Serum response element gene transcriptions: Difference between revisions

Jump to navigation Jump to search
VisualWikitext
Line 51: Line 51:


==SER samplings==
==SER samplings==
{{main|Model samplings}}
 
Copying a responsive elements consensus sequence ACAGGATGT and putting the sequence in "⌘F" finds none between ZNF497 and A1BG or none between ZSCAN22 and A1BG as can be found by the computer programs.
Copying a responsive elements consensus sequence ACAGGATGT and putting the sequence in "⌘F" finds none between ZNF497 and A1BG or none between ZSCAN22 and A1BG as can be found by the computer programs.


Line 57: Line 57:
# negative strand, negative direction, looking for ACAGGATGT, 0.
# negative strand, negative direction, looking for ACAGGATGT, 0.
# positive strand, negative direction, looking for ACAGGATGT, 0.
# positive strand, negative direction, looking for ACAGGATGT, 0.
# negative strand, positive direction, looking for ACAGGATGT, 1, ACAGGATGT at 3575.
# positive strand, positive direction, looking for ACAGGATGT, 0.
# positive strand, positive direction, looking for ACAGGATGT, 0.
# negative strand, positive direction, looking for ACAGGATGT, 1, ACAGGATGT at 3575.
# complement, negative strand, negative direction, looking for TGTCCTACA, 0.
# complement, negative strand, negative direction, looking for TGTCCTACA, 0.
# complement, positive strand, negative direction, looking for TGTCCTACA, 0.
# complement, positive strand, negative direction, looking for TGTCCTACA, 0.
Line 65: Line 65:
# inverse complement, negative strand, negative direction, looking for ACATCCTGT, 0.
# inverse complement, negative strand, negative direction, looking for ACATCCTGT, 0.
# inverse complement, positive strand, negative direction, looking for ACATCCTGT, 0.
# inverse complement, positive strand, negative direction, looking for ACATCCTGT, 0.
# inverse complement, negative strand, positive direction, looking for ACATCCTGT, 0.
# inverse complement, positive strand, positive direction, looking for ACATCCTGT, 0.
# inverse complement, positive strand, positive direction, looking for ACATCCTGT, 0.
# inverse complement, negative strand, positive direction, looking for ACATCCTGT, 0.
# inverse negative strand, negative direction, looking for TGTAGGACA, 0.
# inverse negative strand, negative direction, looking for TGTAGGACA, 0.
# inverse positive strand, negative direction, looking for TGTAGGACA, 0.
# inverse positive strand, negative direction, looking for TGTAGGACA, 0.
# inverse positive strand, positive direction, looking for TGTAGGACA, 0.
# inverse positive strand, positive direction, looking for TGTAGGACA, 0.
# inverse negative strand, positive direction, looking for TGTAGGACA, 0.
# inverse negative strand, positive direction, looking for TGTAGGACA, 0.


===SER positive direction (4050-1) distal promoters===
===SER positive direction (4050-1) distal promoters===


# Negative strand, positive direction: ACAGGATGT at 3575.
# Negative strand, positive direction: ACAGGATGT at 3575.
==Response element random dataset samplings==
# RDr0: 0.
# RDr1: 0.
# RDr2: 0.
# RDr3: 0.
# RDr4: 0.
# RDr5: 0.
# RDr6: 0.
# RDr7: 0.
# RDr8: 0.
# RDr9: 0.
# RDr0ci: 0.
# RDr1ci: 0.
# RDr2ci: 0.
# RDr3ci: 0.
# RDr4ci: 0.
# RDr5ci: 0.
# RDr6ci: 0.
# RDr7ci: 0.
# RDr8ci: 0.
# RDr9ci: 0.
===RDr arbitrary (evens) (4560-2846) UTRs===
===RDr alternate (odds) (4560-2846) UTRs===
===RDr arbitrary negative direction (evens) (2846-2811) core promoters===
===RDr alternate negative direction (odds) (2846-2811) core promoters===
===RDr arbitrary positive direction (odds) (4445-4265) core promoters===
===RDr alternate positive direction (evens) (4445-4265) core promoters===
===RDr arbitrary negative direction (evens) (2811-2596) proximal promoters===
===RDr alternate negative direction (odds) (2811-2596) proximal promoters===
===RDr arbitrary positive direction (odds) (4265-4050) proximal promoters===
===RDr alternate positive direction (evens) (4265-4050) proximal promoters===
===RDr arbitrary negative direction (evens) (2596-1) distal promoters===
===RDr alternate negative direction (odds) (2596-1) distal promoters===
===RDr arbitrary positive direction (odds) (4050-1) distal promoters===
===RDr alternate positive direction (evens) (4050-1) distal promoters===
==Response element analysis and results==
{{main|Complex locus A1BG and ZNF497#Name of response elements}}
The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGT+CCATA+TTAGG+A+CAT+CTG+C, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra/>
{|class="wikitable"
|-
! Reals or randoms !! Promoters !! direction !! Numbers !! Strands !! Occurrences !! Averages (± 0.1)
|-
| Reals || UTR || negative || 0 || 2 || 0 || 0
|-
| Randoms || UTR || arbitrary negative || 0 || 10 || 0 || 0
|-
| Randoms || UTR || alternate negative || 0 || 10 || 0 || 0
|-
| Reals || Core || negative || 0 || 2 || 0 || 0
|-
| Randoms || Core || arbitrary negative || 0 || 10 || 0 || 0
|-
| Randoms || Core || alternate negative || 0 || 10 || 0 || 0
|-
| Reals || Core || positive || 0 || 2 || 0 || 0
|-
| Randoms || Core || arbitrary positive || 0 || 10 || 0 || 0
|-
| Randoms || Core || alternate positive || 0 || 10 || 0 || 0
|-
| Reals || Proximal || negative || 0 || 2 || 0 || 0
|-
| Randoms || Proximal || arbitrary negative || 0 || 10 || 0 || 0
|-
| Randoms || Proximal || alternate negative || 0 || 10 || 0 || 0
|-
| Reals || Proximal || positive || 0 || 2 || 0 || 0
|-
| Randoms || Proximal || arbitrary positive || 0 || 10 || 0 || 0
|-
| Randoms || Proximal || alternate positive || 0 || 10 || 0 || 0
|-
| Reals || Distal || negative || 0 || 2 || 0 || 0
|-
| Randoms || Distal || arbitrary negative || 0 || 10 || 0 || 0
|-
| Randoms || Distal || alternate negative || 0 || 10 || 0 || 0
|-
| Reals || Distal || positive || 0 || 2 || 0 || 0
|-
| Randoms || Distal || arbitrary positive || 0 || 10 || 0 || 0
|-
| Randoms || Distal || alternate positive || 0 || 10 || 0 || 0
|}
Comparison:
The occurrences of real SERs are greater than the randoms. This suggests that the real SERs are likely active or activable.


==Acknowledgements==
==Acknowledgements==

Revision as of 04:16, 24 January 2023

Associate Editor(s)-in-Chief: Henry A. Hoff

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[1]

"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)6GG (CArG) motif."[2]

"The “CCATAATAGG” sequence in the SIRT2 gene promoter is a classic SRE, which allows the SRF dimer to firmly bind to the DNA sequence, whereupon various SRF-binding proteins may be recruited to form a protein complex, which in turn modulates the expression of the SIRT2 gene."[2]

Consensus sequences

Main article: Consensus sequence gene transcriptions

In the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC,

5'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG,

5'-CATCTG-3' is an E box that does not occur in either promoter of A1BG,

5'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F",

5'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.

SER samplings

Copying a responsive elements consensus sequence ACAGGATGT and putting the sequence in "⌘F" finds none between ZNF497 and A1BG or none between ZSCAN22 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence ACAGGATGT (starting with SuccessablesSER.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for ACAGGATGT, 0.
  2. positive strand, negative direction, looking for ACAGGATGT, 0.
  3. negative strand, positive direction, looking for ACAGGATGT, 1, ACAGGATGT at 3575.
  4. positive strand, positive direction, looking for ACAGGATGT, 0.
  5. complement, negative strand, negative direction, looking for TGTCCTACA, 0.
  6. complement, positive strand, negative direction, looking for TGTCCTACA, 0.
  7. complement, positive strand, positive direction, looking for TGTCCTACA, 1, TGTCCTACA at 3575.
  8. complement, negative strand, positive direction, looking for TGTCCTACA, 0.
  9. inverse complement, negative strand, negative direction, looking for ACATCCTGT, 0.
  10. inverse complement, positive strand, negative direction, looking for ACATCCTGT, 0.
  11. inverse complement, negative strand, positive direction, looking for ACATCCTGT, 0.
  12. inverse complement, positive strand, positive direction, looking for ACATCCTGT, 0.
  13. inverse negative strand, negative direction, looking for TGTAGGACA, 0.
  14. inverse positive strand, negative direction, looking for TGTAGGACA, 0.
  15. inverse positive strand, positive direction, looking for TGTAGGACA, 0.
  16. inverse negative strand, positive direction, looking for TGTAGGACA, 0.

SER positive direction (4050-1) distal promoters

  1. Negative strand, positive direction: ACAGGATGT at 3575.

Response element random dataset samplings

  1. RDr0: 0.
  2. RDr1: 0.
  3. RDr2: 0.
  4. RDr3: 0.
  5. RDr4: 0.
  6. RDr5: 0.
  7. RDr6: 0.
  8. RDr7: 0.
  9. RDr8: 0.
  10. RDr9: 0.
  11. RDr0ci: 0.
  12. RDr1ci: 0.
  13. RDr2ci: 0.
  14. RDr3ci: 0.
  15. RDr4ci: 0.
  16. RDr5ci: 0.
  17. RDr6ci: 0.
  18. RDr7ci: 0.
  19. RDr8ci: 0.
  20. RDr9ci: 0.

RDr arbitrary (evens) (4560-2846) UTRs

RDr alternate (odds) (4560-2846) UTRs

RDr arbitrary negative direction (evens) (2846-2811) core promoters

RDr alternate negative direction (odds) (2846-2811) core promoters

RDr arbitrary positive direction (odds) (4445-4265) core promoters

RDr alternate positive direction (evens) (4445-4265) core promoters

RDr arbitrary negative direction (evens) (2811-2596) proximal promoters

RDr alternate negative direction (odds) (2811-2596) proximal promoters

RDr arbitrary positive direction (odds) (4265-4050) proximal promoters

RDr alternate positive direction (evens) (4265-4050) proximal promoters

RDr arbitrary negative direction (evens) (2596-1) distal promoters

RDr alternate negative direction (odds) (2596-1) distal promoters

RDr arbitrary positive direction (odds) (4050-1) distal promoters

RDr alternate positive direction (evens) (4050-1) distal promoters

Response element analysis and results

Main article: Complex locus A1BG and ZNF497 § Name of response elements

The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGT+CCATA+TTAGG+A+CAT+CTG+C, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.[1]

Reals or randoms Promoters direction Numbers Strands Occurrences Averages (± 0.1)
Reals UTR negative 0 2 0 0
Randoms UTR arbitrary negative 0 10 0 0
Randoms UTR alternate negative 0 10 0 0
Reals Core negative 0 2 0 0
Randoms Core arbitrary negative 0 10 0 0
Randoms Core alternate negative 0 10 0 0
Reals Core positive 0 2 0 0
Randoms Core arbitrary positive 0 10 0 0
Randoms Core alternate positive 0 10 0 0
Reals Proximal negative 0 2 0 0
Randoms Proximal arbitrary negative 0 10 0 0
Randoms Proximal alternate negative 0 10 0 0
Reals Proximal positive 0 2 0 0
Randoms Proximal arbitrary positive 0 10 0 0
Randoms Proximal alternate positive 0 10 0 0
Reals Distal negative 0 2 0 0
Randoms Distal arbitrary negative 0 10 0 0
Randoms Distal alternate negative 0 10 0 0
Reals Distal positive 0 2 0 0
Randoms Distal arbitrary positive 0 10 0 0
Randoms Distal alternate positive 0 10 0 0

Comparison:

The occurrences of real SERs are greater than the randoms. This suggests that the real SERs are likely active or activable.

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

See also

References

  1. ↑ 1.0 1.1 Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
  2. ↑ 2.0 2.1 Xiaomin Zhang, Gohar Azhar, Jeanne Y. Wei (21 December 2017). "SIRT2 gene has a classic SRE element, is a downstream target of serum response factor and is likely activated during serum stimulation". PLOS One. 12 (12): e0190011. doi:10.1371/journal.pone.0190011. Retrieved 23 February 2021.

External links

Retrieved from "https://www.wikidoc.org/index.php?title=Serum_response_element_gene_transcriptions&oldid=1732822"