All public logs
Jump to navigation
Jump to search
Combined display of all available logs of wikidoc. You can narrow down the view by selecting a log type, the username (case-sensitive), or the affected page (also case-sensitive).
- 18:02, 3 March 2024 Marshallsumter talk contribs created page Non-degenerate nucleotides per response element (Created page with " {| class="wikitable sortable" |+ Number of non-degenerate nucleotides versus number of response elements |- ! Number of nucleotides !! Letters of nucleotides !! Number of response elements !! Average ± deviation !! Order of list |- | 1 || A || 295 || 295.0 ± 0.0 || 1 |- | 1 || T || 285 || - || 1 |- | 1 || G || 286 || - || 3 |- | 1(4) || C || 300 || 291.5 ± 6 || 5 |- | 2 || AA || 105 || 105 ± 0.0 || 1 |- | 2 || AT || 105 || 105 ± 0.0 || 1 |- | 2 || TA || 74 |...")
- 23:23, 23 July 2023 Marshallsumter talk contribs created page Initiator-like element gene transcriptions (Created page with " Consensus sequence for an Inr-like/TCT is TTCTCT.<ref name=Matsumoto>{{ cite journal |author=Takuya Matsumoto, Saemi Kitajima, Chisato Yamamoto, Mitsuru Aoyagi, Yoshiharu Mitoma, Hiroyuki Harada and Yuji Nagashima |title=Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish ''Takifugu rubripes'' |journal=Fisheries Science |date=9 August 2020 |volume=86 |issue= |pages=873-887 |url=https://researchmap.jp/hiroyukihar...")
- 07:39, 5 April 2023 Marshallsumter talk contribs created page ''Asparagaceae'' (Created page with "Asparagaceae, known as the asparagus family, is a family of flowering plants, placed in the order Asparagales of the monocots.<ref name="APG3">{{Cite journal |last=Angiosperm Phylogeny Group III|year=2009 |title=An update of the Angiosperm Phylogeny Group classification for the orders and families of flowering plants: APG III |journal=Botanical Journal of the Linnean Society|volume=161 |issue=2|pages=105–121|doi=10.1111/j.1095-8339.2009....")
- 07:09, 5 April 2023 Marshallsumter talk contribs created page Remedy (Created page with "thumb|upright|Modern drug ampoules are shown. Credit: [[c:user:Ignis|ignis.]] {{AE}} Henry A. Hoff '''Def.''' "a medicine, application, or treatment that relieves or cures a disease"<ref name=RemedyWikt>{{ cite web |author=Deekayen |title=remedy |publisher=Wikimedia Foundation, Inc |location=San Francisco, California |date=19 April 2005 |url=http://en.wiktionary.org/wiki/remedy |accessdate=2013-06-17 }}</ref> is called a '''remedy'''. {{cl...")
- 14:33, 19 February 2023 Marshallsumter talk contribs created page User talk:Jose Loyola (Created page with "==Autoblock== Hi Jose Loyola! My IP was blocked for 24 hours: "Your IP address has been automatically blocked because it was used by another user, who was blocked by Jose Loyola. The reason given is: Autoblocked because your IP address has been recently used by "Sara Zand"." I sent you an email that stated my IP and it's not the one in the email. "The reason given for Sara Zand's block is "Intimidating behavior/harassment: Removing content from pages" Start of...")
- 06:37, 13 November 2022 Marshallsumter talk contribs created page General regulatory factors (Created page with ""General regulatory factors (GRFs), such as Reb1, Abf1, Rap1, Mcm1, and Cbf1, positionally organize yeast chromatin through interactions with a core consensus DNA sequence."<ref name=Rossi>{{ cite journal |author=Matthew J. Rossi |author2=William K.M. Lai |author3=B. Franklin Pugh |title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors |journal=Genome Research |date=21 March 2018 |volume=28 |issue= |pages=497-508 |url=https://genome...")
- 21:43, 21 August 2021 Marshallsumter talk contribs created page Helix-turn-helix transcription factors (Created page with "200px|thumb|The λ repressor of [[bacteriophage lambda employs two helix-turn-helix motifs (left; green) to bind DNA (right; blue and r...")
- 15:52, 14 August 2021 Marshallsumter talk contribs created page WD-40 repeat family (Created page with "{{AE}} Henry A. Hoff "Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During ''Phaseolus vulgaris'' root d...")
- 00:43, 27 July 2021 Marshallsumter talk contribs created page Basic helix–loop–helix (Created page with "{{AE}} Henry A. Hoff {{distinguish|text=helix-turn-helix domains, a motif similar in shape and function}} {{Pfam_box | Symbol = bHLH | Name = basic helix–loop–helix DN...")
- 01:36, 9 June 2021 Marshallsumter talk contribs created page Tbf1 regulatory factor gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Ribosome biogenesis in ''Saccharomyces cerevisiae'' involves a regulon of >200 genes (Ribi genes) coordinately regulated in response to nutrient availab...")
- 05:04, 7 May 2021 Marshallsumter talk contribs created page Hypoxia response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "We recently discovered a strongly conserved distal 5' [hypoxia response element] HRE and suggested that it might contribute to oxygen-regulated [Erythro...")
- 04:53, 27 April 2021 Marshallsumter talk contribs created page Cytokinin response regulator gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Cytokinin fulfills its diverse roles in planta through a series of transcriptional responses."<ref name=Xiel>{{ cite journal |author=Mingtang Xie1, Hong...")
- 04:58, 22 April 2021 Marshallsumter talk contribs created page TEA consensus sequence gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The TEA/ATTS transcription factor family consists of mammalian, avian, nematode, insect and fungal members that share a conserved TEA domain. The TEA do...")
- 06:32, 21 April 2021 Marshallsumter talk contribs created page GGC triplet gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins), and they recognize highly re...")
- 05:23, 20 April 2021 Marshallsumter talk contribs created page Translational control sequence gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Maternal mRNAs are translationally regulated during early development. Zar1 and its closely related homolog, Zar2, are both crucial in early development...")
- 17:14, 19 April 2021 Marshallsumter talk contribs created page Cell-cycle box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The 5' non-coding part contains the sequence elements characteristic for eukaryotic promoters such as TATA and CAAT boxes as well as an inverted motif t...")
- 02:22, 18 April 2021 Marshallsumter talk contribs created page Musashi binding element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The 24-nt ''Xenopus'' Mos [polyadenylation response element] PRE (Charlesworth ''et al'', 2002) contained a match to the SELEX-derived murine Musashi RN...")
- 20:10, 17 April 2021 Marshallsumter talk contribs created page Cytoplasmic polyadenylation element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The most well-understood mechanism for controlling cytoplasmic polyadenylation is regulation of mRNAs containing the cytoplasmic polyadenylation element...")
- 15:36, 1 April 2021 Marshallsumter talk contribs created page Copper response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "''Chlamydomonas reinhardtii'' activates the transcription of the ''Cyc6'' and the ''Cpx1'' genes (encoding cytochrome ''c<sub>6</sub>'' and coprogen oxi...")
- 05:05, 24 March 2021 Marshallsumter talk contribs created page Adenylate–uridylate rich element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Functionally defined and derived adenylate–uridylate rich element (ARE) consensus sequences have been shown to exist in the 3′UTR of selected mRNAs...")
- 18:42, 19 March 2021 Marshallsumter talk contribs created page N box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Human pColQ1a carries consensus sequences for transcriptional factors E-protein (E-box, CANNTG), NFAT (GGAAA), c-Ets transcription factor [c-Ets, (C/A)G...")
- 20:35, 17 March 2021 Marshallsumter talk contribs created page K-box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "In fact, the ''groE'' genes were greatly induced upon heat shock in the ''hrcA'' mutant which was dark-treated prior to the heat shock in order to keep...")
- 03:32, 12 March 2021 Marshallsumter talk contribs created page YY1 gene transcriptions (Created page with "{{AE}} Henry A. Hoff "To further explore how [high-glucose] HG regulates ''Tug1'' transcription, we retrieved the promoter region of the murine ''Tug1'' gene to identify pote...")
- 20:35, 8 March 2021 Marshallsumter talk contribs created page Vhr1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Transcription of the ''Saccharomyces cerevisiae'' vitamin H transporter gene VHT1 is enhanced by low extracellular biotin."<ref name=Weider>{{ cite jour...")
- 14:24, 7 March 2021 Marshallsumter talk contribs created page Transcription factor 3 gene transcriptions (Created page with "{{AE}} Henry A. Hoff Transcription factor 3 (E2A immunoglobulin enhancer-binding factors E12/E47) (TCF3), is a protein that in humans is encoded by the ''TCF3'' gen...")
- 18:27, 6 March 2021 Marshallsumter talk contribs created page UTR promoter gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} ==Gene expressions== {{main|Gene expressions}} ==Interactions== {{main|Interaction gene transcriptions}} ==Consen...")
- 02:42, 2 March 2021 Marshallsumter talk contribs created page Sucrose box gene transcriptions (Created page with "{{AE}} Henry A. Hoff Manual "scanning was also done to identify the presence of sugar responsive elements such as sucrose box (NNAATCA) (Chen et al., 2002; Fillion et al., 19...")
- 02:55, 25 February 2021 Marshallsumter talk contribs created page Sip4p gene transcriptions (Created page with "{{AE}} Henry A. Hoff The UAS sequence for the transcription factor Sip4p is CCRTYCRTCCG, which occurs in the promoters of ''FBP1, PKC1, ICL1'' genes in ''S. cerevisiae'', wit...")
- 19:37, 24 February 2021 Marshallsumter talk contribs created page A1BG response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff '''Def.''' nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to v...")
- 03:27, 24 February 2021 Marshallsumter talk contribs created page Bioinformatics tool gene transcriptions (Created page with "{{AE}} Henry A. Hoff '''Def.''' a "field of science in which biology, computer science, and information technology merge into a single discipline to analyse biological inform...")
- 01:55, 24 February 2021 Marshallsumter talk contribs created page Complement copy gene transcriptions (Created page with "{{AE}} Henry A. Hoff '''Def.''' a "nucleotide sequence in which each base is replaced by the complementary base of the given sequence: adenine (A) by thymine (T) or uracil (U...")
- 22:16, 23 February 2021 Marshallsumter talk contribs created page Serum response element gene transcriptions (Created page with "{{AE}} Henry A. Hoff The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box,...")
- 22:10, 23 February 2021 Marshallsumter talk contribs created page Inverse copy gene transcriptions (Created page with "{{AE}} Henry A. Hoff '''Def.''' "a state in which something has been turned (properly) upside down or (loosely) inside out or backwards"<ref name=InverseWikt>{{ cite web |aut...")
- 18:54, 22 February 2021 Marshallsumter talk contribs created page Rox1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "All promoters recognized by pol-II may require one or more UASs for regulated gene expression [36,37]."<ref name=Tang/> ==Human genes== {{main|Human ge...")
- 19:43, 21 February 2021 Marshallsumter talk contribs created page Leu3 gene transcriptions (Created page with "{{AE}} Henry A. Hoff With ''HAS1'' ending at zero and ''TDA1'' beginning at above 1000 bp, Leu3 is from 536 - 545 nts yielding consensus sequences (C/G)C(G/T)NNNN(A/C)G(C/G),...")
- 04:21, 21 February 2021 Marshallsumter talk contribs created page Rgt1p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Using MAP-C [Mutation Analysis in Pools by Chromosome conformation capture], we show that inducible interchromosomal pairing between ''HAS1pr-TDA1pr'' a...")
- 03:01, 16 February 2021 Marshallsumter talk contribs created page Xenobiotic responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff The classical recognition motif of the AhR/ARNT complex, referred to as either the AhR-, dioxin- or xenobiotic- responsive element (AHRE, DRE or XRE), co...")
- 04:22, 11 February 2021 Marshallsumter talk contribs created page ORE1 binding site gene transcriptions (Created page with "{{AE}} Henry A. Hoff "As a transcription factor, ORE1 was reported to bind to consensus DNA sequences of [ACG][CA]GT[AG]N{5,6}[CT]AC[AG] [29] or T[TAG][GA]CGT[GA][TCA][TAG] [...")
- 02:09, 11 February 2021 Marshallsumter talk contribs created page Zinc responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "A robust set of genes that responded consistently to Zn limitation was identified, and the set enabled the definition of the Zn-specific Zap1p regulon,...")
- 03:12, 10 February 2021 Marshallsumter talk contribs created page Carbon source-responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "Deletion analysis of the ICL1 promoter led to the identification of an upstream activating sequence element, UASICL1 (5' CATTCATCCG 3'), necessary and s...")
- 05:03, 7 February 2021 Marshallsumter talk contribs created page Msn2,4p gene transcriptions (Created page with "{{AE}} Henry A. Hoff "[msn2p] is a transcription factor that binds to stress-response elements (STREs) resulting in the induction of more than 200 genes.10,11 STRE has a core...")
- 00:32, 5 February 2021 Marshallsumter talk contribs created page Met31p box gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The transcriptional regulation of the sulfur amino acid pathway in Saccharomyces cerevisiae depends on a single activator, Met4p, whose function require...")
- 03:59, 14 January 2021 Marshallsumter talk contribs created page Hex sequence gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} ==Consensus sequences== {{main|Consensus sequence gene transcriptions}} The Hex sequence has the consensus (TGACGTG...")
- 18:35, 3 January 2021 Marshallsumter talk contribs created page Gene project (Created page with "Each of the gene infoboxes on WikiDoc display "VALUE_ERROR (nil)" at the top instead of the gene name followed by answers obtained from WikiData for each entry. Compare ZSCAN...")
- 04:26, 28 December 2020 Marshallsumter talk contribs created page Ethylene responsive element gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} ==Consensus sequences== {{main|Consensus sequence gene transcriptions}} Ethylene responsive elements (ATTTCAAA).<re...")
- 05:35, 26 December 2020 Marshallsumter talk contribs created page Endosperm expression gene transcriptions (Created page with "{{AE}} Henry A. Hoff ==Human genes== {{main|Human genes}} ==Gene expressions== {{main|Gene expressions}} ==Consensus sequences== {{main|Consensus sequence gene transcriptio...")
- 03:02, 21 December 2020 Marshallsumter talk contribs created page EIN3 binding site gene transcriptions (Created page with "{{AE}} Henry A. Hoff "We scanned the ORE1 promoter and found a putative EIN3 binding site (EBS), ATGAACCT, located 1056~1064 bp upstream from the start codon (ATG) of the gen...")
- 23:18, 30 November 2020 Marshallsumter talk contribs created page Coupling element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the cou...")
- 02:37, 30 November 2020 Marshallsumter talk contribs created page Circadian control element gene transcriptions (Created page with "{{AE}} Henry A. Hoff "The circadian control element (circadian; Anderson ''et al.'', 1994) was found in 10 FvTCP genes."<ref name=Wei>{{ cite journal |author=Wei Wei, Yang Hu...")
- 02:52, 28 November 2020 Marshallsumter talk contribs created page A1BG response element positive results (Created page with "{{AE}} Henry A. Hoff '''Def.''' nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to v...")