Oaf1p gene transcriptions: Difference between revisions
m (→Samplings) |
m (→Samplings) |
||
Line 35: | Line 35: | ||
# complement, positive strand, positive direction, looking for GCCN<sub>3</sub>ANTN<sub>9-12</sub>GGC, 0. | # complement, positive strand, positive direction, looking for GCCN<sub>3</sub>ANTN<sub>9-12</sub>GGC, 0. | ||
# complement, negative strand, positive direction, looking for GCCN<sub>3</sub>ANTN<sub>9</sub>GGC, 2, GCCTGCACTCTGGCGAGAGGC at 1484, GCCTGCACTCTGGCGAGAGGC at 1384. | # complement, negative strand, positive direction, looking for GCCN<sub>3</sub>ANTN<sub>9</sub>GGC, 2, GCCTGCACTCTGGCGAGAGGC at 1484, GCCTGCACTCTGGCGAGAGGC at 1384. | ||
# inverse complement, negative strand, negative direction, looking for | # inverse complement, negative strand, negative direction, looking for CGGN<sub>9-12</sub>TNAN<sub>3</sub>CCG, 0. | ||
# inverse complement, positive strand, negative direction, looking for | # inverse complement, positive strand, negative direction, looking for CGGN<sub>9-12</sub>TNAN<sub>3</sub>CCG, 0. | ||
# inverse complement, positive strand, positive direction, looking for | # inverse complement, positive strand, positive direction, looking for CGGN<sub>9-12</sub>TNAN<sub>3</sub>CCG, 0. | ||
# inverse complement, negative strand, positive direction, looking for | # inverse complement, negative strand, positive direction, looking for CGGN<sub>9-12</sub>TNAN<sub>3</sub>CCG, 0. | ||
# inverse negative strand, negative direction, looking for | # inverse negative strand, negative direction, looking for GCCN<sub>9-12</sub>ANTN<sub>3</sub>GGC, 0. | ||
# inverse positive strand, negative direction, looking for | # inverse positive strand, negative direction, looking for GCCN<sub>9-12</sub>ANTN<sub>3</sub>GGC, 0. | ||
# inverse positive strand, positive direction, looking for | # inverse positive strand, positive direction, looking for GCCN<sub>9-12</sub>ANTN<sub>3</sub>GGC, 0. | ||
# inverse negative strand, positive direction, looking for | # inverse negative strand, positive direction, looking for GCCN<sub>9-12</sub>ANTN<sub>3</sub>GGC, 0. | ||
===Oaf1 distal promoters=== | |||
{{main|Distal promoter gene transcriptions}} | |||
Negative strand, negative direction: CGGTCATGAAACCCTCCGACTCCG at 2229. | |||
Positive strand, positive direction: CGGACGTGAGACCGCTCTCCG at 1484, CGGACGTGAGACCGCTCTCCG at 1384. | |||
==See also== | ==See also== |
Revision as of 00:44, 11 February 2021
Associate Editor(s)-in-Chief: Henry A. Hoff
Human genes
Interactions
Consensus sequences
The upstream activating sequence (UAS) for the Oaf1p transcription factor is 5'-CGGN3TNAN9-12CCG-3' or 5'-CGG(A/C/G/T)(A/C/G/T)(A/C/G/T)T(A/C/G/T)A(A/C/G/T)9-12CCG-3'.[1]
Samplings
Copying CGGN3TNAN9-12CCG in "⌘F" yields none between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
For the Basic programs testing consensus sequence CGGN3TNAN9-12CCG (starting with SuccessablesOaf1.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:
- negative strand, negative direction, looking for CGGN3TNAN12CCG, 1, CGGTCATGAAACCCTCCGACTCCG at 2229.
- positive strand, negative direction, looking for CGGN3TNAN9-12CCG, 0.
- positive strand, positive direction, looking for CGGN3TNAN9CCG, 2, CGGACGTGAGACCGCTCTCCG at 1484, CGGACGTGAGACCGCTCTCCG at 1384.
- negative strand, positive direction, looking for CGGN3TNAN9-12CCG, 0.
- complement, negative strand, negative direction, looking for GCCN3ANTN9-12GGC, 0.
- complement, positive strand, negative direction, looking for GCCN3ANTN12GGC, 1, GCCAGTACTTTGGGAGGCTGAGGC at 2229.
- complement, positive strand, positive direction, looking for GCCN3ANTN9-12GGC, 0.
- complement, negative strand, positive direction, looking for GCCN3ANTN9GGC, 2, GCCTGCACTCTGGCGAGAGGC at 1484, GCCTGCACTCTGGCGAGAGGC at 1384.
- inverse complement, negative strand, negative direction, looking for CGGN9-12TNAN3CCG, 0.
- inverse complement, positive strand, negative direction, looking for CGGN9-12TNAN3CCG, 0.
- inverse complement, positive strand, positive direction, looking for CGGN9-12TNAN3CCG, 0.
- inverse complement, negative strand, positive direction, looking for CGGN9-12TNAN3CCG, 0.
- inverse negative strand, negative direction, looking for GCCN9-12ANTN3GGC, 0.
- inverse positive strand, negative direction, looking for GCCN9-12ANTN3GGC, 0.
- inverse positive strand, positive direction, looking for GCCN9-12ANTN3GGC, 0.
- inverse negative strand, positive direction, looking for GCCN9-12ANTN3GGC, 0.
Oaf1 distal promoters
Negative strand, negative direction: CGGTCATGAAACCCTCCGACTCCG at 2229.
Positive strand, positive direction: CGGACGTGAGACCGCTCTCCG at 1484, CGGACGTGAGACCGCTCTCCG at 1384.
See also
References
- ↑ Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check
|pmid=
value (help). Retrieved 18 September 2020.