Complex locus A1BG and ZNF497

Associate Editor(s)-in-Chief: Henry A. Hoff

Alpha-1-B glycoprotein is a 54.3 kDa protein in humans that is encoded by the A1BG gene. The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins.

A1BG was located on the DNA strand of chromosome 19. Additionally, A1BG, in current nucleotide numbering (58,345,183-58,353,492), is located adjacent to the ZSCAN22 gene (58,326,994-58,342,332) on the positive DNA strand, as well as the ZNF837 (58,367,623 - 58,381,030, complement) and ZNF497 (58,354,357 - 58,362,751, complement) genes on the negative strand. In the current nucleotide numbering, the A1BG untranslated region (UTR) has been expanded so that with ZSCAN22 ending at 58,342,332, the nucleotides used in this study are 58,342,347 to 58,346,897 on both strands, with the current UTR for A1BG beginning at 58,345,183.

Introduction

"Many important disease-related pathways utilize transcription factors that specifically bind DNA (e.g., c-Myc, HIF-1, TCF1, p53) as key nodes or endpoints in complex signaling networks. In such cases the transcription factor itself is often the most attractive target. However, drugging transcription factors is challenging owing to an absence of small ligand binding sites in their DNA-binding domain and the presence of a highly charged DNA-binding surface [1]."

If a specific gene appears to be involved in a disease-related or deleterious pathway being able to alter its expression so as to improve the person's health may be needed. To alter its expression constructively may require knowing what regulatory elements exist in the gene's nearby promoters.

Response elements

Main article: A1BG response element gene transcriptions

Identifying a bona fide response element is more difficult than a simple inspection. In order to attribute the response element to a candidate sequence, some observations have to be conducted using molecular, biological and biophysical methods and functional approaches. Findings may indicate that response element in the promoter is a functional element.

A likely response element found by simple inspection may also be inactive due to methylation.

Response Elements: "Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions."

"Under conditions of stress, a transcription activator protein binds to the response element and stimulates transcription. If the same response element sequence is located in the control regions of different genes, then these genes will be activated by the same stimuli, thus producing a coordinated response."

WD-40 repeat family

Main article: WD-40 repeat family

"Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During Phaseolus vulgaris root development, RACK1 (PvRACK1) mRNA expression was induced by auxins, abscissic acid, cytokinin, and gibberellic acid."

Abscissic acid (ABA) response elements

In A1BG response element positive results, abscissic acid (ABA) response elements (ABREs) have been identified for example in the UTR for A1BG between ZSCAN22 and A1BG. If these response elements are active then A1BG can be transcribed as a key cis-regulatory element in ABA signaling. "However, for ABA responsive transcription to occur, a single copy of the ABRE is not sufficient. In barley, the combination of an ABRE and one of two known coupling elements CE1 (TGCCACCGG) and CE3 (GCGTGTC) constitutes an ABA responsive complex (ABRC) in the regulation of the ABA‐inducible genes HVA1 and HVA22 (Shen and Ho 1995; Shen et al. 1996). It was also shown that a pair of ABREs can function as an ABRC with the second ABRE playing the role of the coupling element in rice (Hobo et al. 1999), barley (Shen et al. 1996) and Arabidopsis (Nakashima et al. 2006). Coupling of two CE3s is much less active in conferring ABA response to the minimal promoter (Shen et al. 2004). Interestingly, CE3 appears to be specific to monocots. In Arabidopsis, the CE3 element is practically absent; thus, Arabidopsis relies on paired ABREs to form ABRCs (Gomez‐Porras et al. 2007) or on the coupling of a DRE (TACCGACAT) with ABRE (Narusaka et al. 2003; Nakashima et al. 2006)."

No coupling elements occur in the negative direction between ZSCAN22 and A1BG. Two ABREs occur in both directions suggesting pairs may be available to function as an ABRC on either side of A1BG, subject to needed proximity. The random datasets have more occurrences further away from A1BG and always much fewer occurrences per dataset. These suggest that those around A1BG are not random and are likely active or activatable.

No DRE (TACCGACAT) occurs in either direction of A1BG.

Auxin response factors

In A1BG response element positive results, auxin response factors (ARFs) have been identified in the UTR for A1BG between ZSCAN22 and A1BG and between ZNF497 and A1BG. ARF5s occur in this side's core promoter or proximal promoter. If these response elements are active then A1BG can be transcribed as a regulatory element in auxin signaling. The "genome binding of two ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferred ARF binding site (ARFbs) arrangements (orientation and spacing)."

The position weight matrices (PWMs) used to model ARF DNA binding specificity suggest more general consensus sequences may be (C/G/T)N(G/T)G(C/T)(C/T), where ARF2 is (C/G/T)(A/C/T)(G/T)G(C/T)(C/T)(G/T)(C/G)(A/C/T)(A/G/T) and ARF5/MP is (C/G/T)N(G/T)GTC(G/T). The likely consensus sequence for ARF2 would allow 2592 possible response elements, and that for ARF5/MP would be 48.

Ulmasov ARFbs

"ARFbs were originally defined as TGTCTC (Ulmasov et al., 1995, Guilfoyle et al., 1998), [...]."

The consensus sequence found by Ulmasov (1995) TGTCTC occurs in the negative direction for the UTR (four), proximal promoter (one) and distal promoter (twelve) and in the positive direction only in the distal promoter (ten). But, the random datasets had only one on average in the distal promoter for either direction and only 0.2 in the UTR and none in the proximal promoter. This suggests that the occurrences of the consensus sequences of Ulmasov in the promoters of A1BG are real and likely active or activatable.

Boer ARFbs

"More recently, protein binding microarray (PBM) experiments suggested that TGTCGG are preferred ARFbs, [...] (Boer et al., 2014, Franco-Zorrilla et al., 2014, Liao et al., 2015)."

The consensus sequence of Boer 2014 TGTCGG occurs only once in the UTR in the negative direction and seven times in the positive direction in the distal promoters. The random datasets had about one per dataset in the UTR. The random occurrences of one to three times in the distal promoters for each of ten data sets. While the occurrence in the UTR about matches a random occurrence, the occurrences in the distal promoters are more frequent in the real promoters vs. the random datasets.

Stigliani ARF2s

Random sampling (even numbered datasets for ZSCAN22 to A1BG) for UTRs range from two to eight ARFs whereas the two strands have 6 (negative strand) and 12, respectively, in the negative direction. The negative strand, negative direction results (6) for A1BG fall within the range of random results by number of results, whereas the results for the positive strand, negative direction (12) are well outside the number of random results, suggesting they are real. None of the actual nucleotide sequences for either strand, negative direction match any of the random results.

For ARF core promoters, four of the ten random nucleotide sequences have core promoters, ranging from one to two, correspond (odd numbered random sequences for positive direction, ZNF497 to A1BG) only and none match the nucleotide sequence for the real, negative strand, positive direction.

Only three of the ten random datasets had results for the proximal promoters, only one result each, in the negative direction and none matched the real result. The positive direction random datasets had results in seven ranging from one to four with no nucleotide sequence matches.

The nucleotide sequences for the distal promoters do not match: the random data sets range from (2 to 9) in number and (5 to 14) but the real sets range from (14 to 38) and (15 to 51), respectively. The real occurrences way outnumber the random results.

The results in the promoters of A1BG have about 100 unique nucleotide sequences (Stigliani et al) of the total possible 2592 such sequences per the PMWs assuming a weight of one. The actual weighting is expected to reduce the number of likely sequences resulting in few duplicates between sequences found to occur and those found in the random data sets. Common to both results are only six nucleotide sequences.

Stigliani ARF5s

The varieties of the short consensus sequence for ARF5/MP (C/G/T)N(G/T)GTC(G/T) have been detected in the UTR (25), proximal (3) and distal (49) promoters for A1BG between ZSCAN22 and the A1BG gene and the core (5), proximal (1) and distal (84) promoters for A1BG on the ZNF497 side.

Random datasets arbitrarily chosen to represent the negative direction (even numbered datasets) and positive direction (odd numbered datasets) have only from one to five for the consensus sequence UTRs and two to nine for the inverse complement sequences. Regarding core promoters, two random datasets had one or two inverse complement nucleotide sequences on the even numbered sites, whereas the positive direction random datasets had two datasets with one and three nucleotide sequences. Random datasets had proximal promoters only on the positive side (one to two). Distal promoter sequences for the negative direction had from two to nine nucleotide sequences. For the positive direction, the consensus sequences ranged from eight to fifteen.

Starting with the random occurrences among the ARF5 possibilities 68 have duplicates among the random or real datasets. These same duplicates only occur 78 % of the time among the real datasets.

Using the real consensus sequences to look for duplicates first among the other reals then among the randoms found 97 % had duplicates among either the other reals or among the randoms.

The possible variety of ARF5s within the consensus sequences (C/G/T)N(G/T)GTC(G/T): 3*4*2*1*1*1*2 = 48 plus complement inverses (A/C)GAC(A/C)N(A/C/G): 2*1*1*1*2*4*3 = 48 with duplicates, 96 minus duplicates of some 18 suggests that up to 78 could occur if sampling were large enough.

That the randoms and real occurrences do not match up suggests that the reals are not randomly occurring.

Cytokinins

In A1BG response element positive results, several of the cytokinin response regulators: ARR10s, ARR12s, and those of Rashotte et al. (2003) have occurrences in the UTR of A1BG from the ZSCAN22 side and in the proximal promoters of A1BG from the ZNF497 side.

Any of the randomly generated nucleotide data sets (0 through 9) can be used to represent any of the real data for the response element of interest.

Every response element ARR1 has 6 in the distal promoter (2 negative direction and 4 positive direction). Random samplings ranges from 0-3. For the proximal promoter there is one for two datasets out of 20. No random in the core promoter. And, four for two datasets in the UTR out of 20.

ARR10 has only one element in the negative direction in the UTR. Four of the 10 random datasets had 1.25 response elements in the UTR. No sequences in the core promoters, but one sequence in the proximal promoter and many in the distal promoters. The only response element in the A1BG promoters is an inverse complement and five of the six random UTR response elements are inverse complements.

For ARR12, the random samples have about 2.5 UTR elements, but ARR12 has only one in the UTR. The A1BG has no core promoters on either side but one random sample out of ten has one on the positive direction from ZNF497. The ARR12 in A1BG proximal promoters have none while two out of ten random datasets have one each. In the distal promoters the negative directions averaged four while the random datasets average 1.3. The positive direction has only one and the random datasets averaged 1.3.

The Rashotte1 ARR (ARRR1) results differ from random datasets: one in the UTR on the ZSCAN22 side versus two (random). No core promoter elements versus one in two of ten (random). Three proximal promoters versus none (random). Distal promoters: one in the negative direction and three in the positive and one to three (random).

For (G/A)GAT(T/C) in ARRR2 (Rashotte2) UTRs, there are none for the negative strand, negative direction, but each random data set finds 2-8. For the positive strand, negative direction, there are seven versus 2-8 from the randomly generated nucleotide data sets (0 through 9).

For (A/G)ATC(C/T) in ARRR2 (Rashotte2) UTRs, all four of the negative strand, negative direction results are inverse complements, where the random data sets have (4-9). For the positive strand, negative direction there are eleven, but the random datasets have 2-9.

Neither direction for ARRR2 (Rashotte2) has core promoter elements, while the random results have an average of (1 per data set, 0-1, negative direction, 0-3, positive direction).

For the negative direction and the proximal promoter, ARRR2 (Rashotte2) produced only one. And, the random datasets have an average of (1 per data set, 0-4).

The positive direction, ARRR2 (Rashotte2) has six. The random datasets have about 1 per dataset (0-3).

The distal promoters, negative direction, ARRR2 (Rashotte2) has 37 and the positive direction 25. The random datasets cover 8-20.

Ethylene response factors

Two ethylene response factors or ethylene responsive elements occur in the promoters of A1BG: positive strand, negative direction: ATTTCAAA at 1383 and negative strand, positive direction: ATTTCAAA at 2648. Both of these occur in the distal promoters on either side of A1BG. Sampling of ten random datasets looking for the ERE and its inverse complement found only one: ATTTCAAA at 934. Half way between ZSCAN22 and A1BG is about 2300 nucleotides and between ZNF497 and A1BG is about 2200. One is closer to ZSCAN22 and the other is closer to A1BG. The random occurrence is closer to the zinc finger than A1BG. The response element closer to A1BG is likely real even if inactive. As the real occurrences are more frequent and nearer mid points than the random result, it is likely that the EREs are not random but real and perhaps active.

Gibberellic acid response elements

Main article: GARE gene transcriptions

The TAACAAA box (GARE) has an inverse complement TTTGTTA at 230 nucleotides from ZSCAN22 toward A1BG. This is in the distal promoter for A1BG or is a response element for ZSCAN22 rather than A1BG. The GARE-like 1 TTAACA(A/G)A occurs as an inverse complement TTTGTTA at 230 nucleotides from the gene end of ZSCAN22 and may be a response element for ZSCAN22.

Random datasets have been sampled using TAAC(A/G)(A/G/T)A as a general form to test for GARE-like 2 (TAACGTA), GARE-like 1 (TAACA(A/G)A) and GARE (TAACAAA). Occurrences of TAACGGA, TAACGAA, and TAACATA have been listed but disallowed from analysis. The same has been done for the inverse complement T(A/C/T)(C/T)GTTA with disallowing TCCGTTA, TTCGTTA, and TATGTTA.

Half of the random datasets (10 for TAAC(A/G)(A/G/T)A) and (10 for T(A/C/T)(C/T)GTTA) produced no results. Individual occurrences of TAACAAA at 3592, TAACAAA at 1376, TAACAGA at 1059, TAACAAA at 961, or TAACGTA at 932 were recorded. For the inverse complements: TACGTTA at 3929, TCTGTTA at 3622, TACGTTA at 3228, TTTGTTA at 3209, TTTGTTA at 1168, TTTGTTA at 453 were recorded. One dataset produced three inverse complements: TACGTTA at 3929, TACGTTA at 3228, TTTGTTA at 1168. All occurrences were in the A1BG negative direction UTR or distal promoters in both directions. None were even close to the real occurrences. This suggests that the few real occurrences were not random.

Hypoxia response elements

Main article: Hypoxia response element gene transcriptions

A1BG has hypoxia response elements that are distal on both sides. The closest ones are in the UTR for A1BG on the positive strand in the negative direction: CACGC at 3280, GCGTG at 3046. Random datasets have almost identical results and core and proximal promoters not in the same datasets. Real sides of A1BG have many more elements in the distal promoters than the random datasets.

Pyrimidine boxes

Main article: Pyrimidine box gene transcriptions

TAT boxes

Main article: TAT box gene transcriptions

TATC boxes

Main article: TATC box gene transcriptions

General Regulatory Factors

"General regulatory factors (GRFs), such as Reb1, Abf1, Rap1, Mcm1, and Cbf1, positionally organize yeast chromatin through interactions with a core consensus DNA sequence."

"Ribosome biogenesis in Saccharomyces cerevisiae involves a regulon of >200 genes (Ribi genes) coordinately regulated in response to nutrient availability and cellular growth rate. Two cis-acting elements called PAC and RRPE are known to mediate Ribi gene repression in response to nutritional downshift. [Most] Ribi gene promoters also contain binding sites for one or more General Regulatory Factors (GRFs), most frequently Abf1 and Reb1, and that these factors are enriched in vivo at Ribi promoters. Abf1/Reb1/Tbf1 promoter association was required for full Ribi gene expression in rich medium and for its modulation in response to glucose starvation, characterized by a rapid drop followed by slow recovery. Such a response did not entail changes in Abf1 occupancy, but it was paralleled by a quick increase, followed by slow decrease, in Rpd3L histone deacetylase occupancy. [...] Abf1 site disruption also abolished Rpd3L complex recruitment in response to starvation. Extensive mutational analysis of the DBP7 promoter revealed a complex interplay of Tbf1 sites, PAC and RRPE in the transcriptional regulation of this Ribi gene. [...] GRFs [are] multifaceted players in Ribi gene regulation both during exponential growth and under repressive conditions."

Abf1 regulatory factors

Main article: Abf1 regulatory factor gene transcriptions

The general consensus sequence for Abf1 CGTNNNNN(A/G)(C/T)GA(C/T) occurs on both sides of A1BG but only in the distal promoters. Random datasets, even numbered assigned to the negative direction and odd numbered assigned to the positive direction yielded a sequence in the UTR, core promoter and distal promoter for the negative direction and a sequence in the distal promoter for the positive direction. The real consensus sequence yielded only three results: one in the negative direction and two in the positive, all in the distal promoters. The random sequences (four total) occurred in the UTR, proximal promoter and distal promoter for the negative direction and one in the distal promoter for the positive direction. While the differences between real and random are small (three vs. four), (all distal vs. UTR, proximal and two distal), they are likely significant as the random datasets (10) should have encompassed the real (2, each side of A1BG) but this did not occur.

Cbf1 regulatory factors

Main article: Cbf1 regulatory factor gene transcriptions

Consensus sequence TCACGTGA did not have any real or random results.

Mcm1 regulatory factors

Main article: Mcm1 regulatory factor gene transcriptions

Neither TT(A/T)CCNN(A/T)TNGG(A/T)AA nor TTNCCNNNTNNGGNAA produced any real or random results.

Rap1 regulatory factors

Main article: Rap1 regulatory factor gene transcriptions

When the Rap1 motif was held constant to ACCCRNRCA, no real results occurred. However, using the ten random datasets for testing ACCCRNRCA and its inverse complement yielded five consensus sequence results and four inverse complements. Two were in the UTR of A1BG from the negative direction. One was in the proximal promoter from the positive direction, and the remaining five were in the distal promoters.

The reduced consensus (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) had one result GAACCCACACCTC in the positive direction at 1807, less than half way from ZNF497. Of ten random datasets only one had a result: GCACCCGGGCATC at 1454. Also, for the inverse complement, there was only one TATGCCTGGGTTT at 1380. In both the real sequences and random sequences, each was in the distal promoter closer to the zinc finger than A1BG. The occurrence of one random result per ten datasets suggests that such a result is rarely random. While the real occurrence is likely active as a regulatory response.

The full consensus sequence C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T) gave four to six results in the UTR negative direction, one in the core promoter in the positive direction, two in the proximal promoter in the negative direction and one in the positive direction. In the distal promoter each direction had eight to nine results.

For the random data sets: UTR ranged from zero to four in the UTR, core promoter produced only zero to one, proximal promoter produced zero to one, and the distal promoter contained one to seven for either direction.

Comparing the two, the real UTR, proximal promoter, and distal promoter usually exceeded the random results. This suggests that some of the real results could just be due to random associations of nucleotides, but the rest are likely real.

Reb1 regulatory factors

Main article: Reb1 general regulatory factor gene transcriptions

Reb1 consensus sequences TTACCC(G/T) have three occurrences in A1BG: UTR at 3661 and two distal promoters at 3170 and 2912 in the positive direction all more than half way from either Zn finger.

Using the random datasets: there are three sequences in two datasets within the UTR: TTACCCG at 4135 and CGGGTAA at 3979, with AGGGTAA at 3112; the core promoters contained only TTACCCG at 4416 in the positive direction; the proximal promoters contained only TTACCCT at 4250 in the positive direction; and the distal promoters contained four to five sequences: five in the negative direction all more than half way to ZSCAN22 and four in the positive direction: one TTACCCG at 2965 more than halfway toward A1BG and the remaining three less than halfway.

The extended Reb1 consensus sequence ATTACCCGAA had no locations in either direction or in random datasets for either the extended consensus sequence or its inverse complement.

Tbf1 regulatory factors

Main article: Tbf1 regulatory factor gene transcriptions

The usual consensus sequence for Tbf1 ARCCCTAA occurs three times around A1BG: once in the negative direction within the UTR: the inverse complement TTAGGGTT at 3978 and twice in the positive direction: negative strand TTAGGGCT at 2768 and positive strand AACCCTAA at 2545. Both are closer to A1BG than either zinc finger.

In the random datasets, only the inverse complements occur in one data set: TTAGGGCT at 3616, TTAGGGTT at 198 representing the positive direction, distal promoter. The second is less than halfway from ZNF497.

Basic leucine zipper (bZIP) class response elements

"Most bZIP proteins show high binding affinity for the ACGT motifs, which include CACGTG (G box), GACGTC (C box), TACGTA (A box), AACGTT (T box), and a GCN4 motif, namely TGA(G/C)TCA (Landschulz et al., 1988; Nijhawan et al., 2008)."

"A majority of the plant bZIP proteins isolated to date recognize elements with an ACGT core (Foster et al., 1994)."

"Most recombinant bZIP proteins can interact with ACGT elements derived from different plant genes, albeit with different affinity. Systematic protein/DNA binding studies have shown that sequences flanking the ACGT core affect bZIP protein binding specificity. These studies have provided the basis for a concise ACGT nomenclature and defined high-affinity A-box, C-box, and G-box elements."

"HY5 binds to the promoter of light-responsive genes featuring "ACGT-containing elements" such as the G-box (CACGTG), C-box (GACGTC), Z-box (ATACGGT), and A-box (TACGTA) (4, 6)."

An ACGT element is its own inverse complement. Random datasets had 5 to 9 elements (ACGT) per dataset in the UTR negative direction toward A1BG. The real dataset had 8 in the UTR for the negative strand and one on the positive strand. This suggests that the negative strand, negative direction real occurrences could be random, but the occurrence of only one on the positive strand is likely real.

The real positive direction core promoter from ZNF497 toward A1BG has two ACGT strands. In the positive transcription direction three of five random datasets had 1 or 2 ACGT sequences. But, the real sequences are at or within 4445 nucleotides from ZNF497, whereas the three random datasets are between 4445 and 4560: at 4489, 4448, and 4478 with the transcription start site at 4300 nts. The real promoters on the positive direction were only tested to 4445 nts from ZNF497. So the random datasets kept to the same constraint as the real tests only produced one core promoter at 4401. This excess of real core promoters in the positive direction suggests they are real.

Regarding proximal promoters, only two exist both in the negative direction. The random datasets (3) had five proximal promoters in the negative direction for an average just over one each. One had three sequences suggesting that only two real sequences could be random.

For distal promoters in the negative direction there are 17 real sequences. The random datasets had between 3 and 11 ACGT sequences in the arbitrary negative direction. For the arbitrary positive direction there were between 9 and 15 sequences.

The positive direction had 44 sequences. Both sides of A1BG are not included in the random results suggesting they are real.

For total ACGT occurrences: negative direction between ZSCAN22 and A1BG is 28 and positive direction is 44, but the random datasets had between 9 and 20. The excessive occurrences of ACGT in both directions suggests they are real.

A-boxes

Main article: A box gene transcriptions

For box A (TGACTCT) there is a consensus sequence on either side of A1BG whereas the random datasets have only 0.3 on either side.

In the A1BG promoters, the consensus sequence TACGTA occurs in the negative direction UTR at 4246 nucleotides from ZSCAN22 and the positive direction distal promoter at 3071 nucleotides from ZNF497.

For the random datasets, it occurs only in the distal promoters at 398 or 2107 (two out of ten datasets) of the assigned negative direction and at 3126 or 3688 (two out of ten datasets) of the assigned positive direction.

The real promoters have twice as many consensus sequences relative to any random dataset with a result and the real promoters have them located in the UTR or distal promoter instead of just the distal promoter, which suggests they are real rather than random.

Activating transcription factors

Main article: Activating transcription factor gene transcriptions

The activating transcription factor (Burton) has the consensus sequence of (A/C/G)TT(A/G/T)C(A/G)TCA with one in the UTR in the negative direction and one in the negative direction in the distal promoter, whereas there are five consensus sequences in the positive direction.

The random datasets have one consensus sequence in each direction in the distal promoters.

The (Kilberg) consensus sequence (A/G/T)TT(A/G/T)CATCA is a special case of (A/C/G)TT(A/G/T)C(A/G)TCA of (Burton).

Affinity Capture-Western; Two-hybrid transcription factors

Main article: Aft1p gene transcriptions

The upstream activating sequence (UAS) for Aft1p is PyPuCACCCPu or (C/T)(A/G)CACCC(A/G).

In the UTR of A1BG in the negative direction there is only one occurrence on the positive strand, the inverse complement TGGGTGTG at 3185. Since a separate one does not occur on the negative strand the likelihood is only 0.5, although its complement does occur on the negative strand.

From the random datasets, there is no UTR occurrence from the arbitrarily chosen negative direction. If the other dataset had been picked, there would be an UTR occurrence, inverse complement TGGGTGTA at 4170. It would have the same likelihood of 0.5. The occurrence of the real TGGGTGTG at 3185 is likely random.

The only other real occurrences are in the distal promoter: negative direction - negative strand (1), positive strand (2), for a likelihood of 1.5 in the negative direction. If the occurrences in the UTR and the distal promoter in the negative direction are linked for transcription activation then both are likely active or activable.

The random datasets had three from ten in the arbitrarily chosen negative direction for 0.3.

The real positive direction had one TGCACCCG at 3324 from the negative strand only for 0.5. This has ACGT in the reverse direction.

The arbitrarily chosen positive direction had one complement inverse proximal promoter TGGGTGTA at 4170 from ten datasets for 0.1.

The random datasets have four from ten for 0.4. This is close enough to suggest that the real occurrence in the positive direction in likely random.

If the combination of a UTR and distal promoter occurrences can work together to promote transcription in the negative direction on the positive strand which is the strand of A1BG, then the occurrences are likely active or activable, whereas the occurrence in the positive direction may not be unless it can co-activate with other transcription factors.

C-boxes

Main article: C box gene transcriptions

C-boxes come in several varieties:

1. described by Johnson (GAGGCCATCT, none occur on either side of A1BG), none occurred for GAGGCCATCT in the random datasets or its inverse complement AGATGGCCTC,

C boxes (Samarsky)

1. described by Samarsky (AGTAGT, occur on both sides of A1BG), in the negative direction are five in the UTR versus two for the random datasets, neither have sequences in the core promoters, two occurred only in the random datasets in the proximal promoters, and one in each direction in the real distal promoters versus four in each direction in the random datasets,

C boxes (Voronina)

1. described by Voronina (GGTGATG, positive strand, negative direction at 3798). Only four random datasets yielded Voronina C boxes: three in the negative direction by arbitrary choice of evens including one an inverse complement in the UTR CATCACC at 3456. The rest are in the distal promoters where none occurred in the real promoters.

C boxes (Song)

1. described by Song (GACGTC, both sides of A1BG), For the C-box of Song, eight of the ten random datasets gave at least one result, one gave two sequences in the UTR vs. one in the UTR for the real promoters, none occurred in the core promoter vs. one for the positive direction in the core promoter, the real promoter in the positive direction had eight sequences vs. four in the negative and three in the positive for the randoms.

C boxes (Song hybrids)

1. hybrids described by Song (C/A-box TGACGTAT have none in either real promoter, C/G-box TGACGTGT positive direction at 3962, C/T-box TGACGTTA none). The random datasets have two sequences out of twenty, both inverse complements for the hybrid C/A box. For the C/G box hydrid, there was one random sequence in the negative direction in the distal promoter TGACGTGT at 915 whereas in the reals it was an inverse complement in the positive direction ACACGTCA at 3962. For the C/T box hybrids, there were two inverse complements in the distal promoter for the arbitrary negative direction: TAACGTCA at 2405 and TAACGTCA at 1638. The differences indicate the one real C/G box is likely real and active.

CAMP response elements

Main article: CRE box gene transcriptions

To pick a particular sequence of eight nucleotides where each of the four A,C,G,T are possible and the probability for any one is 0.25, then the probability for any specific eight is 1.5 x 10^-5. For some 4560 nucleotides, the probability for TGACGTCA is 0.070.

The real promoters have one on the negative strand, negative direction: TGACGTCA at 4317 in the UTR, where the occurrence is 0.5 for two strands. This suggests that TGACGTCA at 4317 is likely active or activable.

Gal4 transcription factors

Main article: Gal4p gene transcriptions

G-boxes

Main article: G box gene transcriptions

There are at least two G-boxes: that of Oeda (GCCACGTGGC, none found) and that of Loake (CACGTG, positive direction only: negative strand at 570 and positive strand at 3884, at 2961, at 1219, and at 547). The G-box of Loake is the same as the abscisic acid-responsive element. The random datasets have the even numbered sets arbitrarily assigned to the negative direction. Had they been assigned to the positive direction they additively appear similar to the Loake G-boxes found on the ZNF497 side promoter of A1BG. But, at most only two occur in any dataset. This suggests that those consensus sequences found in the positive direction are real and likely active.

Binding "activity to the G-box of the light-responsive unit 1 (U1) region of the parsley (Petroselinum crispum) CHS promoter (CHS-U1: TCCACGTGGC; Schulze-Lefert et al., 1989) or the G-box of GmAux28 (TCCACGTGTC) was much weaker than to the PA G-box [...]."

(G/T)CCACGTG(G/T)C combines the PA G-box (GCCACGTGGC) with the G-box of GmAux28 (TCCACGTGTC) for testing both. No examples of either the PA G-box or the G-box of GmAux28 were found in either promoter of A1BG. The random datasets had one occurrence on the designated negative direction TCCACGTGTC at 2907.

GCN4 motif

Main article: Gcn4p gene transcriptions

UAS Sequence for the transcription factor Gcn4p is ATGACTCTT.

"The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) [TGA(C/G/T)T(A/C/G)(A/T)] and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters."

"The predicted Gln3p and Gcn4p binding sites in the UGA3 promoter are [...] the consensus Gln3p (GATA) and Gcn4p (GCRE) [TGAGTCA] binding sites present in the minimal UGA3 promoter at -􏰉206 and -􏰉112, respectively, [...]."

For TGA(C/G/T)T(A/C/G)(A/T) there are three UTRs for each strand, one core promoter for each strand in the positive direction only, one proximal promoter in the negative direction and three in the positive direction, with five distal promoters on the negative direction and seventeen in the positive direction.

The random datasets have thirteen UTRs for ten datasets, three core promoters in the positive direction only for ten datasets, one proximal promoter in the negative direction for ten datasets and seven proximal promoters in the positive direction for ten datasets, and twenty-three distal promoters for ten datasets in the negative direction and twenty-three distal promoters in the positive direction for ten datasets.

Maf recognition elements

Main article: Maf recognition element gene transcriptions

Nuclear factors

Main article: Nuclear factor gene transcriptions

T boxes

"Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] AACGTT (T box) [...]."

Real promoter sequences on either side of A1BG only have this T box AACGTT at 2691 and 1614 in the positive direction.

X boxes

Main article: X box gene transcriptions

Z-boxes

Main article: Z box gene transcriptions

A more general Z-box consensus sequence A(C/T)A(C/G)GT(A/G)T, which includes CAGGTA and ATACGTGT, has two occurrences only in the positive direction from ZNF497 of ACAGGTGT at 1969 on the negative strand and ACACGTGT at 2962 on the positive strand.

Helix-turn-helix (HTH) transcription factors

Main article: Helix-turn-helix transcription factors

Gene ID: 4602 is MYB [myeloblastosis] MYB proto-oncogene, transcription factor on 6q23.3: "This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants."

CadC binding domains

Main article: CadC binding domain gene transcriptions

"Altogether, the specific contacts observed suggest a consensus binding motif of 5′-T-T-A-x-x-x-x-T-3′."

"The DNA consensus sequence 5′-T-T-A-x-x-x-x-T-3′ is present once in the quasi-palindromic Cad1 17-mer DNA, consistent with the formation of a 1:1 complex. However, a second consensus facilitates the formation of the 2:1 complex of CadC with Cad1 41-mer DNA as evidenced by the CadC model with the minimal Cad1 26-mer DNA that spans the two AT-rich regions, i.e. consensus sites."

The CadC binding domains occur in the UTR of A1BG between ZSCAN22 and A1BG, thirty-two on the negative strand, negative direction and three on the positive direction for a total occurrence of 17.5. The random datasets had occurrences of eight, six, thirteen, nine, nine, three, nine, ten, five, and six for a total of 78 for ten datasets yielding an average of 7.8 per strand or less than half that of the real strands in the negative direction. The over-random abundance of CadC DNA binding domains suggests they are likely active or activable.

No CadC DNA-binding domains occurred in the real core promoters. The random datasets had one the negative direction for an occurrence of 0.1 and fourteen in the positive direction for an occurrence of 1.4 suggesting that there should have been about one if random.

Proximal promoters have one in the negative direction for an occurrence of 0.5, and nine in the positive direction for an occurrence of 4.5. The random datasets had nine in the negative direction for 0.9 and eleven in the designated positive direction for 1.1. The wide disparity in both directions relative to the almost equal results for the random datasets suggests that the CadC DNA-binding domains are likely active or activable.

The distal promoters had thirty in the negative direction for an average of 15.0. The positive direction has fourteen for 7.0. The random datasets had 15, 8, 8, 13, 13, 13, 14, 11, 13, 11, for an average of 11.9 for the arbitrary negative direction. 20, 18, 23, 13, 13, 23, 14, 13, 20, 16, for an average of 17.3. A cumulative average of 14.6 ± 3 encompasses the real results in the negative direction but is way higher than the positive direction suggesting that the results for the positive direction between ZNF497 and A1BG are likely active or activable but the negative direction is likely random.

Factor II B recognition elements

"The best known core promoter element is the TATA-box, consisting of an AT-rich sequence located ~27 bp upstream of the TSS, but several other core promoter elements exist, including initiator element (Inr) and X core promoter element 1 (XCPE1) localized around the TSS, the TFIIB recognition elements (BRE) that are positioned upstream of the TSS, and downstream promoter element (DPE), motif ten element (MTE) and downstream core element (DCE) that are situated downstream of TSS. The distal regulatory elements include locus control regions (LCR), enhancers, silencers and insulators. The enhancers and silencers have sites for binding multiple transcription factors and they function in activating and repressing transcription, respectively. Insulators operate by blocking genes from being affected by the regulatory elements of neighbouring genes. The LCR consists of multiple transcription regulatory elements that function together to provide proper expression regulation to a cluster of genes." The consensus sequence for the TFIIB recognition elements (BRE^u) is (G/C)(G/C)(G/A)CGCC.

A1BG has one BRE^u in the UTR between ZSCAN22 on the positive strand in the negative direction GGCGTGG at 3047 that is an inverse complement for an occurrence of 0.5. The remaining BRE^us are in the distal promoters: seven in the negative direction and eleven in the positive direction for occurrences of 3.5 and 5.5, respectively.

The random datasets had different occurrences: thirteen in the UTR for 1.3, four in the core promoters for 0.2, four in the proximal promoters for 0.2, and thirteen in the negative direction for 1.3 with twenty-nine in the positive direction for 2.9. Based on the disparity, these response elements are likely active or activable.

MYB recognition elements

Main article: MYB recognition element gene transcriptions

"These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs)."

Basic helix-loop-helix (bHLH) transcription factors

Main article: Basic helix–loop–helix

"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."

"Pho4 bound to virtually all E-boxes in vitro (96%) [...]. That was not the case in vivo, where only 5% were bound by Pho4, under activating conditions as determined by ChIP-seq [Zhou and O'Shea 2011]."

"Pho4 possesses the intrinsic ability to bind every E-box, but in vivo is prevented from binding by chromatin unless assisted by chromatin remodelers (Svaren et al. 1994) that are targeted at promoter regions."

"On one end of that spectrum, typical transcription factors like Pho4 do not appear to compete with nucleosomes and instead predominantly sample motifs that already exist in the [nucleosome-free promoter regions] NFRs generated by other factors. In vitro (PB-exo), Pho4 bound nearly every instance of an E-box motif across the yeast genome. However, in vivo, Pho4 is a low-abundance protein that is recruited to the nucleus upon phosphate starvation by other factors, to act at a few dozen genes (Komeili and O'Shea 1999; Zhou and O'Shea 2011). Since Pho4 appears unable to compete with nucleosomes, competent sites that are occluded by nucleosomes are invisible to Pho4."

The Pho4 homodimer binds to DNA sequences containing the bHLH binding site CACGTG.

The upstream activating sequence (UAS) for Pho4p is CAC(A/G)T(T/G) in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].

bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG.

"A computer search for transcription promoter elements [...] showed the presence of a prominent TATA box 22 nucleotides upstream of the transcription start site and an Sp1 site at position -42 to -33. The 5'-flanking sequence also contains three E boxes with CANNTG consensus sequences at positions -464 to -459, -90 to -85, and -52 to -47 that have been marked as E box, E1 box, and E2 box, respectively [...]. In addition, the 5'-flanking region contains one or more GRE, XRE, GATA-1, GCN-4, PEA-3, AP1, and AP2 consensus motifs and also three imperfect CArG sites [...]."

Aryl hydrocarbon responsive DNA-binding consensus sequences

The TCDD*AhR DNA-binding consensus sequence is GCGTGNN(A/T)NNN(C/G).

These AhR DNA-binding consensus sequences occur only in the positive direction, eleven sequences all in the distal promoter: three on the negative strand and eight on the positive strand for an occurrence of 5.5. All of the real occurrences were closer to ZNF497 than to A1BG, suggesting promotion of ZNF497. For all four promoters the occurrence would be 2.75.

The random datasets had thirteen sequences in twenty strands for an occurrence of 0.65 per strand independent of direction. One sequence occurred in the arbitrarily chosen negative direction in the UTR out of ten for 0.1, likewise for the core promoter in the positive direction for 0.1. For the distal promoters there were six in the negative direction and five in the positive for occurrences of 0.6 and 0.5 or 0.55.

The unusual distribution of of AhRY elements suggests likely active or activable even if not for A1BG.

Aryl hydrocarbon responsive elements II

CATGN₆C(A/T)TG is the consensus sequence for AHRE-II.

Between ZSCAN22 and A1BG (negative direction) on the positive strand is the consensus sequence CATGGTGGCTCATG at 4116. For four strands (2) and directions (2) there is only only occurrence for 0.25. Using twenty random datasets (ten for the direct and ten for the complement inverse), no consensus sequence for AHRE-II was found for an occurrence of 0.0. This suggests that the one occurrence is not random but likely active or activable.

Antioxidant-electrophile responsive elements

Using the ARE Consensus GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A to look for more general AREs, many occur in the promoters of A1BG, where the putative ARE from Human, Chimp, Gorilla, Rhesus, Mouse, and Rat is TGCTGAGTCAT, inside the outer Ts.

The ARE Consensus (Lacher et al. 2018) occurs in the negative direction UTR (1.0,2.0) and all four distal promoters (1.0,3.0) and (1.0,1.0).

The random datasets had seventeen for ten datasets (1.7) in the UTR. In the distal promoters, the reals have six for four (1.5), whereas the randoms have twenty-three for forty (0.575). While it appears the UTR sequences could be random as they are encompassed by the randoms, the discrepancy between reals in the distal promoters and the randoms is significant, suggesting that overall the sequences are likely active or activable.

The predominant consensus sequence for Human, Chimp, Gorilla, Rhesus, Mouse, and Rat is TGCTGAGTCAT. This does not include the outside Ts, one at each end. The predominant consensus sequence does not occur in the promoters of A1BG.

CAT boxes

Main article: CAT box gene transcriptions

Dioxin-responsive elements

"The DRE consensus sequence, 5′-TNGCGTG-3′ is conserved throughout most species and occurs in multiples within the promoter of a target gene [1, 4]."

The dioxin response element occurs in the UTR between ZSCAN22 and A1BG on the positive strand, negative direction CACGCCA, the complement inverse, at 3282. It also occurs in the distal promoters, both in the negative direction and has three occurrences on the positive strand, positive direction for a total of eight occurrences in four strands for 2.0.

With the twenty random datasets, there are only eleven occurrences for 0.55, which suggests these DREs are likely active or activable. The random occurrences were also in the UTR (one) and distal promoters (10).

E-boxes

Consensus sequences: CACGTG.

In the real promoters, CACGTG does not occur in the UTR, core or proximal promoters, but there are five in the distal promoters for an occurrence of 1.25. The random datasets have two in the UTR for an occurrence of 0.4, none in the core or proximal promoters, and in the negative direction for an occurrence of 0.4 in the distal promoters and four in the positive direction for 0.8. This suggests that these enhanced boxes are likely active of activable.

Consensus sequences: CANNTG.

ATCTTG and TCCGCC are the two E-boxes in ChoRE motifs.

For the first enhancer box (ATCTTG) there is one sequence in the UTR for an occurrence of 0.5, two sequence in the proximal promoter: positive strand, positive direction for 0.5.

In the distal promoter there are two consensus sequences for 0.75.

The random sequences had five in the UTR for an occurrence of 2.5, none in the core or proximal promoters, and eleven in the negative direction for an occurrence of 1.1. In the arbitrary positive direction there were eleven for an occurrence of 1.1.

There is no apparent match between random datasets and the real promoters. The consensus sequences are likely active or activable.

The real occurrences of Carb E3 (TCCGCC) are in the UTR for 1.0, zero in the core promoters, proximal promoters have an occurrence of 0.5, the distal promoters have thirteen in the negative direction for an occurrence of 6.5 and five in the positive direction for an occurrence of 2.5.

The random datasets had two occurrences in the UTR for 0.2, one in the core promoters for 0.05, zero in the proximal promoters, and in the distal promoters 0.6 in the negative direction and 2.0 in the arbitrary positive direction, or an overall occurrence of 1.6.

Comparing the real occurrences of Carb E3 to the random occurrences indicates that the reals are likely active or activable.

GATAs

Main article: GATA gene transcriptions

Simple GATA responsive element consists of GATA.

"Upstream noncoding regulatory sequences were retrieved and analyzed using Regulatory Sequence Analysis Tools (34). The program DNA-Pattern was used to search for and catalogue occurrences of consensus GCRE (TGABTVW) and GATA (GATAAG, GATAAH, GATTA) motifs in yeast promoters."

Glucocorticoid response elements

Main article: Glucocorticoid response element gene transcriptions

"DNA-binding by the GR-DBD has been well-characterized; it is highly sequence-specific, directly recognizing invariant guanine nucleotides of two AGAACA [TGTTCT] half sites called the glucocorticoid response element (GRE), and binds as a dimer in head-to-head orientation with mid-nanomolar affinity (4,12–18). [...] The consensus DNA glucocorticoid response element (GRE) is comprised of two half-sites (AGAACA) separated by a three base-pair spacer (13,15,60,61)."

Pho4

Consensus sequences: CAC(A/G)T(T/G).

Quinone reductase response elements

The quinone reductase (QRDRE) gene contains TCCCCTTGCGTG which has the DRE core of TNGCGTG.

While the QRDRE may be just limited to TCCCC since it also has the fixed T after this sequence, TCCCCT has been used to examine the four possible promoters. The only elements are in the distal promoters in the positive direction, negative strand TCCCCT at 1073, and positive strand TCCCCT at 3665, TCCCCT at 2657, TCCCCT at 321, for a response of 1.0.

The random datasets had a far greater number of sequences. In the UTR between ZSCAN22 and A1BG were six consensus sequences, three direct and three complement inverses, for a response of 0.6. In the core promoters there were two in the chosen positive direction for a response of 0.2. The proximal promoters had three, two in the chosen negative direction and one in the positive direction for a response of 0.3. The distal promoters there were ten in the chosen negative direction for 1.0 and nineteen in the positive direction for 1.9.

While the responses for the UTR, core and proximal promoters were low but none were zero. None of the QRDREs are linked to the DREs. As the real occurrences were only in the distal promoters and the occurrences were in the 1.0 to 1.9 range it is likely that these QRDREs are random.

Xenobiotic response elements

Main article: Xenobiotic response element gene transcriptions

"The megalin (LRP2) gene promoter region [shows] eight consensus sequence of XRE 5′-GCGTG-3′."

A1BG is not included in any of the aryl hydrocarbon receptor (Gene ID: 196) pathways (19). As such the XRE is not expected in the promoters of A1BG.

The XRE is involved in the response of 78 human genes such as Gene ID: 1543 where the "Hypomethylation of the XRE -1383 site is associated with the upregulation of CYP1A1 in gastric adenocarcinoma." "Bisulfite sequencing and the resulting methylation percentages revealed dynamically methylated CpG sites located within or around xenobiotic response elements (XRE) 4–10, and a region of consistent hypermethylation located near proximal promoter, encompassing XRE2-3." For example using search concepts ("gastric adenocarcinoma" A1BG) on Google Scholar produced, "Immunohistochemical staining on a tissue microarray was then carried out for alpha-1B-glycoprotein (A1BG), leucine-rich alpha-2-glycoprotein (LRG1), ubiquitin carboxyl-terminal hydrolase 1 (USP1), and mucin-5B as candidate biomarkers. Their levels were significantly elevated in lung cancer tissue. A1BG levels were also determined as significantly elevated with Western blot on sera samples." Further, "Using sera as samples and multiple fractionation steps (protein depletion, lectin affinity fractionation, IEF separation, and LC-MS analysis), the following candidates were selected as breast cancer-associated proteins: thrombospondin-1 (TSP1) and 5 (TSP5), alpha-1B-glycoprotein (A1BG), serum amyloid P-component (SAP), and tenascin-X (TN-X) [106]. SAP and TSP5 were increased in breast cancer serum, A1BG showed a pI shift and a slight increase in total abundance in the cancer samples, TSP1 showed changes in glycan structure, and TN-X was both increased and showed glycan structure changes."

The xenobiotic response element (XRE) GCGTG occurs twice only on the positive strand in the UTR between ZSCAN22 and A1BG for an occurrence of (1.0), but does not occur in either core promoter or proximal promoter. For the distal promoters it occurs along with its complement inverse ten times between the two strands, negative (3) or positive (7), in the negative direction, and between the two strands negative (17) for 8.5 or positive (27) for 13.5 in the positive direction.

The random datasets contained seven XREs in each of ten UTRs for an occurrence of 0.7, twice in the core promoter in the arbitrarily chosen positive direction for an occurrence of 1.0, once in the proximal direction also in the positive direction for 0.5. In the distal promoters nineteen in the arbitrarily chosen negative direction for ten strands yielding 1.9 occurrences per strand and twenty-seven in the positive direction for ten strands yielding 2.7 occurrences per strand.

Although the occurrences are close for the UTRs (1.0 vs 0.7), the comparisons for the core promoters (0 vs 1.0) and proximal promoters (0 vs 0.5) are not close, and for the distal promoters (5.0 vs 1.9) in the negative direction and (13.5 vs 2.7) in the positive direction are also not close, suggesting that the occurrences of the XREs are likely active or activable rather than random occurrences.

Basic helix-loop-helix leucine zipper transcription factors

Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both Basic helix-loop-helix and leucine zipper motifs.

Examples include Microphthalmia-associated transcription factor and Sterol regulatory element-binding protein (SREBP).

MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes.

Serum response element gene transcriptions: The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.

"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)₆GG (CArG) motif."

CArG boxes

Consensus sequences: CC(A/T)₆GG.

C/EBP boxes

Consensus sequences: CCATAATAGG.

E boxes

Consensus sequences: CATCTG.

Consensus sequences: CAYRTG, CA(C/T)(A/G)TG.

M-boxes

Consensus sequences: TCAYRTG or CAYRTGA, TCA(C/T)(A/G)TG or CA(C/T)(A/G)TGA ~ (T/N)CA(C/T)(A/G)TG(A/N).

The M box consensus sequence GTCATGTGCT does not occur on either side of A1BG. The random datasets had only one occurrence GTCATGTGCT at 1977 in the distal promoter.

Using a more general M-box consensus of (T/N)CA(C/T)(A/G)TG(A/N) yielded four sequences in the negative direction and twelve in the positive direction. Of these only TCACATGA at 325 in the negative direction and TCACATGT at 3957, CCATGTGA at 3903, and CCACATGA at 3708 in the positive direction conform to TCAYRTG or CAYRTGA. The random datasets had 25 occurrences of the general consensus but only fifteen fit TCAYRTG or CAYRTGA, nine in the arbitrary negative direction and six in the positive direction. The disparity between real occurrences and random occurrences suggests that the real occurrences are likely active or can be activated.

The M-box with the consensus sequence TCACATGA occurred only once TCACATGA at 325 in the negative direction. There were no occurrences among the random datasets.

M-box consensus sequence is GGTCATGTGCT. This contains the core consensus sequence GTCATGTGCT.

SER elements

Consensus sequences: ACAGGATGT.

Basic helix-span-helix

Activating proteins

Main article: Activating protein gene transcriptions

The activating protein GCCTGGCC (Cohen) has eight occurrences on both sides of A1BG in its promoters: five from the negative direction from ZSCAN22 (two in the UTR and three in the distal promoter), and three from the positive direction in the distal promoter. But, sampling the random datasets (ten for GCCTGGCC and the same ten for the inverse complement GGCCAGGC found no occurrences. This indicates these sequences in the promoters of either side of A1BG are likely real and activable.

The second activating protein TCCCCCGCCC (Cohen) had only one occurrence that being in the positive direction toward A1BG from ZNF497 ending at 4440 nts inside A1BG gene downstream from the TSS at 4300 nts. But, sampling the random datasets (ten for TCCCCCGCCC and the same ten for the inverse complement GGGCGGGGGA found no occurrences. This indicates this sequence in the promoter of the ZNF497 side of A1BG is likely real and activable.

The activating protein TCTTCCC (Yao) has three occurrences around A1BG: two in the negative direction: TCTTCCC at 1657, GGGAAGA at 620 in the distal promoter, and one in the positive direction CCCTTCT at 4264 which is only one nts from being inside the core promoter and is likely a core promoter transcription factor.

Testing the random datasets with TCTTCCC (Yao) and its complement inverse GGGAAGA yielded three sequences in the negative direction: GGGAAGA at 4383, TCTTCCC at 3951, and TCTTCCC at 924, for ten datasets (0.3 per dataset), versus two real sequences. For the positive direction, the random datasets yielded four sequences: TCTTCCC at 1995, TCTTCCC at 1201, GGGAAGA at 1193, and GGGAAGA at 468, (0.4 per dataset) versus one real sequence.

In both instances, the sequences found in random datasets were much less common than in the real directions around A1BG.

The second activating protein consensus sequence CTCCCA and its inverse complement TGGGAG occur nine times in the UTR of A1BG, whereas four random datasets contain mostly one and once two such sequences. None of either occur in the core promoters. None occur in the proximal promoters in either real direction, but two occur (10 %) in the random datasets. In the distal promoters, nine to ten real sequences occur, whereas one to 1.4 occur per each random dataset. These results indicate that these sequences are likely real and activable.

"Pemphigus foliaceus (PF) is an autoimmune disease, endemic in Brazilian rural areas, characterized by acantholysis and accompanied by complement activation, with generalized or localized distribution of painful epidermal blisters. CD59 is an essential complement regulator, inhibiting formation of the membrane attack complex, and mediating signal transduction and activation of T lymphocytes. CD59 has different transcripts by alternative splicing, of which only two are widely expressed, suggesting the presence of regulatory sites in their noncoding regions. To date, there is no association study with polymorphisms in CD59 noncoding regions and susceptibility to autoimmune diseases. In this study, we aimed to evaluate if CD59 polymorphisms have a possible regulatory effect on gene expression and susceptibility to PF. Six noncoding polymorphisms were haplotyped in 157 patients and 215 controls by sequence-specific [polymerase chain reaction (PCR)] PCR, and CD59 mRNA levels were measured in 82 subjects, by qPCR. The rs861256-allele-G (rs861256*G) was associated with increased mRNA expression (p = .0113) and PF susceptibility in women (OR = 4.11, p = .0001), which were also more prone to develop generalized lesions (OR = 4.3, p = .009) and to resist disease remission (OR = 3.69, p = .045). Associations were also observed for rs831625*G (OR = 3.1, p = .007) and rs704697*A (OR = 3.4, p = .006) in Euro-Brazilian women, and for rs704701*C (OR = 2.33, p = .037) in Afro-Brazilians. These alleles constitute the GGCCAA haplotype, which also increases PF susceptibility (OR = 4.9, p = .045) and marks higher mRNA expression (p = .0025). [...] higher CD59 transcriptional levels may be related with PF susceptibility (especially in women), probably due to the effect of genetic polymorphism and to the CD59 role in T cell signal transduction."

The third activating protein consensus sequence GGCCAA can occur within the "optimal TCDD-AhR DNA-binding consensus sequence of GCGTGNNA/TNNNC/G [...]." or (C/G)NNN(A/T)NNGTGCG which yields two UTRs TTGGCC at 4099, TTGGCC at 3948 and six distal promoters (one in the negative direction) and five in the positive direction. The random datasets yielded usually one to two UTRs with an average of 0.4 per data set, two core promoters for an average of 0.1, two proximal promoters, and twenty-one distal promoters for 0.9 and 1.2 per direction, whereas the real nucleotides have no core promoters and six distal promoters (one in the negative direction and five in the positive direction).

Two activating protein response elements have been investigated: [G/C]CCN(3,4)GG[G/C] and GCCCACGGG. The second does not occur on either side of A1BG and also did not occur in the random datasets. The first one which is more general occurred in the core promoter (two) and proximal promoter (two) for the positive direction only. Both directions occurred in the distal promoters: negative direction (two) and positive direction (eighteen). In the random datasets: twenty-one consensus sequences occurred in the UTR for an average of 3.6 per dataset, three were core promoters in the arbitrarily chosen positive direction for 0.6 average, two proximal promoters (one negative, one positive direction) and the distal promoters had twenty-two in the negative direction and positive direction for an average of 4.4 in either direction. There was essentially no agreement between real and random consensus sequences. Therefore, the more general activating protein is likely or activable.

Stem-loops

File:Stem-loop.svg

An example of an RNA stem-loop is shown. Credit: Sakurambo.{{free media}}

As an important secondary structure of RNA, a stem-loop can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.

Hairpin loops are often elements found within the 5'UTR of prokaryotes. These structures are often bound by proteins or cause the attenuation of a transcript in order to regulate translation.

The mRNA stem-loop structure forming at the ribosome binding site may control an initiation of translation.

Adenylate–uridylate rich elements (Bakheet)

"The 3′UTRs were searched for the 13-bp pattern WWWUAUUUAUWW with mismatch=−1 which was computationally derived as previously described ( 2 ). The pattern was further statistically validated against larger sets of mRNA data (10 872 mRNA with 3′UTR; GenBank 119) showing occurrence of the motif in 6.8% of human mRNA." This consensus sequence when in a promoter would be WWWUAUUUAUWW=(A/T)(A/T)(A/T)TATTTAT(A/T)(A/T). This sequence occurred only twice in the promoters of A1BG both in the negative direction: negative strand, negative direction TTTTATTTATTA at 4076 and a complement inverse on the positive strand, negative direction AAATAAATAATA at 4077. Both are in the UTR of A1BG in the negative direction.

The twenty random datasets yielded a direct sequence AATTATTTATTT at 859 in the arbitrary positive direction and a complement inverse TAATAAATAAAA at 1499 in the arbitrary negative direction, both in the distal promoters. The real sequences are likely active or activable.

Adenylate–uridylate rich elements (Chen and Shyu, Class I)

"Class I AUUUA-containing AREs had 1-3 copies of scattered AUUUA motifs coupled with a nearby U-rich region or U stretch". This consensus sequence when in a promoter would be AUUUA=ATTTA. The real promoters have two sequences in the UTR of A1BG: negative strand, negative direction, ATTTA at 4073 and positive strand, negative direction, ATTTA at 4535; two sequences in the proximal promoters: negative strand, negative direction, ATTTA at 2636 and negative strand, positive direction, ATTTA at 4135; and two sequences in the distal promoters: negative strand, negative direction, ATTTA at 1698, and positive strand, positive direction, ATTTA at 3428.

The random datasets had very different results: of the five arbitrarily chosen negative direction datasets, three had eleven sequences in the UTR for a 2.2 average; the ten datasets had only one sequence in a core promoter ATTTA at 4287 for an average of 0.1;, the ten datasets had three sequences in the proximal promoters for an average of 0.3; and the ten datasets had forty-nine for an average of 4.9 per direction.

Adenylate–uridylate rich elements (Chen and Shyu, Class II)

Class "II AUUUA-containing AREs had at least two overlapping copies of the nonamer UUAUUUA(U/A)(U/A) in a U-rich region." UUAUUUA(U/A)(U/A) in the promoters would be TTATTTA(A/T)(A/T).

The real promoters have only one occurrence: in the UTR, negative strand, negative direction: TTATTTATT at 4075.

The twenty random datasets had four sequences all in the distal promoters for an average of 0.2. The one real occurrence is likely active or activable.

Adenylate–uridylate rich elements (Chen and Shyu, Class III)

"Subsequent studies based on analyses of a set of 4884 AUUUA-containing AREs led to a new classification based primarily on the number of overlapping AUUUA-repeats [8, 9, 10]."

Both the sequence ATTT and its inverse complement AAAT were searched on both sides of A1BG. An overlap would occur e.g. as follows ATTT occurs on the negative strand in the negative direction at 4514, i.e. ATTT ends at 4514, ATT ends at 4513, AT ends at 4512, and the A occurs at 4511. A first overlap would be ATTTATTT beginning at 4510, but the next ATTT ends at 4072. In order to overlap an occurrence near A1BG would need to end at -4 before the specific occurrence. For example, ATTT ends at 3014, but the further away ARE is ATTT at 3009, which is -5 rather than -4 so there is no overlapping repeat. For the negative strand in the negative direction there are no ATTTATTT overlapping repeats. For each of the direct sequences there are no overlapping repeats. However, for the inverse complements, there is an overlapping sequence positive strand, negative direction: AAAT at 4073 and AAAT at 4069, yielding AAATAAAT at 4073.

For the twenty random datasets, there are (1) AURIIIr5: ATTT at 859 and ATTT at 855 for ATTTATTT at 859, (2) AURIIIr6: ATTT at 1143 and ATTT at 1139 for ATTTATTT at 1143, and (3) AURIIIr7ci: AAAT at 3634 and AAAT at 3630 for AAATAAAT at 3634. This yields a probability of 0.15 for direct and inverse complement whereas the real promoters have one occurrence. The sequence AAATAAAT at 4073 in the UTR of A1BG (negative direction) is likely active or activable. The two that did occur in the random datasets were both in the arbitrary positive direction. Choosing the other datasets would put one in the UTR and the other in the distal promoter.

Adenylate–uridylate rich overlapping (Siegel) elements

"Cluster 1 and 2 motifs total 13 nucleotides, with AU-rich segments flanking one or two AUUUA core motifs, respectively. Clusters 3, 4 and 5 include 3, 4, or 5 exact AUUUA repeats respectively." "Naive Effective Length Pentamers: Pentamers classified by the “effective length” according to the formula floor((length(nt) + registration − 2)/4). “Registration” refers to the starting nucleotides of the ARE within the initial AUUUA pentamer: an ARE that starts AUUU*=0, UUUA*=1, UUAU*=2, and UAUU*=3. No mismatches allowed."

To find possible ATTT regions within the promoters an algorithm was written to look for sequences of "(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)(A/T)" so that an ATTTA can occur at least once for each of the first five nts. Only the negative strand, negative direction need be considered as the positive strand contains the complements. Possible ATTT regions with overlaps appear to exist such as "TTTATTATT at 4224" but continued examination shows that "TTTTATTAT at 4223" it is not. Another "ATTTATTAT at 4077" upon continuation shows "ATTTATTAT at 4077, TATTTATTA at 4076, TTATTTATT at 4075, TTTATTTAT at 4074, TTTTATTTA at 4073, TTTTTATTT at 4072" that an "ATTTA" is present but overlapping is unlikely. No other such "ATTTA" sequence wa found in either direction or side of A1BG.

In the random datasets an "ATTTAAAAA at 2395" was found in ARESr0, as was a complement "TAAATAAAA at 1499, ATAAATAAA at 1498, AATAAATAA at 1497, TAATAAATA at 1496, ATAATAAAT at 1495, AATAATAAA at 1494". Others were found "TTTTATTTA at 3611, ATTTTATTT at 3610" and "AATTTAATT at 1007, AAATTTAAT at 1006, AAAATTTAA at 1005" in ARESr1, "TAAATTTTT at 3953, ATAAATTTT at 3952, AATAAATTT at 3951, TAATAAATT at 3950, ATAATAAAT at 3949", "AAATTAATT at 1556, TAAATTAAT at 1555" and "TTAAATTTA at 1771" in ARESr2, "TAAATTTTA at 4196, TTAAATTTT at 4195, TTTAAATTT at 4194, TTTTAAATT at 4193, TTTTTAAAT at 4192" in ARESr3, "TATATTTAA at 3724, TTATATTTA at 3723" and "TTAATAAAT at 2444, TTTAATAAA at 2443" in ARESr4, "ATTATAAAT at 1564, AATTATAAA at 1563" and "AAATTTATT at 492" in ARESr5, "TAAATATAA at 2239, TTAAATATA at 2238, TTTAAATAT at 2237, TTTTAAATA at 2236, ATTTTAAAT at 2235, AATTTTAAA at 2234" and "ATTTATTTA at 1144, TATTTATTT at 1143, ATATTTATT at 1142, TATATTTAT at 1141", "TATTTATTA at 919" and "AATTATTTA at 187" in ARESr6, "TTAAAAATA at 3920, TTTAAAAAT at 3919, ATTTAAAAA at 3918, AATTTAAAA at 3917, TAATTTAAA at 3916" and "AAATAAATT at 3635, TAAATAAAT at 3634, ATAAATAAA at 3633, TATAAATAA at 3632" in ARESr7, "TTTTAAATA at 3609" in ARESr8, and "ATTATTTAA at 810, AATTATTTA at 809" in ARESr9; for an occurrence of nineteen possible overlaps in ten datasets for 1.9 per dataset compared with one for two or 0.5 for the real promoters which suggests that the occurrence is likely active or activable but insufficient when two or more are needed.

Constitutive decay elements

Constitutive "decay elements (CDEs) [4, 18][...] are conserved stem loop motifs that bind to the proteins Roquin and Roquin2, resulting in increased mRNA decay [18]. CDEs include an upper stem-loop sequence of the form UUCYRYGAA flanked by lower stem sequences. Lower stem sequences are formed by 2-5 nt pairs of reverse-complementary sequences (e.g. CCUUCYRYGAAGG has a lower stem length of 2)."

For transcription a CDE would occur as TTC(C/T)(A/G)(C/T)GAA for an upper stem-loop sequence. This would be expected to be flanked by lower stem sequences such as CC...GG. The only consensus sequence found on either side of A1BG is TTCCATGAA at 128 in the distal promoter in the positive direction from ZNF497 toward A1BG for an occurrence of 0.125 (1/8). On the two sides of this sequence are GA...CG up to AGAGA...CGGAA which are not the reverse (inverse)-complement of each other. This CDE does not have a CC...GG on the sides so appears to be incomplete or may be a random occurrence rather than a likely active or activable response element.

Of the ten random direct datasets, two consensus sequences occurred: CDEr8: TTCCATGAA at 1472 and CDEr9: TTCTATGAA at 2350. Likewise for the reverse-complements: CDEr4ci: TTCGCGGAA at 2553 and CDEr5ci: TTCGTGGAA at 633. The odd random datasets were arbitrarly chosen as the positive direction. Such a choice suggests a probability of 0.2 for a positive direction CDE. All random occurrences were in the distal promoters though two (TTCGCGGAA at 2553 and TTCTATGAA at 2350) were near the halfway points (2280 nts and 2222.5 nts) between the genes. These results suggest that the upper stem-loop CDE TTCCATGAA at 128 may be a random occurrence or likely active or activable possibly for ZNF497.

Cys
₂His
₂

The Cys
₂His
₂-like fold group (C2H2) is by far the best-characterized class of zinc fingers, and is common in mammalian transcription factors, where such domains adopt a simple ββα fold and have the amino acid sequence motif:

X₂-Cys-X_2,4-Cys-X₁₂-His-X_3,4,5-His

Alcohol dehydrogenase repressor 1

"Saccharomyces cerevisiae Alcohol dehydrogenase repressor 1 (Adr1p, YDR216W) is the transcription activator of the ADH2 gene (alcohol dehydrogenase 2) [1,2], which participates in the metabolic switch from glucose to ethanol or glycerol as food sources in yeast. Adr1p is involved in the activation of a number of genes of the respiratory metabolism, including those that regulate peroxisomes and phospholipid biosynthesis [3,4]." The upstream activating sequence (UAS) for Adr1p is TTGGGG or TTGG(A/G)G.

In the real promoters of A1BG, Adr1 occurs in the UTRs six times, Adr1 occurs in the core promoter in the positive direction TTGGGG at 4302. In the proximal promoters, it occurs once in the negative direction. The only other occurrences are in each direction in the distal promoters: negative direction (seventeen times) and positive direction (eleven times).

But in the random datasets, Adr1 occurs sixteen times for ten datasets or 1.6 times in the UTR, once for ten datasets in the negative direction for 0.1 and two of three less than or equal to 4445 for ten datasets (0.2) in the arbitrary positive direction in the core promoters, once in the negative direction for ten datasets (0.1) and twice in the positive direction for 0.2 in the proximal promoters, for the distal promoters ten datasets had twenty occurrences for 2.0 per dataset in the negative direction, and thirty-eight occurrences for ten datasets in the arbitrary positive direction for 3.8.

AP-2/EREBP-related factors

"cDNA clones have been identified representing 4 novel DNA-binding proteins, called ethylene-responsive element binding proteins (EREBPs), that specifically bind the ERE AGC box".

In the real promoters on either side of A1BG only one AGC box occurs on the positive strand, negative direction GGCGGCT at 1754 in the distal promoter. These four strands in two directions yielded only this consensus sequence for a rate of 0.25 per strand.

In the twenty random datasets there are ten sequences: three in the UTR (arbitrary negative direction), one on the core promoter (arbitrary positive direction), one in the proximal promoter (arbitrary positive direction), and five in the distal promoters, for a response rate of 0.5 per strand. The striking difference between the real promoters and the random promoters suggests that the limited response of the real promoters is likely active or activable. A1BG coding strand is on the positive strand, negative direction which adds some weight to the likelihood this AGC box is used.

AP-1 transcription factor network (Pathway)

Sixty-nine genes are included in the AP-1 transcription factor network (Pathway).

Angiotensinogen core promoter element 1

One of the AP-1 transcription factor network genes is Gene ID: 183 AGT Angiotensin II. The response element class for AGCE1 is not stated but likely bZIP although ACGT does not occur within the response element consensus sequence (A/C)T(C/T)GTG, "located between the TATA box and transcription initiation site (positions −25 to −1)". The three occurrences are ATCGTG, CTCGTG, and ATTGTG, but does not include CTTGTG.

The AGCE1 "acts as a critical regulator of AGT transcription".

The consensus sequence occurs in the UTR between ZSCAN22 and A1BG on both strands seven times. It occurs once in the core promoter between ZNF497 and A1BG on the negative strand in the positive direction. None occur in either proximal promoter. In the distal promoters, nine occur on the strands in the negative direction for 4.5, ten occur on both strands in the positive direction for 5.0.

Not including CTTGTG changes the results as the UTR has six occurrences on the strands for 3.0. In the distal promoters there is one occurrence of CTTGTG.

For the random datasets, ten occur per ten datasets in the UTR for an occurrence of 1.0 vs. 3.0 in the real promoter. In the core promoters, it occurs only once in the arbitrary positive direction CACAAG at 4525. As the number of nucleotides in the positive direction was limited to 4445 this occurrence is excluded. For the real promoters the occurrence is 0.25 for four strands in two directions vs. zero in the random datasets. If the arbitrary direction is reversed the occurrence would be 0.1 for ten datasets. No consensus sequences occur in either proximal promoter. For the distal promoters, there were ten in the negative direction for an occurrence of 1.0. For the arbitrary positive direction there were twenty-seven occurrences for ten datasets or 2.7.

With the exception of the proximal promoters at zero for all datasets and real promoters, the real occurrences were greater than the random occurrences suggesting that the promoter elements are likely active or activable.

Zinc finger DNA-binding domains

Androgen response elements (Kouhpayeh)

"Androgen response elements structurally consist of a short DNA motif with base sequence specificity within the promoter upstream of the androgen-responsive genes. The HRE contains a pair of conserved sequences, which are separated by a three-nucleotide spacer. This sequence is determined as 5'-GGTACAnnnTGTTCT-3'^{10, 11} with 5'-CGG-3' as the spacer in the androgen response element."

"ARE half sites, benefit from neighboring motifs or cooperating transcription factors in regulating gene expression."

The first half to consider is GGTACA and its inverse complement. Of the eight occurrences, only one is in the proximal promoter, negative strand, negative direction for an occurrence of 0.25, whereas the other seven are in the distal promoters: three in the negative direction, one of these on the positive strand and the other two on the negative strand for an occurrence of 1.5, the remaining four are on the positive strand in the positive direction for an occurrence of 2.0.

The random datasets had three out of ten occurrences in the arbitrary negative direction UTR for an occurrence of 0.3. The only occurrence in the core promoters was also in the positive direction for an occurrence of 0.1. The proximal promoters had two occurrences in opposite directions for 0.1. The distal promoters had four out of ten in the negative direction for 0.4, a 4 out of ten in the positive direction for 0.4.

The real occurrences do not compare well with the random datasets. The real occurrences are likely active or activable.

The second half TGTTCT and its complement inverse have five occurrences in the UTR between ZSCAN22 and A1BG, four on the negative strand (4.0) and one on the positive strand (1.0). One occurrence is in the proximal promoter between ZNF497 and A1BG on the negative strand (0.5). There are five distal promoter sequences, three in the negative direction, negative strand (1.0) and (2.0) and two in the positive direction (1.0).

The random data sets had only one in the UTR of ten for (0.1), one in the proximal promoters of twenty for (0.05). The distal promoters had five of ten for (0.5) in the arbitrary negative direction and seven of ten in the positive direction for (0.7).

Again there is no agreement between random sequences and real sequences suggesting that the real sequences are likely active or activable.

For the full AnRE (Kouhpayeh) there are no real sequences. With the random datasets there are none close enough to form the full AnRE.

Androgen response elements (Wilson)

The full fifteen nucleotide sequence AGAACANNNTGTTCT doesn't occur in any promoter for A1BG. While the TGTTCT portion was studied as part of "Androgen response elements (Kouhpayeh)" the other portion AGAACA which is the complement inverse of TGTTCT was looked at as part of "Androgen response element2 (Kouhpayeh)". The random occurrences were 0.1 for the one UTR, 0.1 for one of ten, and the distal promoters had two for each direction for 0.2 each. These are much lower than the real results suggesting that the reals are likely active or activable.

B box (Johnson)

TGGGCA is a B-box. It shows up in the UTR (occurrence of 3.0), proximal promoter (occurrence of 0.5), and distal promoter (occurrence of 3.0) of A1BG between ZSCAN22 and A1BG (negative direction). In the positive direction, proximal promoter (occurrence of 0.5) and distal promoter (occurrence of 3.0).

The random datasets had three for occurrence of 0.3 in the UTR, one for ten in the proximal promoter (occurrence of 0.1), but in the distal promoter (occurrence of 0.7, negative direction) or seventeen (occurrence of 7.0, positive direction).

Box B (Sanchez)

"The human [Transforming growth factor b1] TGFB1 promoter region contains two binding sequences for [Activator protein-1] AP-1, designated AP-1 box A (TGACTCT) and box B (TGTCTCA), which mediate the upregulation of promoter activity via a PKC-dependent pathway after exposure of cells to a high-glucose environment (Refs 37, 38)."

The real promoters have two box Bs in the UTR (occurrence of 1.0), eight in the negative direction distal promoter (occurrence of 4.0) and three in the positive direction distal promoter (occurrence of 1.5).

The random datasets had one either in the UTR or proximal promoter (occurrence of 0.1) and one in the distal promoter (occurrence of 0.1) near either ZSCAN22 or ZNF497. The disparity in occurrences is large indicating that the box Bs are likely active or activable.

β-Scaffold factors

"Higher animals have [transcription factor] TF genes for the basic domain, the β-scaffold factor, and other new structures; however, their total proportion is less than 15% and most are [zinc (Zn)-coordinating factor] ZF and [Helix-Turn-Helix] HTH genes."

ATA boxes

In the real promoters for A1BG, nine consensus ATA boxes (direct and complement inverse) occur in the UTR between ZSCAN22 and A1BG for an occurrence of 4.5 (two strands in one direction). No consensus sequences occur in either core promoter, only one occurs in the four proximal promoters for two directions, occurrence 0.25. The distal promoters have only two consensus sequences for an occurrence of 0.5.

The random sequences (ten direct and ten complement inverses) had four sequences in the UTR for an occurrence of 0.4 (one of two directions). The core promoters had only two for 0.2, the proximal promoters had two for 0.2, and the distal promoters had eighteen and thirteen per direction for 1.8 and 1.3.

Comparing the two, the real sequences are far more common in the UTR and much less common further away from the transcription start sites suggesting that the real sequences are likely active or activable. Whether the ATA box is bound by transcription factors possessing a β-Scaffold is not yet known or the source not yet found.

Unknown response element types

Calcineurin-responsive transcription factors

The calcineurin-responsive transcription factors occur (1.5) in the UTR between ZSCAN22 and A1BG and at 2.5 in the distal promoters.

The random datasets had an occurrence of 0.4 in the UTR, 0.1 in the core promoters, and 0.2 in the negative direction distal promoters and 0.7 in the positive direction.

The disparity indicates that the CRTs are likely active or activable.

Carbohydrate response elements (Carb)

"The putative ChREBP binding sites ChoRE1 [contain the response element here denoted as Carb underlined] (CACGTGACCGGATCTTG, -324 to -308)".

The UTR between ZSCAN22 and A1BG has an occurrence of 3.5 response elements per strand and direction, the core promoters have an occurrence of 0.25. the proximal promoters have an occurrence of 0.5, and the distal promoters have an occurrence of 5.0 in the negative direction and 13.0 in the positive direction.

The random datasets had occurrences of 2.1 in the UTR, 0.3 for the core promoters, 0.4 for the proximal promoters, and 3.0 in the negative direction and 4.7 in the positive direction. Generally, the random datasets produced slightly higher results suggestive of likely active or activable.

Carbohydrate response elements (Carb1)

"The putative ChREBP binding sites [are] ChoRE1 (CACGTGACCGGATCTTG, -324 to -308) and ChoRE2 (TCCGCCCCCATCACGTG, -298 to - 282)". .

Carb1 (CCCAT) occurs in the UTR between A1BG and ZSCAN22 at 2.5, the proximal promoters at 1.0, and the distal promoters at 2.0 in the negative direction and 4.5 in the positive direction.

The random datasets had twenty-three for ten datasets or 2.3, in the core promoters for 0.2, proximal promoters for 0.35, and distal promoters: 31 for the arbitrary negative direction (3.1) and 55 for the arbitrary positive direction (5.5) at 4.3 for an average of both.

While the occurrences for real and random are close for the UTRs and distal promoters, with an error of about 0.2 suggests that most of the occurrences are random except in the proximal promoters. The real occurrences may be likely active or activable.

Cat8s

The upstream activating sequence (UAS) for Cat8p is 5'-CGGNBNVMHGGA-3', where N = A, C, G, T, B = C, G, T, V = A, C, G, M = A, C, and H = A, C, T; i.e. 5'-CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA-3'.

The real promoters have only two Cat8s: TCCGTGCCACCG at 2528 and TCCGTGCCACCG at 657, both inverse complements and on the negative strand in the negative direction in the distal promoter for an occurrence of 0.5.

The random datasets had response elements in the UTRs (0.1) and proximal promoters (0.1) as well as the distal promoters (0.25), specifically in the negative direction (0.2) and 0.3 in the positive direction.

Even though there are only two real Cat8 response elements in the distal promoter, they are likely active or activable.

ZSCAN22

Main article: ZSCAN22

1. Gene ID: 342945 is ZSCAN22 zinc finger and SCAN domain containing 22 on 19q13.43. ZSCAN22 is transcribed in the negative direction from LOC100887072.
2. Gene ID: 102465484 is MIR6806 microRNA 6806 on 19q13.43: "microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop." MIR6806 is transcribed in the negative direction from LOC105372480.

Of the some 111 gaps between genes on chromosome locus 19q13.43 as of 4 August 2020, gap number 88 is between ZSCAN22 and A1BG. But, there is no gap between ZNF497 and A1BG.

Promoters

The core promoter begins approximately -35 nts upstream from the transcription start site (TSS). For the numbered nucleotides between ZSCAN22 and A1BG the core promoter extends from 4425 nts up to 4460 nts (TSS). The proximal promoter extends from approximately -250 to the TSS or 4210 nts up to 4460 nts. The distal promoter begins at about 2460 nts and extends to about 4210 nts.

From the ZNF497 side the core promoter begins about 4265 nts up to 4300 nts, the proximal promoter from 4050 nts to 4265 nts, and the distal promoter from 2300 nts to 4050 nts.

Alpha-1-B glycoprotein

Main article: Alpha-1-B glycoprotein

Def. "a substance that induces an immune response, usually foreign" is called an antigen.

Def. any "substance that elicits [an] immune response" is called an immunogen.

An antigen "or immunogen is a molecule that sometimes stimulates an immune system response." But, "the immune system does not consist of only antibodies", instead it "encompasses all substances that can be recognized by the adaptive immune system."

Def. "a protein produced by B-lymphocytes that binds to [a specific antigen or] an antigen" is called an antibody.

Five different antibody isotypes are known in mammals, which perform different roles, and help direct the appropriate immune response for each different type of foreign object they encounter.

Although the general structure of all antibodies is very similar, a small region, known as the hypervariable region, at the tip of the protein is extremely variable, allowing millions of antibodies with slightly different tip structures to exist, where each of these variants can bind to a different target, known as an antigen.

Def. "any of the glycoproteins in blood serum that respond to invasion by foreign antigens and that protect the host by removing pathogens;" "an antibody" is called an immunoglobulin.

Gene ID: 1 is A1BG alpha-1-B glycoprotein on 19q13.43, a 54.3 kDa protein in humans that is encoded by the A1BG gene. A1BG is transcribed in the positive direction from ZNF497. "The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins."

1. NP_570602.2 alpha-1B-glycoprotein precursor, cd05751 Location: 401 → 493 Ig1_LILRB1_like; First immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILR)B1 (also known as LIR-1) and similar proteins, smart00410 Location: 218 → 280 IG_like; Immunoglobulin like, pfam13895 Location: 210 → 301 Ig_2; Immunoglobulin domain and cl11960 Location: 28 → 110 Ig; Immunoglobulin domain.

Patients who have pancreatic ductal adenocarcinoma show an overexpression of A1BG in pancreatic juice.

Immunoglobulin supergene family

Main article: Immunoglobulin supergene family

"𝛂₁B-glycoprotein(𝛂₁B) [...] consists of a single polypeptide chain N-linked to four glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂₁B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂₁B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂₁B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."

"Some of the domains of 𝛂₁B show significant homology to variable (V) and constant (C) regions of certain immunoglobulins. Likewise, there is statistically significant homology between 𝛂₁B and the secretory component (SC) of human IgA (15) and also with the extracellular portion of the rabbit receptor for transepithelial transport of polymeric immunoglobulins (IgA and IgM). Mostov et al. (16) have called the later protein the poly-Ig receptor or poly-IgR and have shown that it is the precursor of SC."

The immunoglobulin supergene family is "the group of proteins that have immunoglobulin-like domains, including histocompatibility antigens, the T-cell antigen receptor, poly-IgR, and other proteins involved in the vertebrate immune response (17)."

"The internal homology in primary structure [...] and the presence of an intrasegment disulfide bond suggest that 𝛂₁B is composed of five structural domains that arose by duplication of a primordial gene coding for about 95 amino acid residues."

"Unlike immunoglobulins (25), ceruloplasmin (6), and hemopexin (7), 𝛂₁B is not subject to limited interdomain cleavage by proteolytic enzymes. At least, we were not able to produce such fragments by use of a variety of proteases. This stability of 𝛂₁B is probably associated with the frequency of proline in the sequences linking the domains [...]."

"A peptide identified in the late and early milk proteomes showed homology to eutherian alpha 1B glycoprotein (A1BG), a plasma protein with unknown function⁴⁶, as well as venom inhibitors characterised in the Southern opossum Didelphis marsupialis (DM43 and DM46^47,48,49), all members of the immunoglobulin superfamily. To characterise the relationship between the peptide sequence identified in koala, A1BG, DM43 and DM46, a phylogenetic tree was constructed [...] including all marsupial and monotreme homologs (identified by BLAST), three phylogenetically representative eutherian sequences, with human IGSF1 and TARM1, related members of the immunoglobulin super family, used as outgroups. This phylogeny indicates that A1BG-like proteins in marsupials and the Didelphis antitoxic proteins are homologs of eutherian A1BG, with excellent bootstrap support (98%). The marsupial A1BG-like sequences and the Didelphis antitoxic proteins formed a single clade with strong bootstrap support (97%)."

"Human TARM1 and IGSF1, related members of the immunoglobulin superfamily are used as outgroups. The tree was constructed using the maximum likelihood approach and the JTT model with bootstrap support values from 500 bootstrap tests. Bootstrap values less than 50% are not displayed. Accession numbers: Tasmanian devil (Sarcophilus harrisii; XP_012402143), Wallaby (Macropus eugenii; FY619507), Possum (Trichosurus vulpecula; DY596639) Virginia opossum (Didelphis virginiana; AAA30970, AAN06914), Southern opossum (Didelphis marsupialis; AAL82794, P82957, AAN64698), Human (Homo sapiens; P04217, B6A8C7, Q8N6C5), Platypus (Ornithorhychus anatinus; ENSOANP00000000762), Cow (Bos taurus; Q2KJF1), Alpaca (Vicugna pacos; XP_015107031)."

"The sequences of 𝛂₁B-glycoprotein (38) and chicken N-CAM (neural cell-adhesion molecule) (39) have been shown to be related to the immunoglobulin supergene family."

A1BG contains the immunoglobulin domain: cl11960 and three immunoglobulin-like domains: pfam13895, cd05751 and smart00410.

"Immunoglobulin (Ig) domain [cl11960] found in the Ig superfamily. The Ig superfamily is a heterogenous group of proteins, built on a common fold comprised of a sandwich of two beta sheets. Members of this group are components of immunoglobulin, neuroglia, cell surface glycoproteins, such as, T-cell receptors, CD2, CD4, CD8, and membrane glycoproteins, such as, butyrophilin and chondroitin sulfate proteoglycan core protein. A predominant feature of most Ig domains is a disulfide bridge connecting the two beta-sheets with a tryptophan residue packed against the disulfide bond."

"This domain [pfam13895] contains immunoglobulin-like domains."

"Ig1_LILR_KIR_like: [cd05751] domain similar to the first immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILRs) and Natural killer inhibitory receptors (KIRs). This group includes LILRB1 (or LIR-1), LILRA5 (or LIR9), an activating natural cytotoxicity receptor NKp46, the immune-type receptor glycoprotein VI (GPVI), and the IgA-specific receptor Fc-alphaRI (or CD89). LILRs are a family of immunoreceptors expressed on expressed on T and B cells, on monocytes, dendritic cells, and subgroups of natural killer (NK) cells. The human LILR family contains nine proteins (LILRA1-3,and 5, and LILRB1-5). From functional assays, and as the cytoplasmic domains of various LILRs, for example LILRB1 (LIR-1), LILRB2 (LIR-2), and LILRB3 (LIR-3) contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs) it is thought that LIR proteins are inhibitory receptors. Of the eight LIR family proteins, only LIR-1 (LILRB1), and LIR-2 (LILRB2), show detectable binding to class I MHC molecules; ligands for the other members have yet to be determined. The extracellular portions of the different LIR proteins contain different numbers of Ig-like domains for example, four in the case of LILRB1 (LIR-1), and LILRB2 (LIR-2), and two in the case of LILRB4 (LIR-5). The activating natural cytotoxicity receptor NKp46 is expressed in natural killer cells, and is organized as an extracellular portion having two Ig-like extracellular domains, a transmembrane domain, and a small cytoplasmic portion. GPVI, which also contains two Ig-like domains, participates in the processes of collagen-mediated platelet activation and arterial thrombus formation. Fc-alphaRI is expressed on monocytes, eosinophils, neutrophils and macrophages; it mediates IgA-induced immune effector responses such as phagocytosis, antibody-dependent cell-mediated cytotoxicity and respiratory burst."

"IG domains [smart00410] that cannot be classified into one of IGv1, IGc1, IGc2, IG." "𝛂₁B-glycoprotein(𝛂₁B) [...] consists of a single polypeptide chain N-linked to four glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂₁B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂₁B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂₁B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."

A1BG protein species

Def. a "group of plants or animals having similar appearance" or "the largest group of organisms in which [any] two individuals [of the appropriate sexes or mating types] can produce fertile offspring, typically by sexual reproduction" is called a species.

The gene contains 20 distinct introns. Transcription produces 15 different mRNAs, 10 alternatively spliced variants and 5 unspliced forms. There are 4 probable alternative promoters, 4 non overlapping alternative last exons and 7 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of 4 cassette exons, overlapping exons with different boundaries, splicing versus retention of 3 introns.

Variants or isoforms

Def. a "different sequence of a gene (locus)" is called a variant.

Def. any "of several different forms of the same protein, arising from either single nucleotide polymorphisms, differential splicing of mRNA, or post-translational modifications (e.g. sulfation, glycosylation, etc.)" is called an isoform.

Regarding additional isoforms, mention has been made of "new genetic variants of A1BG."

"Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein (A1BG) and its post-translationally modified isoforms."

Pharmacogenomic variants have been reported.

Genotypes

Def. the "part (DNA sequence) of the genetic makeup of an organism which determines a specific characteristic (phenotype) of that organism" or a "group of organisms having the same genetic constitution" is called a genotype.

There are A1BG genotypes.

A1BG has a genetic risk score of rs893184.

"A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10⁻⁵)."

Polymorphs

Def. the "regular existence of two or more different genotypes within a given species or population; also, variability of amino acid sequences within a gene's protein" is called polymorphism.

Def. "one of a number of alternative forms of the same gene occupying a given position, [or locus], on a chromosome" is called an allele.

"rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG."

"Genetic polymorphism of human plasma (serum) alpha 1B-glycoprotein (alpha 1B) was observed using one-dimensional horizontal polyacrylamide gel electrophoresis (PAGE) pH 9.0 of plasma samples followed by Western blotting with specific antiserum to alpha 1B."

A1B*5 is a "new allele [...] of human plasma 𝜶₁B-glycoprotein [...]."

"Genetic polymorphism of human plasma 𝜶₁B-glycoprotein (𝜶₁B) was reported first, in brief, by Altland et al. [1983; also given in Altkand and Hacklar, 1984]. A detailed description of human 𝜶₁B polymorphism was reported in subsequent studies [Gahne et al., 1987; Juneja et al., 1988, 1989]. Five different 𝜶₁B alleles (A1B*1, A1B*2, A1B*3, A1B*4 and A1B*5) were reported. In Caucasian whites, the frequencies of A1B*1 and ''A1B*2 were about 0.95 and 0.05, respectively. A1B*4 was observed in 2 related Czech individuals. In American blacks, A1B*1 and A1B*2 occurred with a frequency of 0.73 and 0.21, respectively, while a new allele, viz, A1B*3 had a frequency of 0.06. A1B*5 was observed only in Swedish Lapps and in Finns with a frequency of 0.04 and 0.007, respectively."

"The frequency of A1B*1 varied from 0.89 to 0.91 and that of A1B*2 from 0.08 to 0.10. The A1B*3 allele, reported previously only in American blacks, was observed with a frequency range of 0.003-0.01 in 3 of the Chinese populations, in Koreans and in Malays. A new 𝜶₁B allele (A1B*6) was observed in 2 Chinese individuals."

Phenotypes

Def. the "appearance of an organism based on a single trait [multifactorial combination of genetic traits and environmental factors], especially used in pedigrees" or any "observable characteristic of an organism, such as its morphological, developmental, biochemical or physiological properties, or its behavior" is called a phenotype.

"The three different phenotypes of α1B observed (designated 1-1, 1-2, and 2-2) were apparently identical to those reported by Altland et al. (1983), who used double one-dimensional electrophoresis. Family data supported the hypothesis that the three α1B phenotypes are determined by two codominant alleles at an autosomal locus, designated A1B. Allele frequencies in a Swedish population were: A1B *1, 0.937; A1B *2, 0.063; PIC, 0.111."

Protein species

"Both protein species of [alpha 1-beta glycoprotein] A1B (A1Ba, p = 0.008; f.c.= +1.62, A1Bb, p = 0.003; f.c. = +1.82) [...] were apparently overexpressed in patients with PTCa [...]."

A1BG is mainly produced in the liver, and is secreted to plasma to levels of approximately 0.22 mg/mL.

CRISPs

The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity." CRISP3 has a relatively high content in human plasma.

"The A1BG-CRISP-3 complex is noncovalent with a 1:1 stoichiometry and is held together by strong electrostatic forces." "Similar [complex formation] between toxins from snake venom and A1BG-like plasma proteins ... inhibits the toxic effect of snake venom metalloproteinases or myotoxins and protects the animal from envenomation."

Opossums have a remarkably robust immune system, and show partial or total immunity to the venom of rattlesnakes, Agkistrodon piscivorus, cottonmouths, and other Crotalinae, pit vipers.

"Crisp3 [is] mainly [expressed] in the salivary glands, pancreas, and prostate." "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."

ZNF497

Main article: ZNF497

Gene ID: 503538 is A1BG-AS1 A1BG antisense RNA 1. A1BG-AS1 is transcribed in the negative direction from ZSCAN22.

Gene ID: 162968 is ZNF497 zinc finger protein 497. ZNF497 is transcribed in the positive direction from RNA5SP473.

1. NP_001193938.1 zinc finger protein 497: "Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein."
2. NP_940860.2 zinc finger protein 497: "Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein."

Gene ID: 100419840 is LOC100419840 zinc finger protein 446 pseudogene. LOC100419840 may be transcribed in the positive direction from LOC105372483.

Gene ID: 105372483 is LOC105372483 uncharacterized LOC105372483 ncRNA. LOC105372483 is transcribed in the negative direction from LOC100419840.

Gene ID: 106479017 is RNA5SP473 RNA, 5S ribosomal pseudogene 473. RNA5SP473 may be transcribed in the negative direction from ZNF497.

GC contents

Approximately "76% of human core promoters lack TATA-like elements, have a high GC content, and are enriched in Sp1 binding sites."

CpG islands typically occur at or near the transcription start site of genes, particularly housekeeping genes, in vertebrates.

The number of CG or GC pairs near the TSS for A1BG appears to be low: between ZSCAN22 and A1BG are 8.2 % CG/GC and between ZNF497 and A1BG are 15 % CG/GC.

19q13.43

Main article: Genes on 19q13.43

Regulatory elements and regions

Main article: A1BG regulatory elements and regions

Functions of A1BG

"Receptors of the leukocyte receptor cluster (LRC) play a range of important functions in the human immune system."

"The leukocyte receptor cluster (LRC) is a family of structurally related genes for immunoregulatory receptors. Originally, the term LRC was introduced to emphasize the linkage of the genes encoding killer immunoglobulin-like receptors (KIRs), leukocyte Ig-like receptors (LILRs), and FcαR on human chromosome 19q13.4 (Wagtmann et al. 1997; Wende et al. 1999). Subsequently, it has been found that the region contains some other structurally related genes, such as NCR1, GPVI, LAIR1, LAIR2, and OSCAR (Meyaard et al. 1997; Sivori et al. 1997; Clemetson et al. 1999; Kim et al. 2002). Most recently, the LRC has been further extended by adding two more genes named VSTM1/SIRL1 and TARM1 (Steevels et al. 2010; Radjabova et al. 2015)."

"Except for LAIR2, which is a secreted protein, all human LRC products are type I cell surface receptors with extracellular regions composed of 1–4 C2-type Ig-like domains."

The "eutherian LRC family, in addition to commonly recognized members, includes two new, IGSF1 and alpha-1-B glycoprotein (A1BG)."

"Nucleotide sequences were retrieved and analyzed using utilities at the NCBI (https://www.ncbi.nlm.nih.gov/, last accessed May 20, 2019) and Ensemble (http://www.ensembl.org, last accessed May 20, 2019) websites."

"In our previous studies, it was observed that the Ig-like domains of the frog and chicken LRC proteins reproducibly showed homology not only to known LRC members but also to the products of four mammalian genes that to our knowledge have never been considered in the phylogenetic analyses of LRC. These genes are VSTM1, TARM1, A1BG, and IGSF1. VSTM1 and TARM1 are the most recently identified members of the human LRC (Steevels et al. 2010; Radjabova et al. 2015). A1BG encodes alpha-1 B glycoprotein, a soluble component of mammalian blood plasma that is known for half a century (Schultze et al. 1963). The protein is composed of five Ig-like domains and has been shown to bind to CRISP-3, a small polypeptide that is present in exocrine secretions of neutrophilic granulocytes and that is believed to play a role in innate immunity (Udby et al. 2004). In the human genome, A1BG maps to 19q13.4 some 3.3 Mb away from GPVI [...]."

"The attribution of IGSF1 and A1BG domains to the LRC was supported by their 3D structures predicted using homology modeling [...]."

"Noteworthy is that the D1 and D6 domains of IgSF1 fall into one clade with the N-terminal (d1) domains of A1BG and OSCAR (cluster B1). Closer relationship of A1BG and OSCAR was supported by clustering of the d2–d5 domains of A1BG with membrane-proximal (d2) domain of OSCAR (cluster B2)."

"Altogether, these results support the attribution of IGSF1 and A1BG to the LRC and suggest their relatedness to OSCAR, TARM1, and VSTM1."

"Clustering of the N-terminal domains of OSCAR, IGSF1, and A1BG with each other and with IGSF1 d6 was also reproduced. Finally, the d2 domains of OSCAR cluster with the d2–d5 domains of A1BG (fig. 5). These results further justify grouping IGSF1, A1BG, OSCAR, TARM1, and VSTM1 into a distinct group B."

Hypotheses

1. Downstream core promoters may work as transcription factors even as their complements or inverses.
2. In addition to the DNA binding sequences listed above, the transcription factors that can open up and attach through the local epigenome need to be known and specified.
3. Each DNA binding domain serving as a transcription factor for the promoter of any immunoglobulin supergene family member, also serves or is present in the promoters for A1BG.
4. The function of A1BG is the same as other immunoglobulin genes possessing the immunoglobulin domain cl11960 and/or any of three immunoglobulin-like domains: pfam13895, cd05751 and smart00410 in the order and nucleotide sequence: cd05751 Location: 401 → 493, smart00410 Location: 218 → 280, pfam13895 Location: 210 → 301 and cl11960 Location: 28 → 110.

See also

• A1BG gene transcription core promoters
• A1BG gene transcriptions
• A1BG regulatory elements and regions
• A1BG response element gene transcriptions
• A1BG response element negative results
• A1BG response element positive results
• Alpha-1-B glycoprotein
• Immunoglobulin domain cl11960
• Immunoglobulin like domain cd05751
• Immunoglobulin like domain pfam13895
• Immunoglobulin like domain smart00410
• Immunoglobulin supergene family
• Nuclear factor gene transcriptions
• SCAN domain

External links

• GenomeNet KEGG database
• Home - Gene - NCBI
• NCBI All Databases Search
• NCBI Site Search

{{Phosphate biochemistry}}