Reb1 general regulatory factor gene transcriptions →External links
- 02:2702:27, 21 February 2021 diff hist −32 m Template:Gene project No edit summary
20 February 2021
- 19:3719:37, 20 February 2021 diff hist +185 m A1BG response element negative results →Response element negative results
- 19:3319:33, 20 February 2021 diff hist +223 m A1BG response element positive results →Response element positive results
- 19:3319:33, 20 February 2021 diff hist −247 m Reb1 general regulatory factor gene transcriptions →Extended Reb1 samplings
- 18:1218:12, 20 February 2021 diff hist +126 m Reb1 general regulatory factor gene transcriptions →Reb1 samplings
- 06:1806:18, 20 February 2021 diff hist +3,733 m Reb1 general regulatory factor gene transcriptions →Samplings
- 05:3705:37, 20 February 2021 diff hist +193 m A1BG response element positive results →Response element positive results
- 05:0405:04, 20 February 2021 diff hist +427 m Rap1 regulatory factor gene transcriptions →Rap1 prevalent samplings
19 February 2021
- 18:3718:37, 19 February 2021 diff hist +2,156 m Rap1 regulatory factor gene transcriptions →See also
- 18:3018:30, 19 February 2021 diff hist +125 m Rap1 regulatory factor gene transcriptions →Consensus sequences
- 18:2018:20, 19 February 2021 diff hist −11 m A1BG response element negative results →Response element negative results
- 17:5717:57, 19 February 2021 diff hist −147 m Rap1 regulatory factor gene transcriptions →Rap1 samplings
- 16:1116:11, 19 February 2021 diff hist +9 m Rap1 regulatory factor gene transcriptions →Rap1 samplings
- 06:5606:56, 19 February 2021 diff hist +13 m Rap1 regulatory factor gene transcriptions No edit summary
- 06:5406:54, 19 February 2021 diff hist +1,799 m Rap1 regulatory factor gene transcriptions →Samplings
- 06:5206:52, 19 February 2021 diff hist +159 m Rap1 regulatory factor gene transcriptions →Consensus sequences
- 04:1204:12, 19 February 2021 diff hist +268 m A1BG response element positive results →Response element positive results
- 03:5803:58, 19 February 2021 diff hist 0 m Xenobiotic response element gene transcriptions →QRDRE distal promoters
- 03:5603:56, 19 February 2021 diff hist +150 m Xenobiotic response element gene transcriptions →QRDRE samplings
- 03:1003:10, 19 February 2021 diff hist +2,044 m Xenobiotic response element gene transcriptions No edit summary
- 02:0202:02, 19 February 2021 diff hist +198 m A1BG response element positive results →Response element positive results
- 01:4501:45, 19 February 2021 diff hist +184 m Xenobiotic responsive element gene transcriptions →AHRE-II samplings
18 February 2021
- 21:4421:44, 18 February 2021 diff hist +390 m A1BG response element positive results →Response element positive results
- 21:4021:40, 18 February 2021 diff hist +330 m Q element gene transcriptions →QE samplings
- 05:3305:33, 18 February 2021 diff hist +409 m Q element gene transcriptions →Samplings
17 February 2021
- 22:4022:40, 17 February 2021 diff hist +75 m Q element gene transcriptions →See also
- 22:4022:40, 17 February 2021 diff hist +1,810 m Q element gene transcriptions →Samplings
- 22:0222:02, 17 February 2021 diff hist +207 m CRE box gene transcriptions →Root specific element
- 22:0222:02, 17 February 2021 diff hist −207 m A1BG regulatory elements and regions →Root specific elements
- 21:5821:58, 17 February 2021 diff hist −296 m A1BG regulatory elements and regions →Retinoblastoma control elements
- 21:2621:26, 17 February 2021 diff hist −196 m A1BG response element positive results →Response element positive results
- 21:2321:23, 17 February 2021 diff hist −194 m A1BG regulatory elements and regions →Nuclear factor of activated T cell transcriptions
- 21:2221:22, 17 February 2021 diff hist −213 m A1BG regulatory elements and regions →Nuclear factor kappa-light-chain-enhancer of activated B cells
- 21:2121:21, 17 February 2021 diff hist −231 m A1BG regulatory elements and regions →Myocyte enhancer factor 2 (MEF2)
- 21:1921:19, 17 February 2021 diff hist −222 m A1BG regulatory elements and regions →MYB recognition elements
- 21:0721:07, 17 February 2021 diff hist +182 m A1BG response element negative results →Response element negative results
- 20:4520:45, 17 February 2021 diff hist −38 m Xenobiotic response element gene transcriptions →AHRE samplings
- 07:1307:13, 17 February 2021 diff hist +660 m A1BG response element negative results →Response element negative results
- 05:4405:44, 17 February 2021 diff hist +279 m A1BG response element positive results →Response element positive results
- 05:3805:38, 17 February 2021 diff hist −127 m AGC box gene transcriptions →GCC box samplings
- 05:3205:32, 17 February 2021 diff hist +915 m AGC box gene transcriptions →GCC box samplings
- 04:5804:58, 17 February 2021 diff hist −142 m ABA-response element gene transcriptions →ABREN samplings
- 04:5404:54, 17 February 2021 diff hist +3 m A1BG response element positive results →Response element positive results
- 04:5304:53, 17 February 2021 diff hist +24 m ABA-response element gene transcriptions →ABRE samplings
- 04:4804:48, 17 February 2021 diff hist +20 m ABA-response element gene transcriptions →ABREN samplings
- 04:4404:44, 17 February 2021 diff hist +6 m ABA-response element gene transcriptions →Samplings
- 04:0404:04, 17 February 2021 diff hist +1,570 m A1BG response element positive results →Response element positive results
- 02:4402:44, 17 February 2021 diff hist +2,453 m Xenobiotic response element gene transcriptions →Xenobiotic response element samplings
- 02:0802:08, 17 February 2021 diff hist +12 m Xenobiotic responsive element gene transcriptions →AHRE-II samplings
- 00:4900:49, 17 February 2021 diff hist +3,442 m Xenobiotic response element gene transcriptions →See also
16 February 2021
- 22:4722:47, 16 February 2021 diff hist +334 m A1BG response element positive results →Response element positive results
- 22:4322:43, 16 February 2021 diff hist −146 m Xenobiotic response element gene transcriptions →DIOX samplings
- 22:3722:37, 16 February 2021 diff hist +382 m Xenobiotic response element gene transcriptions →DIOX samplings
- 20:0020:00, 16 February 2021 diff hist +158 m Xenobiotic response element gene transcriptions →DIOX samplings
- 19:3519:35, 16 February 2021 diff hist +12 m Xenobiotic response element gene transcriptions →DRE samplings
- 18:2418:24, 16 February 2021 diff hist +2,040 m Xenobiotic response element gene transcriptions →See also
- 07:2907:29, 16 February 2021 diff hist +434 m Xenobiotic response element gene transcriptions →Consensus sequences
- 06:5606:56, 16 February 2021 diff hist −47 m A1BG response element negative results →Response element negative results
- 06:5206:52, 16 February 2021 diff hist −187 m Polycomb response element gene transcriptions →Extended Pho-Phol samplings
- 05:4405:44, 16 February 2021 diff hist +19 m Polycomb response element gene transcriptions →Samplings
- 05:4305:43, 16 February 2021 diff hist −6 m Polycomb response element gene transcriptions →Consensus sequences
- 05:4205:42, 16 February 2021 diff hist +2,036 m Polycomb response element gene transcriptions →See also
- 05:4005:40, 16 February 2021 diff hist +338 m A1BG response element positive results →Response element positive results
- 05:3505:35, 16 February 2021 diff hist +2,199 m Polycomb response element gene transcriptions →Samplings
- 03:2003:20, 16 February 2021 diff hist +56 m Template:Gene project No edit summary
- 03:1903:19, 16 February 2021 diff hist −777 m Xenobiotic response element gene transcriptions No edit summary
- 03:1703:17, 16 February 2021 diff hist +54 m Xenobiotic responsive element gene transcriptions →See also
- 03:0903:09, 16 February 2021 diff hist −2,055 m Xenobiotic responsive element gene transcriptions →AHRE samplings
- 03:0903:09, 16 February 2021 diff hist +1,827 m Xenobiotic response element gene transcriptions →Samplings
- 03:0303:03, 16 February 2021 diff hist +214 m A1BG regulatory elements and regions →See also
- 03:0203:02, 16 February 2021 diff hist +58 m A1BG regulatory elements and regions →Xenobiotic responsive elements
- 03:0103:01, 16 February 2021 diff hist +9,306 N Xenobiotic responsive element gene transcriptions Created page with "{{AE}} Henry A. Hoff The classical recognition motif of the AhR/ARNT complex, referred to as either the AhR-, dioxin- or xenobiotic- responsive element (AHRE, DRE or XRE), co..."
15 February 2021
- 19:3419:34, 15 February 2021 diff hist 0 m Peroxisome proliferator hormone response element gene transcriptions No edit summary
- 19:0819:08, 15 February 2021 diff hist −198 m Peroxisome proliferator hormone response element gene transcriptions →PPRE samplings
- 19:0719:07, 15 February 2021 diff hist +3,590 m A1BG regulatory elements and regions →X core promoter elements
- 18:5718:57, 15 February 2021 diff hist −693 m A1BG regulatory elements and regions →Peroxisome proliferator hormone response elements
- 18:3718:37, 15 February 2021 diff hist +928 m Peroxisome proliferator hormone response element gene transcriptions No edit summary
- 18:3218:32, 15 February 2021 diff hist +200 m A1BG response element negative results →Response element negative results
- 06:0806:08, 15 February 2021 diff hist +266 m A1BG response element positive results →Response element positive results
- 06:0206:02, 15 February 2021 diff hist +4,010 m Peroxisome proliferator hormone response element gene transcriptions →Samplings
- 04:1204:12, 15 February 2021 diff hist −3 m A1BG response element negative results No edit summary
- 04:0704:07, 15 February 2021 diff hist −277 m Pdr1,3p gene transcriptions →Pdr samplings
14 February 2021
- 05:3405:34, 14 February 2021 diff hist −19 m User:Marshallsumter No edit summary
- 05:3405:34, 14 February 2021 diff hist +2,415 m Pdr1,3p gene transcriptions No edit summary
- 04:3504:35, 14 February 2021 diff hist +207 m A1BG response element negative results →Response element negative results
- 04:1804:18, 14 February 2021 diff hist +669 m P63 DNA-binding site gene transcriptions No edit summary current
- 04:1404:14, 14 February 2021 diff hist +867 m P63 DNA-binding site gene transcriptions →Samplings
13 February 2021
- 18:2518:25, 13 February 2021 diff hist +403 m A1BG response element positive results →Response element positive results
- 17:4817:48, 13 February 2021 diff hist −279 m A1BG regulatory elements and regions →p63 DNA-binding sites
- 17:4717:47, 13 February 2021 diff hist +1,969 m P63 DNA-binding site gene transcriptions →Samplings
- 17:3417:34, 13 February 2021 diff hist −383 m A1BG regulatory elements and regions →p53 response elements
- 17:3317:33, 13 February 2021 diff hist +2,370 m P53 response element gene transcriptions No edit summary
- 17:0117:01, 13 February 2021 diff hist +226 m Pollen1 element gene transcriptions →See also
- 17:0017:00, 13 February 2021 diff hist +3,349 m Pollen1 element gene transcriptions →Pollen1 samplings
- 16:5916:59, 13 February 2021 diff hist +1,290 m A1BG response element positive results →Response element positive results
- 15:0515:05, 13 February 2021 diff hist +2,060 m Pollen1 element gene transcriptions →Consensus sequences
- 05:2205:22, 13 February 2021 diff hist −2 m A1BG response element negative results →Response element negative results
- 05:1005:10, 13 February 2021 diff hist +1,557 m TCCACCATA element gene transcriptions →Samplings current
- 04:1604:16, 13 February 2021 diff hist +151 m A1BG response element negative results →Response element negative results
- 02:2402:24, 13 February 2021 diff hist +329 m Pollen1 element gene transcriptions →External links
- 02:2202:22, 13 February 2021 diff hist +1,926 m Pollen1 element gene transcriptions →Samplings
- 01:2101:21, 13 February 2021 diff hist −187 m A1BG regulatory elements and regions →Pollen1 elements
- 01:1201:12, 13 February 2021 diff hist −109 m A1BG regulatory elements and regions →Pribnow boxes
- 01:0001:00, 13 February 2021 diff hist +237 m A1BG response element positive results →Response element positive results
12 February 2021
- 18:2918:29, 12 February 2021 diff hist +11 m A1BG response element positive results →Response element positive results
- 18:2718:27, 12 February 2021 diff hist +979 m A1BG response element positive results →Response element positive results
- 18:2218:22, 12 February 2021 diff hist +1,338 m ORE1 binding site gene transcriptions →ORE1 (Olsen) samplings
- 16:4316:43, 12 February 2021 diff hist +30 m ORE1 binding site gene transcriptions →ORE1-1 samplings
- 16:4116:41, 12 February 2021 diff hist +30 m ORE1 binding site gene transcriptions →ORE1-2 samplings
- 16:3816:38, 12 February 2021 diff hist +1,136 m ORE1 binding site gene transcriptions No edit summary
- 05:4005:40, 12 February 2021 diff hist +85 m ORE1 binding site gene transcriptions →ORE1-2 samplings
- 03:4103:41, 12 February 2021 diff hist +1,831 m ORE1 binding site gene transcriptions →ORE1-1 samplings
- 00:1500:15, 12 February 2021 diff hist +293 m ORE1 binding site gene transcriptions →ORE1-1 samplings
11 February 2021
- 15:4115:41, 11 February 2021 diff hist +453 m ORE1 binding site gene transcriptions →ORE1-1 samplings
- 06:2706:27, 11 February 2021 diff hist +2,260 m ORE1 binding site gene transcriptions No edit summary
- 05:3105:31, 11 February 2021 diff hist +1,457 m ORE1 binding site gene transcriptions No edit summary
- 05:0405:04, 11 February 2021 diff hist +603 m ORE1 binding site gene transcriptions No edit summary
- 04:2204:22, 11 February 2021 diff hist +4,316 N ORE1 binding site gene transcriptions Created page with "{{AE}} Henry A. Hoff "As a transcription factor, ORE1 was reported to bind to consensus DNA sequences of [ACG][CA]GT[AG]N{5,6}[CT]AC[AG] [29] or T[TAG][GA]CGT[GA][TCA][TAG] [..."
- 04:2104:21, 11 February 2021 diff hist −583 m A1BG regulatory elements and regions No edit summary
- 04:0604:06, 11 February 2021 diff hist +51 m Template:Gene project No edit summary
- 03:3503:35, 11 February 2021 diff hist +182 m Oaf1p gene transcriptions →See also
- 02:5802:58, 11 February 2021 diff hist −108 m Oaf1p gene transcriptions →Consensus sequences
- 02:5502:55, 11 February 2021 diff hist +562 m Oaf1p gene transcriptions No edit summary
- 02:0902:09, 11 February 2021 diff hist +4,462 N Zinc responsive element gene transcriptions Created page with "{{AE}} Henry A. Hoff "A robust set of genes that responded consistently to Zn limitation was identified, and the set enabled the definition of the Zn-specific Zap1p regulon,..."
- 01:3101:31, 11 February 2021 diff hist +931 m Oaf1p gene transcriptions No edit summary
- 01:0501:05, 11 February 2021 diff hist −448 m A1BG regulatory elements and regions No edit summary
- 01:0101:01, 11 February 2021 diff hist +654 m A1BG regulatory elements and regions →Nutrient-sensing response element 1
- 00:5700:57, 11 February 2021 diff hist −168 m A1BG response element negative results →Response element negative results
- 00:5500:55, 11 February 2021 diff hist −1 m Oaf1p gene transcriptions →External links
- 00:5200:52, 11 February 2021 diff hist +263 m A1BG response element positive results →Response element positive results
- 00:4400:44, 11 February 2021 diff hist +485 m Oaf1p gene transcriptions →Samplings
10 February 2021
- 22:4122:41, 10 February 2021 diff hist +391 m Oaf1p gene transcriptions →Samplings
- 21:0521:05, 10 February 2021 diff hist +62 m Oaf1p gene transcriptions →Samplings
- 14:4314:43, 10 February 2021 diff hist −15 m Oaf1p gene transcriptions →Samplings
- 14:1214:12, 10 February 2021 diff hist +1,516 m Oaf1p gene transcriptions →Samplings
- 03:2103:21, 10 February 2021 diff hist +179 m Template:Gene project No edit summary
- 03:1203:12, 10 February 2021 diff hist +4,047 N Carbon source-responsive element gene transcriptions Created page with "{{AE}} Henry A. Hoff "Deletion analysis of the ICL1 promoter led to the identification of an upstream activating sequence element, UASICL1 (5' CATTCATCCG 3'), necessary and s..."
- 01:5801:58, 10 February 2021 diff hist +489 m A1BG regulatory elements and regions →Nuclear factor 1
- 01:5401:54, 10 February 2021 diff hist −200 m A1BG response element negative results →Response element negative results
- 01:5301:53, 10 February 2021 diff hist +181 m A1BG response element positive results →Response element positive results
- 01:3401:34, 10 February 2021 diff hist +1,702 m Nutrient-sensing response element gene transcriptions →Samplings
9 February 2021
- 22:2122:21, 9 February 2021 diff hist +400 m A1BG response element positive results →Response element positive results
- 22:2122:21, 9 February 2021 diff hist +468 m Nuclear factor of activated T cell gene transcriptions (NFAT) →NFAT samplings
- 05:1405:14, 9 February 2021 diff hist +6 m A1BG response element negative results →Response element negative results
- 05:1305:13, 9 February 2021 diff hist −424 m Nuclear factor Y gene transcriptions No edit summary current
- 04:5604:56, 9 February 2021 diff hist +271 m Nuclear factor Y gene transcriptions →See also
- 04:5404:54, 9 February 2021 diff hist +4 m Nuclear factor Y gene transcriptions →Samplings
- 04:4804:48, 9 February 2021 diff hist +1,669 m Nuclear factor Y gene transcriptions →Samplings
- 04:0104:01, 9 February 2021 diff hist +41 m A1BG response element negative results →Response element negative results
- 03:5103:51, 9 February 2021 diff hist −183 m Nuclear factor gene transcriptions →NF-1 samplings
- 03:1303:13, 9 February 2021 diff hist +136 m A1BG response element negative results →Response element negative results
- 03:0703:07, 9 February 2021 diff hist −77 m NF-κB No edit summary current
- 02:5302:53, 9 February 2021 diff hist −264 m Nuclear factor gene transcriptions →NF𝜿B samplings
- 01:2601:26, 9 February 2021 diff hist +2,029 m Nuclear factor of activated T cell gene transcriptions (NFAT) →See also
- 01:2501:25, 9 February 2021 diff hist −600 m Nuclear factor gene transcriptions →CCAAT samplings
- 01:2001:20, 9 February 2021 diff hist +4,101 m Nuclear factor gene transcriptions →Acknowledgements
- 01:0701:07, 9 February 2021 diff hist +6 m Nuclear factor gene transcriptions →Samplings
- 00:3900:39, 9 February 2021 diff hist −1 m Nuclear factor gene transcriptions →CCCAAT distal promoters
- 00:3900:39, 9 February 2021 diff hist +2 m Nuclear factor gene transcriptions →CCAT distal promoters
- 00:3800:38, 9 February 2021 diff hist +2 m Nuclear factor gene transcriptions →CCAT distal promoters
- 00:3700:37, 9 February 2021 diff hist +426 m Nuclear factor gene transcriptions →Consensus sequences
- 00:2200:22, 9 February 2021 diff hist +586 m Ndt80p gene transcriptions No edit summary
- 00:0400:04, 9 February 2021 diff hist +20 m Ndt80p gene transcriptions No edit summary
- 00:0200:02, 9 February 2021 diff hist +236 m A1BG response element positive results →Response element positive results
8 February 2021
- 21:1021:10, 8 February 2021 diff hist +210 m Ndt80p gene transcriptions →Ndt80 samplings
- 14:2414:24, 8 February 2021 diff hist +5,073 m Ndt80p gene transcriptions No edit summary
- 04:5704:57, 8 February 2021 diff hist +294 m A1BG response element positive results →Response element positive results
- 04:4304:43, 8 February 2021 diff hist +3,267 m Myocyte enhancer factor gene transcriptions No edit summary
- 02:2602:26, 8 February 2021 diff hist +1 m A1BG response element positive results →External links
- 02:2402:24, 8 February 2021 diff hist +485 m A1BG response element positive results →Response element positive results
- 02:1502:15, 8 February 2021 diff hist +4,649 m MYB recognition element gene transcriptions No edit summary
7 February 2021
- 23:1623:16, 7 February 2021 diff hist +465 m A1BG response element negative results →Response element negative results
- 22:5022:50, 7 February 2021 diff hist −312 m Middle sporulation element gene transcriptions →HAP2 samplings
- 20:4520:45, 7 February 2021 diff hist +56 m A1BG response element positive results →Response element positive results
- 20:4520:45, 7 February 2021 diff hist +151 m Msn2,4p gene transcriptions →Samplings
- 20:2620:26, 7 February 2021 diff hist +2,108 m Middle sporulation element gene transcriptions No edit summary
- 05:3005:30, 7 February 2021 diff hist +651 m A1BG response element positive results →Response element positive results
- 05:2305:23, 7 February 2021 diff hist +746 m A1BG regulatory elements and regions No edit summary
- 05:0305:03, 7 February 2021 diff hist +6,444 N Msn2,4p gene transcriptions Created page with "{{AE}} Henry A. Hoff "[msn2p] is a transcription factor that binds to stress-response elements (STREs) resulting in the induction of more than 200 genes.10,11 STRE has a core..."
- 02:1302:13, 7 February 2021 diff hist −143 m A1BG regulatory elements and regions →Msn2,4p
- 01:0301:03, 7 February 2021 diff hist +966 m Mig1p gene transcriptions No edit summary
- 00:4000:40, 7 February 2021 diff hist +2,078 m Mig1p gene transcriptions No edit summary
6 February 2021
- 22:5922:59, 6 February 2021 diff hist +1,060 m A1BG response element positive results →Response element positive results
- 22:3622:36, 6 February 2021 diff hist +1,025 m Mig1p gene transcriptions →Samplings
- 14:3514:35, 6 February 2021 diff hist +217 m Mig1p gene transcriptions →Samplings
- 04:4304:43, 6 February 2021 diff hist +1,254 m Mig1p gene transcriptions →Samplings
- 03:5103:51, 6 February 2021 diff hist +250 m Mig1p gene transcriptions No edit summary
- 03:3403:34, 6 February 2021 diff hist +571 m A1BG regulatory elements and regions →Middle sporulation elements
- 02:0502:05, 6 February 2021 diff hist −1 m A1BG response element negative results →Response element negative results
- 02:0102:01, 6 February 2021 diff hist −25 m Middle sporulation element gene transcriptions No edit summary
- 01:5901:59, 6 February 2021 diff hist +485 m A1BG response element positive results →Response element positive results
- 01:3801:38, 6 February 2021 diff hist +519 m Middle sporulation element gene transcriptions No edit summary
- 01:1001:10, 6 February 2021 diff hist +1,016 m Middle sporulation element gene transcriptions No edit summary
- 00:3400:34, 6 February 2021 diff hist −391 m Middle sporulation element gene transcriptions →Consensus sequences
5 February 2021
- 23:3623:36, 5 February 2021 diff hist +170 m Middle sporulation element gene transcriptions →MSE (Xu) samplings
- 20:5120:51, 5 February 2021 diff hist −22 m A1BG regulatory elements and regions No edit summary
- 20:3820:38, 5 February 2021 diff hist 0 m A1BG regulatory elements and regions →External links
- 20:3620:36, 5 February 2021 diff hist +891 m A1BG regulatory elements and regions →Metal responsive elements
- 20:3520:35, 5 February 2021 diff hist +58 m Middle sporulation element gene transcriptions →MSE (Branco) samplings
- 13:3013:30, 5 February 2021 diff hist +4,147 m Middle sporulation element gene transcriptions No edit summary
- 04:2004:20, 5 February 2021 diff hist −4 m A1BG regulatory elements and regions →Met31ps
- 04:1904:19, 5 February 2021 diff hist +5 m A1BG regulatory elements and regions →Met31ps
- 04:0804:08, 5 February 2021 diff hist +18 m Met31p box gene transcriptions →Samplings
- 03:2603:26, 5 February 2021 diff hist +759 m A1BG regulatory elements and regions →M35 boxes
- 02:5702:57, 5 February 2021 diff hist −121 m A1BG response element negative results →Response element negative results
- 02:5602:56, 5 February 2021 diff hist +489 m A1BG response element positive results →Response element positive results
- 02:5502:55, 5 February 2021 diff hist +150 m Met31p box gene transcriptions →Samplings
- 00:3200:32, 5 February 2021 diff hist +6,274 N Met31p box gene transcriptions Created page with "{{AE}} Henry A. Hoff "The transcriptional regulation of the sulfur amino acid pathway in Saccharomyces cerevisiae depends on a single activator, Met4p, whose function require..."
4 February 2021
- 13:4013:40, 4 February 2021 diff hist +14 m A1BG response element negative results →Response element negative results
- 03:5703:57, 4 February 2021 diff hist +329 m Mcm1 regulatory factor gene transcriptions →External links
- 03:3903:39, 4 February 2021 diff hist +5 m A1BG response element negative results →Response element negative results
- 03:1703:17, 4 February 2021 diff hist −87 m Mcm1 regulatory factor gene transcriptions →Samplings
3 February 2021
- 18:4418:44, 3 February 2021 diff hist +76 m Mcm1 regulatory factor gene transcriptions →Samplings
- 16:4716:47, 3 February 2021 diff hist +1,836 m Mcm1 regulatory factor gene transcriptions →Samplings
- 16:4316:43, 3 February 2021 diff hist +92 m Mcm1 regulatory factor gene transcriptions →Consensus sequences
- 16:2716:27, 3 February 2021 diff hist +561 m A1BG response element negative results →Response element negative results
- 16:0516:05, 3 February 2021 diff hist −266 m M box gene transcriptions →Samplings
- 05:1205:12, 3 February 2021 diff hist +2,346 m Mig1p gene transcriptions No edit summary
- 05:0605:06, 3 February 2021 diff hist −144 m A1BG regulatory elements and regions →Mig1ps
- 04:4704:47, 3 February 2021 diff hist +2,516 m M box gene transcriptions No edit summary
- 03:5203:52, 3 February 2021 diff hist +511 m Maf recognition element gene transcriptions No edit summary current
- 03:4903:49, 3 February 2021 diff hist +561 m A1BG response element negative results →Response element negative results
- 03:2903:29, 3 February 2021 diff hist −142 m Maf recognition element gene transcriptions →Samplings
- 00:1400:14, 3 February 2021 diff hist +1,812 m Maf recognition element gene transcriptions →Samplings
2 February 2021
- 05:0105:01, 2 February 2021 diff hist +313 m A1BG regulatory elements and regions →M35 boxes
- 04:5704:57, 2 February 2021 diff hist +155 m A1BG response element positive results →Response element positive results
- 04:2404:24, 2 February 2021 diff hist +464 m A1BG response element negative results →Response element negative results
- 04:2104:21, 2 February 2021 diff hist +24 m L box gene transcriptions →Samplings current
- 03:3903:39, 2 February 2021 diff hist +1 m A1BG response element negative results →External links
- 03:3903:39, 2 February 2021 diff hist +1,431 m L box gene transcriptions No edit summary
- 01:1601:16, 2 February 2021 diff hist −300 m Kozak sequence gene transcriptions →(Matsumoto) samplings
- 01:1401:14, 2 February 2021 diff hist −2 m A1BG response element negative results →Response element negative results
1 February 2021
- 21:1421:14, 1 February 2021 diff hist +450 m A1BG response element negative results →Response element negative results
- 20:4720:47, 1 February 2021 diff hist +4,334 m Kozak sequence gene transcriptions No edit summary
- 19:4319:43, 1 February 2021 diff hist 0 m User:Marshallsumter No edit summary
- 19:4119:41, 1 February 2021 diff hist 0 m AGC box gene transcriptions →GCC box samplings
- 19:1419:14, 1 February 2021 diff hist +1,584 m AGC box gene transcriptions →AGC box samplings
- 19:0719:07, 1 February 2021 diff hist +10 m User:Marshallsumter No edit summary
- 17:3817:38, 1 February 2021 diff hist +2,029 m A1BG response element positive results →Response element positive results
- 06:4306:43, 1 February 2021 diff hist +6,441 m Krüppel-like factor gene transcriptions →Samplings
- 02:2702:27, 1 February 2021 diff hist +1,734 m Krüppel-like factor gene transcriptions →Samplings
- 01:4701:47, 1 February 2021 diff hist +3,813 m Complex locus A1BG and ZNF497 →Regulatory elements and regions
31 January 2021
- 21:3121:31, 31 January 2021 diff hist +950 m Alpha-1-B glycoprotein →Protein
- 19:5919:59, 31 January 2021 diff hist +952 m Alpha-1-B glycoprotein →Non-small cell lung cancers
- 16:5516:55, 31 January 2021 diff hist +258 m Krüppel-like factor gene transcriptions →See also
- 16:4416:44, 31 January 2021 diff hist −271 m A1BG regulatory elements and regions →Krüppel-like factors
- 16:3716:37, 31 January 2021 diff hist −195 m A1BG regulatory elements and regions →Ethylene responsive elements
- 16:3616:36, 31 January 2021 diff hist −155 m A1BG regulatory elements and regions →Hypoxia response elements
- 16:3316:33, 31 January 2021 diff hist −146 m A1BG regulatory elements and regions →Initiator-like element, TCT
- 16:3016:30, 31 January 2021 diff hist −734 m A1BG regulatory elements and regions →Jasmonic acid-responsive elements
- 07:3007:30, 31 January 2021 diff hist +1,040 m A1BG response element positive results →Response element positive results
- 07:2307:23, 31 January 2021 diff hist +3,771 m Jasmonic acid-responsive element gene transcriptions →Samplings
- 05:2805:28, 31 January 2021 diff hist +68 m User:Marshallsumter No edit summary
- 05:1105:11, 31 January 2021 diff hist +1,990 m Interferon regulatory factor gene transcriptions →Consensus sequences
- 01:2601:26, 31 January 2021 diff hist +1,816 m A1BG response element positive results →Response element positive results
30 January 2021
- 19:0719:07, 30 January 2021 diff hist +696 m A1BG response element positive results →Response element positive results
- 17:2817:28, 30 January 2021 diff hist +178 m Complex locus A1BG and ZNF497 →See also
- 17:2317:23, 30 January 2021 diff hist 0 m Complex locus A1BG and ZNF497 No edit summary
- 17:2117:21, 30 January 2021 diff hist −9 m Complex locus A1BG and ZNF497 No edit summary
- 17:0517:05, 30 January 2021 diff hist +290 m Complex locus A1BG and ZNF497 No edit summary
- 01:3801:38, 30 January 2021 diff hist +1,003 m Interferon regulatory factor gene transcriptions →IRF3
- 01:2701:27, 30 January 2021 diff hist +873 m Interferon regulatory factor gene transcriptions →IRF9
- 01:1701:17, 30 January 2021 diff hist +135 m Interferon regulatory factor gene transcriptions →See also
- 01:1301:13, 30 January 2021 diff hist −680 m Interferon regulatory factor gene transcriptions No edit summary
- 00:4500:45, 30 January 2021 diff hist +122 m Template:Gene project No edit summary
- 00:3800:38, 30 January 2021 diff hist +345 m A1BG response element positive results →Response element positive results
29 January 2021
- 23:2023:20, 29 January 2021 diff hist +175 m A1BG response element negative results →Response element negative results
- 23:1123:11, 29 January 2021 diff hist +31 m Inositol, choline-responsive element gene transcriptions →ICRE (Lopes) samplings
- 22:2422:24, 29 January 2021 diff hist −1 m Inositol, choline-responsive element gene transcriptions →ICRE (Canes) samplings
- 22:2422:24, 29 January 2021 diff hist +1,571 m Inositol, choline-responsive element gene transcriptions →ICRE (Lopes) samplings
- 22:2122:21, 29 January 2021 diff hist +3 m A1BG response element negative results →Response element negative results
- 21:5621:56, 29 January 2021 diff hist +722 m Inositol, choline-responsive element gene transcriptions →Consensus sequences
- 21:4321:43, 29 January 2021 diff hist +36 m Inositol, choline-responsive element gene transcriptions →ICRE (Lopes) samplings
- 20:3520:35, 29 January 2021 diff hist +1,544 m Inositol, choline-responsive element gene transcriptions →See also
- 20:3320:33, 29 January 2021 diff hist +1 m Inositol, choline-responsive element gene transcriptions →ICRE (Shwank) samplings
- 20:3320:33, 29 January 2021 diff hist +14 m Inositol, choline-responsive element gene transcriptions →Samplings
- 20:2120:21, 29 January 2021 diff hist +805 m Inositol, choline-responsive element gene transcriptions →Consensus sequences
- 19:3819:38, 29 January 2021 diff hist +234 m A1BG response element positive results →Response element positive results
- 19:2319:23, 29 January 2021 diff hist +272 m Inositol, choline-responsive element gene transcriptions →Samplings
- 06:2906:29, 29 January 2021 diff hist +52 m Inositol, choline-responsive element gene transcriptions →Samplings
- 06:1706:17, 29 January 2021 diff hist +2,255 m Inositol, choline-responsive element gene transcriptions →Consensus sequences
- 05:4505:45, 29 January 2021 diff hist +4 m Inositol, choline-responsive element gene transcriptions →Samplings
- 05:4405:44, 29 January 2021 diff hist +4 m Inositol, choline-responsive element gene transcriptions →Samplings
- 05:2405:24, 29 January 2021 diff hist +1,746 m Inositol, choline-responsive element gene transcriptions →Samplings
- 04:5704:57, 29 January 2021 diff hist +333 m A1BG response element positive results →Response element positive results
- 04:2504:25, 29 January 2021 diff hist +2,670 m Initiator element gene transcriptions →Inr-like, TCTs
- 02:2502:25, 29 January 2021 diff hist +503 m A1BG response element positive results →Response element positive results
- 01:2001:20, 29 January 2021 diff hist +502 m A1BG response element positive results →Response element positive results
28 January 2021
- 23:4923:49, 28 January 2021 diff hist +688 m A1BG response element positive results No edit summary
- 23:2723:27, 28 January 2021 diff hist −1,954 m DNA damage response element gene transcriptions →DRE (Sumrada, core) samplings
- 21:1521:15, 28 January 2021 diff hist −2 m A1BG response element negative results →Response element negative results
- 21:1321:13, 28 January 2021 diff hist +6,084 m DNA damage response element gene transcriptions →DRE (Sumrada) samplings
- 18:2518:25, 28 January 2021 diff hist −2 m A1BG response element negative results →Response element negative results
- 18:2318:23, 28 January 2021 diff hist +251 m DNA damage response element gene transcriptions →Consensus sequences
- 18:2018:20, 28 January 2021 diff hist +1,557 m DNA damage response element gene transcriptions →Samplings
- 16:2116:21, 28 January 2021 diff hist +526 m A1BG response element negative results →Response element negative results
- 05:5205:52, 28 January 2021 diff hist −126 m I box gene transcriptions →F box samplings current
- 05:4905:49, 28 January 2021 diff hist −251 m I box gene transcriptions →I box samplings
- 02:4002:40, 28 January 2021 diff hist +1,758 m I box gene transcriptions →F boxes
- 02:3802:38, 28 January 2021 diff hist +1,740 m I box gene transcriptions →Samplings
- 02:0902:09, 28 January 2021 diff hist 0 m A1BG regulatory elements and regions →Heat shock elements
- 02:0702:07, 28 January 2021 diff hist +1,086 m A1BG regulatory elements and regions →Hex sequences
- 02:0002:00, 28 January 2021 diff hist +940 m A1BG regulatory elements and regions →GT boxes
- 01:5001:50, 28 January 2021 diff hist +4 m A1BG regulatory elements and regions →GT boxes
- 01:4901:49, 28 January 2021 diff hist +742 m A1BG regulatory elements and regions →Gcr1ps
- 01:4501:45, 28 January 2021 diff hist +1,159 m A1BG regulatory elements and regions →Gibberellin responsive elements
- 01:4101:41, 28 January 2021 diff hist +216 m A1BG regulatory elements and regions →Ethylene responsive elements
- 01:3701:37, 28 January 2021 diff hist +54 m A1BG regulatory elements and regions →Circadian control elements
- 01:3601:36, 28 January 2021 diff hist +51 m A1BG regulatory elements and regions →DAF-16 binding elements
- 01:3101:31, 28 January 2021 diff hist +796 m A1BG regulatory elements and regions →Endosperm expression
- 01:2601:26, 28 January 2021 diff hist +719 m A1BG regulatory elements and regions →D boxes
- 01:1601:16, 28 January 2021 diff hist +4 m A1BG regulatory elements and regions →Metal responsive elements
- 01:1401:14, 28 January 2021 diff hist −339 m A1BG regulatory elements and regions →Metal responsive elements
- 01:1201:12, 28 January 2021 diff hist +788 m A1BG response element positive results →Response element positive results
- 00:1000:10, 28 January 2021 diff hist +540 m A1BG response element negative results →Response element negative results
27 January 2021
- 16:4316:43, 27 January 2021 diff hist −120 m Hypoxia-inducible factor gene transcriptions →Samplings
- 05:0305:03, 27 January 2021 diff hist +98 m Hypoxia-inducible factor gene transcriptions →Samplings
- 04:1304:13, 27 January 2021 diff hist +1,760 m Hypoxia-inducible factor gene transcriptions →Samplings
- 04:0704:07, 27 January 2021 diff hist +866 m A1BG response element positive results →Response element positive results
- 04:0504:05, 27 January 2021 diff hist 0 m ABA-response element gene transcriptions →External links
- 03:5303:53, 27 January 2021 diff hist +4,129 m ABA-response element gene transcriptions →Acknowledgements
- 00:2900:29, 27 January 2021 diff hist −252 m A1BG response element negative results →Response element negative results
- 00:2100:21, 27 January 2021 diff hist 0 m A1BG response element positive results →Response element positive results
26 January 2021
- 23:4323:43, 26 January 2021 diff hist +824 m A1BG response element negative results →Response element negative results
- 23:2923:29, 26 January 2021 diff hist +724 m A1BG response element positive results →Response element positive results
- 22:3322:33, 26 January 2021 diff hist +36 m Hsf1p gene transcriptions →HSE10 (Eastmond) samplings
- 05:0005:00, 26 January 2021 diff hist +72 m Hsf1p gene transcriptions →HSE10 (Eastmond) samplings