Complex locus A1BG and ZNF497: Difference between revisions

Latest revision as of 21:09, 16 May 2023

Associate Editor(s)-in-Chief: Henry A. Hoff

Alpha-1-B glycoprotein is a 54.3 kDa protein in humans that is encoded by the A1BG gene.^[1] The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins.

A1BG was located on the DNA strand of chromosome 19.^[2] Additionally, A1BG, in current nucleotide numbering (58,345,183-58,353,492), is located adjacent to the ZSCAN22 gene (58,326,994-58,342,332) on the positive DNA strand, as well as the ZNF837 (58,367,623 - 58,381,030, complement) and ZNF497 (58,354,357 - 58,362,751, complement) genes on the negative strand.^[2]

In the current nucleotide numbering, the A1BG untranslated region (UTR) has been expanded so that with ZSCAN22 ending at 58,342,332, the nucleotides used in this study are 58,342,333 to 58,346,892 on both strands, with the current UTR for A1BG beginning at 58,345,183. On the other side of A1BG ending at 58,353,492, the nucleotides used are 58,353,493 to 58,357,937. With ZNF497 beginning at 58,354,357, this study goes into ZNF497 to 58,357,937 or 3580 nucleotides from its downstream TSS or 4445 nucleotides from the TSS of A1BG downstream from ZNF497.

For example, an abscisic acid responsive element (ABRE) with the consensus sequence of ACGTG(G/T)C (Watanabe et al. 2017) occurs in the positive strand in the negative direction from ZSCAN22 to A1BG as ACGTGGC ending at 4239 nucleotides from the end of ZSCAN22 or 58,346,571, where the A is at 58,346,565 inside the UTR of A1BG.

Introduction

"Many important disease-related pathways utilize transcription factors that specifically bind DNA (e.g., c-Myc, HIF-1, TCF1, p53) as key nodes or endpoints in complex signaling networks. In such cases the transcription factor itself is often the most attractive target. However, drugging transcription factors is challenging owing to an absence of small ligand binding sites in their DNA-binding domain and the presence of a highly charged DNA-binding surface [1]."^[3]

If a specific gene appears to be involved in a disease-related or deleterious pathway being able to alter its expression so as to improve the person's health may be needed. To alter its expression constructively may require knowing what regulatory elements exist in the gene's nearby promoters.

Response elements

Identifying a bona fide response element is more difficult than a simple inspection. In order to attribute the response element to a candidate sequence, some observations have to be conducted using molecular, biological and biophysical methods and functional approaches. Findings may indicate that response element in the promoter is a functional element.^[4]

A likely response element found by simple inspection may also be inactive due to methylation.

Response Elements: "Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions."^[5]

"Under conditions of stress, a transcription activator protein binds to the response element and stimulates transcription. If the same response element sequence is located in the control regions of different genes, then these genes will be activated by the same stimuli, thus producing a coordinated response."^[6]

WD-40 repeat family

"Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During Phaseolus vulgaris root development, RACK1 (PvRACK1) mRNA expression was induced by auxins, abscisic acid, cytokinin, and gibberellic acid."^[7]

Abscisic acid (ABA) response elements

Auxin response factors

ARFUs

ARFBs

ARF2s

ARF5s

CAACTC regulatory elements

CAREs (Fan)

CAREs (Garaeva)

Cytokinins

ARR1s

ARR10s

ARR12s

ARRFs

ARRR1s

ARRR2s

Coupling elements

CE3Ws

CE3Ds

EREs

Gibberellic acid response elements

GAREs

GAREL1s

Hypoxia response elements

HIFs

HREs

CACAs

Pyrimidine boxes

TAT boxes

TATFs

TATYs

General Regulatory Factors

The following general regulatory factors occur in the promoters between ZSCAN22, A1BG and ZNF497 on human chromosome 19.

Abfms

Rap1s

Reb1s

Tbf1s

Basic leucine zipper (bZIP) class response elements

A-boxes

ACGTs

"A majority of the plant bZIP proteins isolated to date recognize elements with an ACGT core (Foster et al., 1994)."^[8]

"Most recombinant bZIP proteins can interact with ACGT elements derived from different plant genes, albeit with different affinity. Systematic protein/DNA binding studies have shown that sequences flanking the ACGT core affect bZIP protein binding specificity. These studies have provided the basis for a concise ACGT nomenclature and defined high-affinity A-box, C-box, and G-box elements."^[9]

"HY5 binds to the promoter of light-responsive genes featuring "ACGT-containing elements" such as the G-box (CACGTG), C-box (GACGTC), Z-box (ATACGGT), and A-box (TACGTA) (4, 6)."^[10]

Activating transcription factors

ATFBs

ATFKs

Affinity Capture-Western; Two-hybrid transcription factors

AFTs

Box As

C-boxes

C-boxes come in several varieties:

C-boxes (Johnson)

C boxes (Samarsky)

C boxes (Voronina)

C boxes (Song)

C boxes (Song hybrids)

Hybrids: C/A-box (TGACGTAT), C/G-box (TGACGTGT), C/T-box (TGACGTTA).

CAMPs

ESRE

The endoplasmic reticulum stress response element (ESRE) has two parts: (1) CCAAT and (2) CCACG which are tested separately then compared to see if any parts have any nine nucleotides between them.

CCAAT

CCACG

According to So (2018) the endoplasmic reticulum stress response element should be CCAAT-N9-CCACG. Samplings demonstrate that the ideal CCAAT-N9-CCACG or its complement inverse do not occur on either side of A1BG or close to ZSCAN22 or ZNF497.

Hap motif

G-boxes

G-box (CACGTG)

GCN4 motif

GCREs (Gcn4)

Migs

Nuclear factors

NFATs

HNF6s

T boxes

TboxCs

TboxZs

Vboxes

Z-boxes

ZboxGs

ZboxSps

Helix-turn-helix (HTH) transcription factors

Gene ID: 4602 is MYB [myeloblastosis] MYB proto-oncogene, transcription factor on 6q23.3: "This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants."^[11]

CadC binding domains

Factor II B recognition elements

Forkhead boxes

Homeoboxes

Homeodomains

HSE3 (Eastmond)

HSE4 (Eastmond)

HSE8 GAP1 (Eastmond)

HSE9 GAP2 (Eastmond)

Hsf (Tang)

MREs

Tryptophan residues

Basic helix-loop-helix (bHLH) transcription factors

"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."^[12]

"Pho4 bound to virtually all E-boxes in vitro (96%) [...]. That was not the case in vivo, where only 5% were bound by Pho4, under activating conditions as determined by ChIP-seq [Zhou and O'Shea 2011]."^[12]

"Pho4 possesses the intrinsic ability to bind every E-box, but in vivo is prevented from binding by chromatin unless assisted by chromatin remodelers (Svaren et al. 1994) that are targeted at promoter regions."^[12]

"On one end of that spectrum, typical transcription factors like Pho4 do not appear to compete with nucleosomes and instead predominantly sample motifs that already exist in the [nucleosome-free promoter regions] NFRs generated by other factors. In vitro (PB-exo), Pho4 bound nearly every instance of an E-box motif across the yeast genome. However, in vivo, Pho4 is a low-abundance protein that is recruited to the nucleus upon phosphate starvation by other factors, to act at a few dozen genes (Komeili and O'Shea 1999; Zhou and O'Shea 2011). Since Pho4 appears unable to compete with nucleosomes, competent sites that are occluded by nucleosomes are invisible to Pho4."^[12]

The Pho4 homodimer binds to DNA sequences containing the bHLH binding site CACGTG.^[13]

The upstream activating sequence (UAS) for Pho4p is CAC(A/G)T(T/G) in the promoters of HIS4 and PHO5 regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].^[14]

bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG.^[15]

"A computer search for transcription promoter elements [...] showed the presence of a prominent TATA box 22 nucleotides upstream of the transcription start site and an Sp1 site at position -42 to -33. The 5'-flanking sequence also contains three E boxes with CANNTG consensus sequences at positions -464 to -459, -90 to -85, and -52 to -47 that have been marked as E box, E1 box, and E2 box, respectively [...]. In addition, the 5'-flanking region contains one or more GRE, XRE, GATA-1, GCN-4, PEA-3, AP1, and AP2 consensus motifs and also three imperfect CArG sites [...]."^[16]

AhRYs

AHRE-IIs

AEREs

CAT boxes

CAT-box-like elements

"Class C"

"Class I"

TCFs

DIOXs

Enhancer boxes

ChoRE motifs

CarbE1s

CarbE2s

CarbE3s

Phors

Palindromic E-box motif (CACGTG).

E2 boxes

GATAs

Gln3s

Glucocorticoid response elements

ICRE (Lopes)

ICRE (Schwank)

Pho4

QRDREs

Carbon source-responsive elements

CATTCAs

TCCGs

XREs

Basic helix-loop-helix leucine zipper transcription factors

Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both Basic helix-loop-helix and leucine zipper motifs.

Examples include Microphthalmia-associated transcription factor and Sterol regulatory element-binding protein (SREBP).

MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes.^[17]

Serum response element gene transcriptions: The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.^[18]

"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)₆GG (CArG) motif."^[19]

CArG boxes

MITF E-boxes

RREs

Consensus sequence: CATCTG.

M-boxes

M box (Bertolotto)

M-box (Hoek)

M-box (Ripoll)

SER elements

Basic helix-span-helix

Activating proteins

AP2as

APCo1s

APCo2s

APM3Ns

APM4Ns

Yao1s

Yao2s

Yau3s

"Pemphigus foliaceus (PF) is an autoimmune disease, endemic in Brazilian rural areas, characterized by acantholysis and accompanied by complement activation, with generalized or localized distribution of painful epidermal blisters. CD59 is an essential complement regulator, inhibiting formation of the membrane attack complex, and mediating signal transduction and activation of T lymphocytes. CD59 has different transcripts by alternative splicing, of which only two are widely expressed, suggesting the presence of regulatory sites in their noncoding regions. To date, there is no association study with polymorphisms in CD59 noncoding regions and susceptibility to autoimmune diseases. In this study, we aimed to evaluate if CD59 polymorphisms have a possible regulatory effect on gene expression and susceptibility to PF. Six noncoding polymorphisms were haplotyped in 157 patients and 215 controls by sequence-specific PCR, and CD59 mRNA levels were measured in 82 subjects, by qPCR. The rs861256-allele-G (rs861256*G) was associated with increased mRNA expression (p = .0113) and PF susceptibility in women (OR = 4.11, p = .0001), which were also more prone to develop generalized lesions (OR = 4.3, p = .009) and to resist disease remission (OR = 3.69, p = .045). Associations were also observed for rs831625*G (OR = 3.1, p = .007) and rs704697*A (OR = 3.4, p = .006) in Euro-Brazilian women, and for rs704701*C (OR = 2.33, p = .037) in Afro-Brazilians. These alleles constitute the GGCCAA haplotype, which also increases PF susceptibility (OR = 4.9, p = .045) and marks higher mRNA expression (p = .0025). [...] higher CD59 transcriptional levels may be related with PF susceptibility (especially in women), probably due to the effect of genetic polymorphism and to the CD59 role in T cell signal transduction."^[20]

Stem-loops

File:Stem-loop.svg

An example of an RNA stem-loop is shown. Credit: Sakurambo.{{free media}}

As an important secondary structure of RNA, a stem-loop can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.^[21]

Hairpin loops are often elements found within the 5'UTR of prokaryotes. These structures are often bound by proteins or cause the attenuation of a transcript in order to regulate translation.^[22]

The mRNA stem-loop structure forming at the ribosome binding site may control an initiation of translation.^[23]^[24]

AUREs

Adenylate–uridylate rich elements (Chen and Shyu, Class I)

Adenylate–uridylate rich elements (Chen and Shyu, Class II)

Adenylate–uridylate rich elements (Chen and Shyu, Class III)

MERs

Constitutive decay elements

Cys
₂His
₂ SP / Kruppel-like factor (KLF) transcription factor family

The Cys
₂His
₂-like fold group (Cys
₂His
₂) is by far the best-characterized class of zinc fingers, and is common in mammalian transcription factors, where such domains adopt a simple ββα fold and have the amino acid sequence motif:^[25]

X₂-Cys-X_2,4-Cys-X₁₂-His-X_3,4,5-His

Alcohol dehydrogenase repressor 1

SP1M1s

SP1M2s

SP-1 (Sato)s

SP1 (Yao)s

YY1Ts

AP-2/EREBP-related factors

AGC boxes

AP-1 transcription factor network (Pathway)

Sixty-nine genes are included in the AP-1 transcription factor network (Pathway).^[26]

AGCEs

Zinc finger DNA-binding domains

AnRE1s

AnDRE2s

AnREWs

B-boxes

Box Bs

β-Scaffold factors

"Higher animals have [transcription factor] TF genes for the basic domain, the β-scaffold factor, and other new structures; however, their total proportion is less than 15% and most are [zinc (Zn)-coordinating factor] ZF and [Helix-Turn-Helix] HTH genes."^[27]

ATA boxes

Γ-interferon activated sequences

HMG boxes

Zn(II)₂Cys₆ proteins

"The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)₂Cys₆ proteins), and they recognize highly related sequences rich in GGC triplets [15]."^[28]

Dal81

GCC boxes

GGC triplets

GGCGGC triplets

Leu3

Uga3

Hairpin-hinge-hairpin-tail

"In addition to this ACA box, they have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity. Despite this lack of primary sequence conservation, the H and ACA boxes are embedded in an evolutionarily conserved hairpin-hinge-hairpin-tail core secondary structure with the H box in the single-stranded hinge region and the ACA box in the single-stranded tail (5, 16)."^[29]

H and ACA boxes

H-boxes (Grandbastien)

H-boxes (Lindsay)

H boxes (Mitchell)

H boxes (Rozhdestvensky)

Unknown response element types

ACEs

BBCABW Inrs

Calcineurin-responsive transcription factors

Carbs

Carb1s

Cat8s

Cell-cycle box variants

CGCG boxes

Circadian control elements

Cold-responsive elements

Copper response elements

CuREQs

CuREPs

Cytoplasmic polyadenylation elements

DAF-16 binding elements

D box (Samarsky)

D box (Voronina)

D-box (Motojima)

dBRE

Downstream core elements

DCE SI

DCE SII

DCE SIII

DPE (Juven-Gershon)

DPE (Kadonaga)

DPE (Matsumoto)

EIN3 binding sites

Endosperm expressions

Estrogen response elements

ERE1s

ERE2s

GAAC elements

GC boxes (Briggs)

GC boxes (Ye)

GC boxes (Zhang)

GCR1s

GREs

GT boxes (Sato)

Hex sequences

HY boxes

IFNs

Inr-like, TCTs

IRF3s

IRSs

KAR2s

MBE1s

MBE2s

MBE3s

NF𝜿BSs

PREs

Pribs

RAREs

Rgts

ROREs

SERVs

STAT5s

STREs

Sucroses

TACTs

TAGteams

TAPs

TATAs

Examining the promoter regions upstream from ZSCAN22 to A1BG and downstream from ZNF497 to A1BG for TATA boxes has shown that TATA boxes in various forms are present and likely active or activable: (1) TATAAAA (Carninci 2006), (2) TATA(A/T)A(A/T) (Watson 2014), (3) TATA(A/T)AA(A/G) (Juven-Gershon 2010), and (4) TATA(A/T)A(A/T)(A/G) (Basehoar 2004).

The TATA boxes have the pattern of appearing in only the negative direction UTRs, proximal and distals. The shorter TATA box: TATAAA does appear as above but also in the positive direction as the complement inverse TTTATA at 2588 in the distal promoter.

TATABs

TATACs

TATAJs

TATAWs

TEAs

TECs

THRs

TRFs

UPREs

UPRE-1s

URS (Sumrada, core)

VDREs

XCPE1s

Yaps

YYRNWYY Inrs

A1BG orthologs

Geotrypetes seraphini

File:Geotrypetes seraphini 81151944.jpg

Geotrypetes seraphini, the Gaboon caecilian, is a species of amphibian. Credit: Marius Burger.{{free media}}

Geotrypetes seraphini, the Gaboon caecilian, is a species of amphibian in the family Dermophiidae.^[30]

Its A1BG ortholog has 368 aa vs 495 aa for Homo sapiens.

ZSCAN22

Gene ID: 342945 is ZSCAN22 zinc finger and SCAN domain containing 22 on 19q13.43.^[31] ZSCAN22 is transcribed in the negative direction from LOC100887072.^[31]
Gene ID: 102465484 is MIR6806 microRNA 6806 on 19q13.43: "microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop."^[32] MIR6806 is transcribed in the negative direction from LOC105372480.^[32]

Of the some 111 gaps between genes on chromosome locus 19q13.43 as of 4 August 2020, gap number 88 is between ZSCAN22 and A1BG. But, there is no gap between ZNF497 and A1BG.

Promoters

The core promoter begins approximately -35 nts upstream from the transcription start site (TSS). For the numbered nucleotides between ZSCAN22 and A1BG the core promoter extends from 4425 nts up to 4460 nts (TSS). The proximal promoter extends from approximately -250 to the TSS or 4210 nts up to 4460 nts. The distal promoter begins at about 2460 nts and extends to about 4210 nts.

From the ZNF497 side the core promoter begins about 4265 nts up to 4300 nts, the proximal promoter from 4050 nts to 4265 nts, and the distal promoter from 2300 nts to 4050 nts.

Alpha-1-B glycoprotein

Def. "a substance that induces an immune response, usually foreign"^[33] is called an antigen.

Def. any "substance that elicits [an] immune response"^[34] is called an immunogen.

An antigen "or immunogen is a molecule that sometimes stimulates an immune system response."^[35] But, "the immune system does not consist of only antibodies",^[35] instead it "encompasses all substances that can be recognized by the adaptive immune system."^[35]

Def. "a protein produced by B-lymphocytes that binds to [a specific antigen or]^[36] an antigen"^[37] is called an antibody.

Five different antibody isotypes are known in mammals, which perform different roles, and help direct the appropriate immune response for each different type of foreign object they encounter.^[38]

Although the general structure of all antibodies is very similar, a small region, known as the hypervariable region, at the tip of the protein is extremely variable, allowing millions of antibodies with slightly different tip structures to exist, where each of these variants can bind to a different target, known as an antigen.^[39]

Def. "any of the glycoproteins in blood serum that respond to invasion by foreign antigens and that protect the host by removing pathogens;"^[40] "an antibody"^[41] is called an immunoglobulin.

Gene ID: 1 is A1BG alpha-1-B glycoprotein on 19q13.43, a 54.3 kDa protein in humans that is encoded by the A1BG gene.^[42] A1BG is transcribed in the positive direction from ZNF497.^[42] "The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins."^[42]

NP_570602.2 alpha-1B-glycoprotein precursor, cd05751 Location: 401 → 493 Ig1_LILRB1_like; First immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILR)B1 (also known as LIR-1) and similar proteins, smart00410 Location: 218 → 280 IG_like; Immunoglobulin like, pfam13895 Location: 210 → 301 Ig_2; Immunoglobulin domain and cl11960 Location: 28 → 110 Ig; Immunoglobulin domain.^[42]

Patients who have pancreatic ductal adenocarcinoma show an overexpression of A1BG in pancreatic juice.^[43]

Immunoglobulin supergene family

"𝛂₁B-glycoprotein(𝛂₁B) [...] consists of a single polypeptide chain N-linked to four glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂₁B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂₁B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂₁B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."^[44]

"Some of the domains of 𝛂₁B show significant homology to variable (V) and constant (C) regions of certain immunoglobulins. Likewise, there is statistically significant homology between 𝛂₁B and the secretory component (SC) of human IgA (15) and also with the extracellular portion of the rabbit receptor for transepithelial transport of polymeric immunoglobulins (IgA and IgM). Mostov et al. (16) have called the later protein the poly-Ig receptor or poly-IgR and have shown that it is the precursor of SC."^[44]

The immunoglobulin supergene family is "the group of proteins that have immunoglobulin-like domains, including histocompatibility antigens, the T-cell antigen receptor, poly-IgR, and other proteins involved in the vertebrate immune response (17)."^[44]

"The internal homology in primary structure [...] and the presence of an intrasegment disulfide bond suggest that 𝛂₁B is composed of five structural domains that arose by duplication of a primordial gene coding for about 95 amino acid residues."^[44]

"Unlike immunoglobulins (25), ceruloplasmin (6), and hemopexin (7), 𝛂₁B is not subject to limited interdomain cleavage by proteolytic enzymes. At least, we were not able to produce such fragments by use of a variety of proteases. This stability of 𝛂₁B is probably associated with the frequency of proline in the sequences linking the domains [...]."^[44]

"A peptide identified in the late and early milk proteomes showed homology to eutherian alpha 1B glycoprotein (A1BG), a plasma protein with unknown function⁴⁶, as well as venom inhibitors characterised in the Southern opossum Didelphis marsupialis (DM43 and DM46^47,48,49), all members of the immunoglobulin superfamily. To characterise the relationship between the peptide sequence identified in koala, A1BG, DM43 and DM46, a phylogenetic tree was constructed [...] including all marsupial and monotreme homologs (identified by BLAST), three phylogenetically representative eutherian sequences, with human IGSF1 and TARM1, related members of the immunoglobulin super family, used as outgroups. This phylogeny indicates that A1BG-like proteins in marsupials and the Didelphis antitoxic proteins are homologs of eutherian A1BG, with excellent bootstrap support (98%). The marsupial A1BG-like sequences and the Didelphis antitoxic proteins formed a single clade with strong bootstrap support (97%)."^[45]

"Human TARM1 and IGSF1, related members of the immunoglobulin superfamily are used as outgroups. The tree was constructed using the maximum likelihood approach and the JTT model with bootstrap support values from 500 bootstrap tests. Bootstrap values less than 50% are not displayed. Accession numbers: Tasmanian devil (Sarcophilus harrisii; XP_012402143), Wallaby (Macropus eugenii; FY619507), Possum (Trichosurus vulpecula; DY596639) Virginia opossum (Didelphis virginiana; AAA30970, AAN06914), Southern opossum (Didelphis marsupialis; AAL82794, P82957, AAN64698), Human (Homo sapiens; P04217, B6A8C7, Q8N6C5), Platypus (Ornithorhychus anatinus; ENSOANP00000000762), Cow (Bos taurus; Q2KJF1), Alpaca (Vicugna pacos; XP_015107031)."^[45]

"The sequences of 𝛂₁B-glycoprotein (38) and chicken N-CAM (neural cell-adhesion molecule) (39) have been shown to be related to the immunoglobulin supergene family."^[46]

A1BG contains the immunoglobulin domain: cl11960 and three immunoglobulin-like domains: pfam13895, cd05751 and smart00410.

"Immunoglobulin (Ig) domain [cl11960] found in the Ig superfamily. The Ig superfamily is a heterogenous group of proteins, built on a common fold comprised of a sandwich of two beta sheets. Members of this group are components of immunoglobulin, neuroglia, cell surface glycoproteins, such as, T-cell receptors, CD2, CD4, CD8, and membrane glycoproteins, such as, butyrophilin and chondroitin sulfate proteoglycan core protein. A predominant feature of most Ig domains is a disulfide bridge connecting the two beta-sheets with a tryptophan residue packed against the disulfide bond."^[47]

"This domain [pfam13895] contains immunoglobulin-like domains."^[48]

"Ig1_LILR_KIR_like: [cd05751] domain similar to the first immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILRs) and Natural killer inhibitory receptors (KIRs). This group includes LILRB1 (or LIR-1), LILRA5 (or LIR9), an activating natural cytotoxicity receptor NKp46, the immune-type receptor glycoprotein VI (GPVI), and the IgA-specific receptor Fc-alphaRI (or CD89). LILRs are a family of immunoreceptors expressed on expressed on T and B cells, on monocytes, dendritic cells, and subgroups of natural killer (NK) cells. The human LILR family contains nine proteins (LILRA1-3,and 5, and LILRB1-5). From functional assays, and as the cytoplasmic domains of various LILRs, for example LILRB1 (LIR-1), LILRB2 (LIR-2), and LILRB3 (LIR-3) contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs) it is thought that LIR proteins are inhibitory receptors. Of the eight LIR family proteins, only LIR-1 (LILRB1), and LIR-2 (LILRB2), show detectable binding to class I MHC molecules; ligands for the other members have yet to be determined. The extracellular portions of the different LIR proteins contain different numbers of Ig-like domains for example, four in the case of LILRB1 (LIR-1), and LILRB2 (LIR-2), and two in the case of LILRB4 (LIR-5). The activating natural cytotoxicity receptor NKp46 is expressed in natural killer cells, and is organized as an extracellular portion having two Ig-like extracellular domains, a transmembrane domain, and a small cytoplasmic portion. GPVI, which also contains two Ig-like domains, participates in the processes of collagen-mediated platelet activation and arterial thrombus formation. Fc-alphaRI is expressed on monocytes, eosinophils, neutrophils and macrophages; it mediates IgA-induced immune effector responses such as phagocytosis, antibody-dependent cell-mediated cytotoxicity and respiratory burst."^[49]

"IG domains [smart00410] that cannot be classified into one of IGv1, IGc1, IGc2, IG."^[50] "𝛂₁B-glycoprotein(𝛂₁B) [...] consists of a single polypeptide chain N-linked to four glucosamine oligosaccharides. The polypeptide has five intrachain disulfide bonds and contains 474 amino acid residues. [...] 𝛂₁B exhibits internal duplication and consists of five repeating structural domains, each containing about 95 amino acids and one disulfide bond. [...] several domains of 𝛂₁B, especially the third, show statistically significant homology to variable regions of certain immunoglobulin light and heavy chains. 𝛂₁B [...] exhibits sequence similarity to other members of the immunoglobulin supergene family such as the receptor for transepithelial transport of IgA and IgM and the secretory component of human IgA."^[44]

A1BG protein species

Def. a "group of plants or animals having similar appearance"^[51] or "the largest group of organisms in which [any]^[52] two individuals [of the appropriate sexes or mating types]^[52] can produce fertile offspring, typically by sexual reproduction"^[53] is called a species.

The gene contains 20 distinct introns.^[54] Transcription produces 15 different mRNAs, 10 alternatively spliced variants and 5 unspliced forms.^[54] There are 4 probable alternative promoters, 4 non overlapping alternative last exons and 7 validated alternative polyadenylation sites.^[54] The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of 4 cassette exons, overlapping exons with different boundaries, splicing versus retention of 3 introns.^[54]

Variants or isoforms

Def. a "different sequence of a gene (locus)"^[55] is called a variant.

Def. any "of several different forms of the same protein, arising from either single nucleotide polymorphisms,^[56] differential splicing of mRNA, or post-translational modifications (e.g. sulfation, glycosylation, etc.)"^[57] is called an isoform.

Regarding additional isoforms, mention has been made of "new genetic variants of A1BG."^[58]

"Proteomic analysis revealed that [a circulating] set of plasma proteins was α 1 B-glycoprotein (A1BG) and its post-translationally modified isoforms."^[59]

Pharmacogenomic variants have been reported.^[60]

Genotypes

Def. the "part (DNA sequence) of the genetic makeup of an organism which determines a specific characteristic (phenotype) of that organism"^[61] or a "group of organisms having the same genetic constitution" ^[62]is called a genotype.

There are A1BG genotypes.^[60]

A1BG has a genetic risk score of rs893184.^[60]

"A genetic risk score, including rs16982743, rs893184, and rs4525 in F5, was significantly associated with treatment-related adverse cardiovascular outcomes in whites and Hispanics from the INVEST study and in the Nordic Diltiazem study (meta-analysis interaction P=2.39×10⁻⁵)."^[60]

Polymorphs

Def. the "regular existence of two or more different genotypes within a given species or population; also, variability of amino acid sequences within a gene's protein"^[63] is called polymorphism.

Def. "one of a number of alternative forms of the same gene occupying a given position, [or locus],^[64] on a chromosome"^[65] is called an allele.

"rs893184 causes a histidine (His) to arginine (Arg) [nonsynonymous single nucleotide polymorphism (nsSNP), A (minor) for G (major)] substitution at amino acid position 52 in A1BG."^[60]

"Genetic polymorphism of human plasma (serum) alpha 1B-glycoprotein (alpha 1B) was observed using one-dimensional horizontal polyacrylamide gel electrophoresis (PAGE) pH 9.0 of plasma samples followed by Western blotting with specific antiserum to alpha 1B."^[66]

A1B*5 is a "new allele [...] of human plasma 𝜶₁B-glycoprotein [...]."^[67]

"Genetic polymorphism of human plasma 𝜶₁B-glycoprotein (𝜶₁B) was reported first, in brief, by Altland et al. [1983; also given in Altkand and Hacklar, 1984]. A detailed description of human 𝜶₁B polymorphism was reported in subsequent studies [Gahne et al., 1987; Juneja et al., 1988, 1989]. Five different 𝜶₁B alleles (A1B*1, A1B*2, A1B*3, A1B*4 and A1B*5) were reported. In Caucasian whites, the frequencies of A1B*1 and ''A1B*2 were about 0.95 and 0.05, respectively. A1B*4 was observed in 2 related Czech individuals. In American blacks, A1B*1 and A1B*2 occurred with a frequency of 0.73 and 0.21, respectively, while a new allele, viz, A1B*3 had a frequency of 0.06. A1B*5 was observed only in Swedish Lapps and in Finns with a frequency of 0.04 and 0.007, respectively."^[68]

"The frequency of A1B*1 varied from 0.89 to 0.91 and that of A1B*2 from 0.08 to 0.10. The A1B*3 allele, reported previously only in American blacks, was observed with a frequency range of 0.003-0.01 in 3 of the Chinese populations, in Koreans and in Malays. A new 𝜶₁B allele (A1B*6) was observed in 2 Chinese individuals."^[68]

Phenotypes

Def. the "appearance of an organism based on a single trait [multifactorial combination of genetic traits and environmental factors]^[69], especially used in pedigrees"^[70] or any "observable characteristic of an organism, such as its morphological, developmental, biochemical or physiological properties, or its behavior"^[71] is called a phenotype.

"The three different phenotypes of α1B observed (designated 1-1, 1-2, and 2-2) were apparently identical to those reported by Altland et al. (1983), who used double one-dimensional electrophoresis. Family data supported the hypothesis that the three α1B phenotypes are determined by two codominant alleles at an autosomal locus, designated A1B. Allele frequencies in a Swedish population were: A1B *1, 0.937; A1B *2, 0.063; PIC, 0.111."^[66]

Protein species

"Both protein species of [alpha 1-beta glycoprotein] A1B (A1Ba, p = 0.008; f.c.= +1.62, A1Bb, p = 0.003; f.c. = +1.82) [...] were apparently overexpressed in patients with PTCa [...]."^[72]

A1BG is mainly produced in the liver, and is secreted to plasma to levels of approximately 0.22 mg/mL.^[44]

CRISPs

The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity."^[73] CRISP3 has a relatively high content in human plasma.^[73]

"The A1BG-CRISP-3 complex is noncovalent with a 1:1 stoichiometry and is held together by strong electrostatic forces."^[73] "Similar [complex formation] between toxins from snake venom and A1BG-like plasma proteins ... inhibits the toxic effect of snake venom metalloproteinases or myotoxins and protects the animal from envenomation."^[73]

Opossums have a remarkably robust immune system, and show partial or total immunity to the venom of rattlesnakes, Agkistrodon piscivorus, cottonmouths, and other Crotalinae, pit vipers.^[74]^[75]

"Crisp3 [is] mainly [expressed] in the salivary glands, pancreas, and prostate."^[76] "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."^[76]

A1BG-AS1

Gene ID: 503538 is A1BG-AS1 A1BG antisense RNA 1.^[77] A1BG-AS1 is transcribed in the negative direction from ZSCAN22.^[77]

Gene ID 503538 extends from 58,351,390 to 58,355,183. It is a long, non-coding (lnc) RNA.^[78] Extensive evidence indicates that long noncoding RNAs (lncRNAs) regulate the tumorigenesis and progression of hepatocellular carcinoma (HCC).^[78]

The underexpression of A1BG-AS1 was found in HCC via analysis of The Cancer Genome Atlas database.^[78] A1BG-AS1 expression in HCC was markedly lower than that in noncancerous tissues.^[78]

ZNF497

Gene ID: 162968 is ZNF497 zinc finger protein 497.^[79] ZNF497 is transcribed in the positive direction from RNA5SP473.^[79]

NP_001193938.1 zinc finger protein 497: "Transcript Variant: This variant (2) lacks an alternate exon in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same protein."^[79]
NP_940860.2 zinc finger protein 497: "Transcript Variant: This variant (1) is the longer transcript. Variants 1 and 2 encode the same protein."^[79]

Gene ID: 100419840 is LOC100419840 zinc finger protein 446 pseudogene.^[80] LOC100419840 may be transcribed in the positive direction from LOC105372483.^[80]

Gene ID: 105372483 is LOC105372483 uncharacterized LOC105372483 ncRNA.^[81] LOC105372483 is transcribed in the negative direction from LOC100419840.^[81]

Gene ID: 106479017 is RNA5SP473 RNA, 5S ribosomal pseudogene 473.^[82] RNA5SP473 may be transcribed in the negative direction from ZNF497.^[82]

GC contents

Approximately "76% of human core promoters lack TATA-like elements, have a high GC content, and are enriched in Sp1 binding sites."^[83]

CpG islands typically occur at or near the transcription start site of genes, particularly housekeeping genes, in vertebrates.^[84]

The number of CG or GC pairs near the TSS for A1BG appears to be low: between ZSCAN22 and A1BG are 8.2 % CG/GC and between ZNF497 and A1BG are 15 % CG/GC.

19q13.43

Regulatory elements and regions

Functions of A1BG

"Receptors of the leukocyte receptor cluster (LRC) play a range of important functions in the human immune system."^[85]

"The leukocyte receptor cluster (LRC) is a family of structurally related genes for immunoregulatory receptors. Originally, the term LRC was introduced to emphasize the linkage of the genes encoding killer immunoglobulin-like receptors (KIRs), leukocyte Ig-like receptors (LILRs), and FcαR on human chromosome 19q13.4 (Wagtmann et al. 1997; Wende et al. 1999). Subsequently, it has been found that the region contains some other structurally related genes, such as NCR1, GPVI, LAIR1, LAIR2, and OSCAR (Meyaard et al. 1997; Sivori et al. 1997; Clemetson et al. 1999; Kim et al. 2002). Most recently, the LRC has been further extended by adding two more genes named VSTM1/SIRL1 and TARM1 (Steevels et al. 2010; Radjabova et al. 2015)."^[85]

"Except for LAIR2, which is a secreted protein, all human LRC products are type I cell surface receptors with extracellular regions composed of 1–4 C2-type Ig-like domains."^[85]

The "eutherian LRC family, in addition to commonly recognized members, includes two new, IGSF1 and alpha-1-B glycoprotein (A1BG)."^[85]

"Nucleotide sequences were retrieved and analyzed using utilities at the NCBI (https://www.ncbi.nlm.nih.gov/, last accessed May 20, 2019) and Ensemble (http://www.ensembl.org, last accessed May 20, 2019) websites."^[85]

"In our previous studies, it was observed that the Ig-like domains of the frog and chicken LRC proteins reproducibly showed homology not only to known LRC members but also to the products of four mammalian genes that to our knowledge have never been considered in the phylogenetic analyses of LRC. These genes are VSTM1, TARM1, A1BG, and IGSF1. VSTM1 and TARM1 are the most recently identified members of the human LRC (Steevels et al. 2010; Radjabova et al. 2015). A1BG encodes alpha-1 B glycoprotein, a soluble component of mammalian blood plasma that is known for half a century (Schultze et al. 1963). The protein is composed of five Ig-like domains and has been shown to bind to CRISP-3, a small polypeptide that is present in exocrine secretions of neutrophilic granulocytes and that is believed to play a role in innate immunity (Udby et al. 2004). In the human genome, A1BG maps to 19q13.4 some 3.3 Mb away from GPVI [...]."^[85]

"The attribution of IGSF1 and A1BG domains to the LRC was supported by their 3D structures predicted using homology modeling [...]."^[85]

"Noteworthy is that the D1 and D6 domains of IgSF1 fall into one clade with the N-terminal (d1) domains of A1BG and OSCAR (cluster B1). Closer relationship of A1BG and OSCAR was supported by clustering of the d2–d5 domains of A1BG with membrane-proximal (d2) domain of OSCAR (cluster B2)."^[85]

"Altogether, these results support the attribution of IGSF1 and A1BG to the LRC and suggest their relatedness to OSCAR, TARM1, and VSTM1."^[85]

"Clustering of the N-terminal domains of OSCAR, IGSF1, and A1BG with each other and with IGSF1 d6 was also reproduced. Finally, the d2 domains of OSCAR cluster with the d2–d5 domains of A1BG (fig. 5). These results further justify grouping IGSF1, A1BG, OSCAR, TARM1, and VSTM1 into a distinct group B."^[85]

Hypotheses

Downstream core promoters may work as transcription factors even as their complements or inverses.
In addition to the DNA binding sequences listed above, the transcription factors that can open up and attach through the local epigenome need to be known and specified.
Each DNA binding domain serving as a transcription factor for the promoter of any immunoglobulin supergene family member, also serves or is present in the promoters for A1BG.
The function of A1BG is the same as other immunoglobulin genes possessing the immunoglobulin domain cl11960 and/or any of three immunoglobulin-like domains: pfam13895, cd05751 and smart00410 in the order and nucleotide sequence: cd05751 Location: 401 → 493, smart00410 Location: 218 → 280, pfam13895 Location: 210 → 301 and cl11960 Location: 28 → 110.

References

↑ "Entrez Gene: Alpha-1-B glycoprotein". Retrieved 2012-11-09.
↑ ^2.0 ^2.1 "A1BG alpha-1-B glycoprotein". Retrieved May 10, 2013.
↑ Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
↑ Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang (July 2016). "Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region". Pediatric Research. 80 (1): 159–168. doi:10.1038/pr.2016.47. PMID 26991262. Retrieved 7 September 2020.
↑ U.S. National Library of Medicine (8 July 2008). "Response Elements MeSH Descriptor Data 2021". 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health. Retrieved 22 April 2021.
↑ Benjamin A. Pierce (24 December 2004). Control of Gene Expression, In: Genetics Solutions and Problem Solving MegaManual. Macmillan. p. 221. Retrieved 22 April 2021.
↑ Tania Islas-Flores, Gabriel Guillén, Xóchitl Alvarado-Affantranger, Miguel Lara-Flores, Federico Sánchez, and Marco A. Villanueva (2011). "PvRACK1 Loss-of-Function Impairs Cell Expansion and Morphogenesis in Phaseolus vulgaris L. Root Nodules". Molecular Plant-Microbe Interactions. 24 (7): 819–826. doi:10.1094/MPMI-11-10-0261. Retrieved 25 April 2021.
↑ Nijhawan A, Jain M, Tyagi AK, Khurana JP (February 2008). "Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice". Plant Physiology. 146 (2): 333–50. doi:10.1104/pp.107.112821. PMID 18065552.
↑ Randy Foster, Takeshi Izawa and Nam-Hai Chua (1 February 1994). "Plant bZIP proteins gather at ACGT elements". FASEB. 8 (2): 192–200. doi:10.1096/fasebj.8.2.8119490. PMID 8119490. Retrieved 25 June 2021.
↑ Ganesh M. Nawkar, Chang Ho Kanga, Punyakishore Maibam, Joung Hun Park, Young Jun Jung, Ho Byoung Chae, Yong Hun Chi, In Jung Jung, Woe Yeon Kim, Dae-Jin Yun, and Sang Yeol Lee (21 February 2017). "HY5, a positive regulator of light signaling, negatively controls the unfolded protein response in Arabidopsis" (PDF). Proceedings of the National Academy of Sciences USA. 114 (8): 2084–89. doi:10.1073/pnas.1609844114. Retrieved 24 June 2021.
↑ RefSeq (January 2016). "MYB MYB proto-oncogene, transcription factor [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 7 February 2021.
↑ ^12.0 ^12.1 ^12.2 ^12.3 Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
↑ Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman (1 February 1998). "A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p". Nucleic Acids Research. 26 (3): 710–4. doi:10.1093/nar/26.3.710. PMC 147311. PMID 9443961.
↑ Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.
↑ Chaudhary J, Skinner MK (1999). "Basic helix-loop-helix proteins can act at the E-box within the serum response element of the c-fos promoter to influence hormone-induced promoter activation in Sertoli cells". Mol. Endocrinol. 13 (5): 774–86. doi:10.1210/mend.13.5.0271. PMID 10319327.
↑ Nibedita Lenka, Aruna Basu, Jayati Mullick, and Narayan G. Avadhani (22 November 1996). "The role of an E box binding basic helix loop helix protein in the cardiac muscle-specific expression of the rat cytochrome oxidase subunit VIII gene" (PDF). The Journal of Biological Chemistry. 271 (47): 30281–30289. doi:10.1074/jbc.271.47.30281. Retrieved 7 February 2019.
↑ Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C, Einarsson SO, Valgeirsdottir S, Bergsteinsdottir K, Schepsky A, Dummer R, Steingrimsson E (2008). "Novel MITF targets identified using a two-step DNA microarray strategy". Pigment Cell Melanoma Res. 21 (6): 665–76. doi:10.1111/j.1755-148X.2008.00505.x. PMID 19067971.
↑ Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
↑ Xiaomin Zhang, Gohar Azhar, Jeanne Y. Wei (21 December 2017). "SIRT2 gene has a classic SRE element, is a downstream target of serum response factor and is likely activated during serum stimulation". PLOS One. 12 (12): e0190011. doi:10.1371/journal.pone.0190011. Retrieved 23 February 2021.
↑ Amanda Salviano-Silva, Maria Luiza Petzl-Erler & Angelica Beate Winter Boldt (29 April 2017). "CD59 polymorphisms are associated with gene expression and different sexual susceptibility to pemphigus foliaceus". Autoimmunity. 50 (6): 377–385. doi:10.1080/08916934.2017.1329830. Retrieved 27 September 2021.
↑ Svoboda, P., & Cara, A. (2006). Hairpin RNA: A secondary structure of primary importance. Cellular and Molecular Life Sciences, 63(7), 901-908.
↑ Meyer, Michelle; Deiorio-Haggar K; Anthony J (July 2013). "RNA structures regulating ribosomal protein biosynthesis in bacilli". RNA Biology. 7. 10: 1160–1164. doi:10.4161/rna.24151. PMID 23611891.
↑ Malys N, Nivinskas R (2009). "Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction". Mol Microbiol. 73 (6): 1115–1127. doi:10.1111/j.1365-2958.2009.06840.x. PMID 19708923.
↑ Malys N, McCarthy JEG (2010). "Translation initiation: variations in the mechanism can be anticipated". Cellular and Molecular Life Sciences. 68 (6): 991–1003. doi:10.1007/s00018-010-0588-z. PMID 21076851.
↑ Pabo CO, Peisach E, Grant RA (2001). "Design and selection of novel Cys2His2 zinc finger proteins". Annual Review of Biochemistry. 70: 313–40. doi:10.1146/annurev.biochem.70.1.313. PMID 11395410.
↑ NCBI (9 March 2021). "AP-1 transcription factor network". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 26 October 2021.
↑ Toshifumi Nagata, Aeni Hosaka-Sasaki and Shoshi Kikuchi (2016). Daniel H. Gonzalez, ed. The Evolutionary Diversification of Genes that Encode Transcription Factor Proteins in Plants, In: Plant Transcription Factors Evolutionary, Structural and Functional Aspects. Academic Press. pp. 73–97. doi:10.1016/B978-0-12-800854-6.00005-1. ISBN 978-0-12-800854-6. Retrieved 28 November 2021.
↑ Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti, Susana Correa-Garcia (1 November 2017). "Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor LEU3" (PDF). Microbiology. doi:10.1099/mic.0.000560. Retrieved 21 February 2021.
↑ James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins (January 1999). "A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End" (PDF). Molecular and Cellular Biology. 19 (1): 567–576. Retrieved 5 November 2018.
↑ IUCN SSC Amphibian Specialist Group (2019). "Geotrypetes seraphini". 2019: e.T59557A16957715. doi:10.2305/IUCN.UK.2019-1.RLTS.T59557A16957715.en. Retrieved 16 November 2021.
↑ ^31.0 ^31.1 HGNC (13 March 2020). "ZSCAN22 zinc finger and SCAN domain containing 22 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
↑ ^32.0 ^32.1 RefSeq (10 September 2009). "MIR6806 microRNA 6806 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
↑ Jag123 (7 March 2005). "antigen". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
↑ SemperBlotto (21 April 2008). "immunogen". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 8 March 2020.
↑ ^35.0 ^35.1 ^35.2 C. Michael Gibson (27 April 2008). "Antigen". Boston, Massachusetts: WikiDoc Foundation. Retrieved 8 March 2020.
↑ Williamsayers79 (26 February 2007). "antibody". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
↑ Jag123 (7 March 2005). "antibody". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
↑ Eleonora Market, F. Nina Papavasiliou (2003). "V(D)J Recombination and the Evolution of the Adaptive Immune System". PLoS Biology. 1 (1): e16. doi:10.1371/journal.pbio.0000016.
↑ Charles A Janeway, Jr, Paul Travers, Mark Walport, and Mark J Shlomchik (2001). Immunobiolog (5th ed. ed.). Garland Publishing. ISBN 0-8153-3642-X.
↑ SemperBlotto (25 February 2006). "immunoglobulin". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
↑ SemperBlotto (28 April 2008). "immunoglobulin". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.
↑ ^42.0 ^42.1 ^42.2 ^42.3 RefSeq (10 December 2019). "A1BG alpha-1-B glycoprotein [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
↑ Mei Tian, Ya-Zhou Cui, Guan-Hua Song, Mei-Juan Zong, Xiao-Yan Zhou, Yu Chen, Jin-Xiang Han (2008). "Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients". BMC Cancer. 8: 241. doi:10.1186/1471-2407-8-241. PMC 2528014. PMID 18706098.
↑ ^44.0 ^44.1 ^44.2 ^44.3 ^44.4 ^44.5 ^44.6 Noriaki Ishioka, Nobuhiro Takahashi, and Frank W. Putnam (April 1986). "Amino acid sequence of human plasma 𝛂₁B-glycoprotein: Homology to the immunoglobulin supergene family" (PDF). Proceedings of the National Academy of Sciences USA. 83 (8): 2363–7. doi:10.1073/pnas.83.8.2363. PMID 3458201. Retrieved 9 March 2020.
↑ ^45.0 ^45.1 Katrina M. Morris, Denis O’Meally, Thiri Zaw, Xiaomin Song, Amber Gillett, Mark P. Molloy, Adam Polkinghorne, and Katherine Belova (7 October 2016). "Characterisation of the immune compounds in koala milk using a combined transcriptomic and proteomic approach". Scientific Reports. 6: 35011. doi:10.1038/srep35011. PMID 27713568. Retrieved 14 March 2020.
↑ R. J. Paxton, G. Mooser, H. Pande, T. D. Lee, and J. E. Shively (1 February 1987). "Sequence analysis of carcinoembryonic antigen: identification of glycosylation sites and homology with the immunoglobulin supergene family" (PDF). Proceedings of the National Academy of Sciences USA. 84 (4): 920–924. doi:10.1073/pnas.84.4.920. PMID 3469650. Retrieved 26 March 2020.
↑ NCBI (2 February 2016). "Conserved Protein Domain Family cl11960: Ig Superfamily". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 22 May 2020.
↑ NCBI (5 August 2015). "Conserved Protein Domain Family pfam13895: Ig_2". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
↑ NCBI (16 August 2016). "Conserved Protein Domain Family cd05751: Ig1_LILR_KIR_like". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
↑ NCBI (16 January 2013). "Conserved Protein Domain Family smart00410: IG_like". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.
↑ 24.98.118.180 (28 February 2007). "species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ ^52.0 ^52.1 Peter coxhead (22 August 2018). "Species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ Chiswick Chap (1 December 2016). "Species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ ^54.0 ^54.1 ^54.2 ^54.3 "AceView: A1BG". Retrieved May 11, 2013.
↑ Pdeitiker (26 July 2008). "variant". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ SemperBlotto (6 January 2007). "isoform". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2 December 2018.
↑ 72.178.245.181 (30 November 2008). "isoform". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2 December 2018.
↑ H Eiberg, ML Bisgaard, J Mohr (1 December 1989). "Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG". Clinical genetics. 36 (6): 415–8. PMID 2591067. Retrieved 2017-10-08.
↑ John R. Stehle Jr., Mark E. Weeks, Kai Lin, Mark C. Willingham, Amy M. Hicks, John F. Timms, Zheng Cui (January 2007). "Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice". Biochimica et Biophysica Acta (BBA) - General Subjects. 1770 (1): 79–86. doi:10.1016/j.bbagen.2006.06.020. PMID 16945486. Retrieved 2017-10-08.
↑ ^60.0 ^60.1 ^60.2 ^60.3 ^60.4 Caitrin W. McDonough, Yan Gong, Sandosh Padmanabhan, Ben Burkley, Taimour Y. Langaee, Olle Melander, Carl J. Pepine, Anna F. Dominiczak, Rhonda M. Cooper-DeHoff, and Julie A. Johnson (June 2013). "Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes" (PDF). Hypertension. 62 (1): 48–54. doi:10.1161/HYPERTENSIONAHA.111.00823. PMID 23690342. Retrieved 2017-10-08.
↑ DTLHS (10 January 2018). "genotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ SemperBlotto (22 October 2005). "genotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ Widsith (28 March 2012). "polymorphism". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ 217.105.66.98 (8 September 2016). "allele". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ 138.130.33.215 (7 April 2004). "allele". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.
↑ ^66.0 ^66.1 B. Gahne, R. K. Juneja, and A. Stratil (June 1987). "Genetic polymorphism of human plasma alpha 1B-glycoprotein: phenotyping by immunoblotting or by a simple method of 2-D electrophoresis". Human Genetics. 76 (2): 111–5. doi:10.1007/bf00284904. PMID 3610142. Retrieved 25 March 2020.
↑ R.K. Juneja, G. Beckman, M. Lukka, B. Gahne, and C. Ehnholm (1989). "Plasma α₁B-Glycoprotein Allele Frequencies in Finns and Swedish Lapps: Evidence for a New α₁B Allele". Human Heredity. 39 (1): 32–36. doi:10.1159/000153828. PMID 2759622. Retrieved 25 March 2020.
↑ ^68.0 ^68.1 R.K. Juneja, N. Saha, B. Gahne and J.S.H. Tay (1989). "Distribution of Plasma Alpha-1-B-Glycoprotein Phenotypes in Several Mongoloid Populations of East Asia". Human Heredity. 39: 218–222. doi:10.1159/000153863. PMID 2583734. Retrieved 25 March 2020.
↑ 24.235.196.118 (23 September 2007). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.
↑ SemperBlotto (14 February 2005). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.
↑ N2e (3 July 2008). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.
↑ Mardiaty Iryani Abdullah, Ching Chin Lee, Sarni Mat Junit, Khoon Leong Ng, and Onn Haji Hashim (13 September 2016). "Tissue and serum samples of patients with papillary thyroid cancer with and without benign background demonstrate different altered expression of proteins". Peer J. 4: e2450. doi:10.7717/peerj.2450. PMID 27672505. Retrieved 15 March 2020.
↑ ^73.0 ^73.1 ^73.2 ^73.3 Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (12 October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460. Retrieved 2011-11-28.
↑ "The Opossum: Our Marvelous Marsupial, The Social Loner". Wildlife Rescue League.
↑ Journal Of Venomous Animals And Toxins – Anti-Lethal Factor From Opossum Serum Is A Potent Antidote For Animal, Plant And Bacterial Toxins. Retrieved 2009-12-29.
↑ ^76.0 ^76.1 B Haendler, J Krätzschmar, F Theuring and W D Schleuning (July 1993). "Transcripts for cysteine-rich secretory protein-1 (CRISP-1; DE/AEG) and the novel related CRISP-3 are expressed under androgen control in the mouse salivary gland". Endocrinology. 133 (1): 192–8. doi:10.1210/en.133.1.192. PMID 8319566. Retrieved 2012-02-20.
↑ ^77.0 ^77.1 HGNC (10 December 2019). "A1BG-AS1 A1BG antisense RNA 1 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
↑ ^78.0 ^78.1 ^78.2 ^78.3 Jigang Bai, Bowen Yao, Liang Wang, Liankang Sun, Tianxiang Chen, Runkun Liu, Guozhi Yin, Qiuran Xu, Wei Yang (June 2019). "lncRNA A1BG-AS1 suppresses proliferation and invasion of hepatocellular carcinoma cells by targeting miR-216a-5p". 120 (6): 10310–10322. doi:10.1002/jcb.28315. PMID 30556161. Retrieved 16 May 2023.
↑ ^79.0 ^79.1 ^79.2 ^79.3 HGNC (10 December 2019). "ZNF497 zinc finger protein 497 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
↑ ^80.0 ^80.1 HGNC (10 December 2019). "LOC100419840 zinc finger protein 446 pseudogene [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
↑ ^81.0 ^81.1 HGNC (10 December 2019). "LOC105372483 uncharacterized LOC105372483 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
↑ ^82.0 ^82.1 HGNC (10 December 2019). "RNA5SP473 RNA, 5S ribosomal pseudogene 473 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.
↑ Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (2007). "Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters". Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMID 17123746. Unknown parameter |month= ignored (help)
↑ Saxonov S, Berg P, Brutlag DL (2006). "A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters". Proc Natl Acad Sci USA. 103 (5): 1412–1417. doi:10.1073/pnas.0510310103. PMC 1345710. PMID 16432200.
↑ ^85.0 ^85.1 ^85.2 ^85.3 ^85.4 ^85.5 ^85.6 ^85.7 ^85.8 ^85.9 Sergey V Guselnikov and Alexander V Taranin (1 June 2019). "Unraveling the LRC Evolution in Mammals: IGSF1 and A1BG Provide the Keys". Genome Biology and Evolution. 11 (6): 1586–1601. doi:10.1093/gbe/evz102. PMID 31106814. |access-date= requires |url= (help)

External links

{{Phosphate biochemistry}}

[entrez-1] "Entrez Gene: Alpha-1-B glycoprotein". Retrieved 2012-11-09.

[A1BG-2] 2.0 ^2.1 "A1BG alpha-1-B glycoprotein". Retrieved May 10, 2013.

[Li2020-3] Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.

[Gu-4] Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang (July 2016). "Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region". Pediatric Research. 80 (1): 159–168. doi:10.1038/pr.2016.47. PMID 26991262. Retrieved 7 September 2020.

[MeSHNote99-5] U.S. National Library of Medicine (8 July 2008). "Response Elements MeSH Descriptor Data 2021". 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health. Retrieved 22 April 2021.

[Pierce-6] Benjamin A. Pierce (24 December 2004). Control of Gene Expression, In: Genetics Solutions and Problem Solving MegaManual. Macmillan. p. 221. Retrieved 22 April 2021.

[Flores-7] Tania Islas-Flores, Gabriel Guillén, Xóchitl Alvarado-Affantranger, Miguel Lara-Flores, Federico Sánchez, and Marco A. Villanueva (2011). "PvRACK1 Loss-of-Function Impairs Cell Expansion and Morphogenesis in Phaseolus vulgaris L. Root Nodules". Molecular Plant-Microbe Interactions. 24 (7): 819–826. doi:10.1094/MPMI-11-10-0261. Retrieved 25 April 2021.

[Nijhawan-8] Nijhawan A, Jain M, Tyagi AK, Khurana JP (February 2008). "Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice". Plant Physiology. 146 (2): 333–50. doi:10.1104/pp.107.112821. PMID 18065552.

[Foster-9] Randy Foster, Takeshi Izawa and Nam-Hai Chua (1 February 1994). "Plant bZIP proteins gather at ACGT elements". FASEB. 8 (2): 192–200. doi:10.1096/fasebj.8.2.8119490. PMID 8119490. Retrieved 25 June 2021.

[Nawkar-10] Ganesh M. Nawkar, Chang Ho Kanga, Punyakishore Maibam, Joung Hun Park, Young Jun Jung, Ho Byoung Chae, Yong Hun Chi, In Jung Jung, Woe Yeon Kim, Dae-Jin Yun, and Sang Yeol Lee (21 February 2017). "HY5, a positive regulator of light signaling, negatively controls the unfolded protein response in Arabidopsis" (PDF). Proceedings of the National Academy of Sciences USA. 114 (8): 2084–89. doi:10.1073/pnas.1609844114. Retrieved 24 June 2021.

[RefSeq4602-11] RefSeq (January 2016). "MYB MYB proto-oncogene, transcription factor [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 7 February 2021.

[Rossi-12] 12.0 ^12.1 ^12.2 ^12.3 Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.

[Shao-13] Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman (1 February 1998). "A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p". Nucleic Acids Research. 26 (3): 710–4. doi:10.1093/nar/26.3.710. PMC 147311. PMID 9443961.

[Tang-14] Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.

[pmid10319327-15] Chaudhary J, Skinner MK (1999). "Basic helix-loop-helix proteins can act at the E-box within the serum response element of the c-fos promoter to influence hormone-induced promoter activation in Sertoli cells". Mol. Endocrinol. 13 (5): 774–86. doi:10.1210/mend.13.5.0271. PMID 10319327.

[Lenka-16] Nibedita Lenka, Aruna Basu, Jayati Mullick, and Narayan G. Avadhani (22 November 1996). "The role of an E box binding basic helix loop helix protein in the cardiac muscle-specific expression of the rat cytochrome oxidase subunit VIII gene" (PDF). The Journal of Biological Chemistry. 271 (47): 30281–30289. doi:10.1074/jbc.271.47.30281. Retrieved 7 February 2019.

[Hoek-17] Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C, Einarsson SO, Valgeirsdottir S, Bergsteinsdottir K, Schepsky A, Dummer R, Steingrimsson E (2008). "Novel MITF targets identified using a two-step DNA microarray strategy". Pigment Cell Melanoma Res. 21 (6): 665–76. doi:10.1111/j.1755-148X.2008.00505.x. PMID 19067971.

[Misra-18] Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.

[Zhang2017-19] Xiaomin Zhang, Gohar Azhar, Jeanne Y. Wei (21 December 2017). "SIRT2 gene has a classic SRE element, is a downstream target of serum response factor and is likely activated during serum stimulation". PLOS One. 12 (12): e0190011. doi:10.1371/journal.pone.0190011. Retrieved 23 February 2021.

[Silva-20] Amanda Salviano-Silva, Maria Luiza Petzl-Erler & Angelica Beate Winter Boldt (29 April 2017). "CD59 polymorphisms are associated with gene expression and different sexual susceptibility to pemphigus foliaceus". Autoimmunity. 50 (6): 377–385. doi:10.1080/08916934.2017.1329830. Retrieved 27 September 2021.

[21] Svoboda, P., & Cara, A. (2006). Hairpin RNA: A secondary structure of primary importance. Cellular and Molecular Life Sciences, 63(7), 901-908.

[Meyer-22] Meyer, Michelle; Deiorio-Haggar K; Anthony J (July 2013). "RNA structures regulating ribosomal protein biosynthesis in bacilli". RNA Biology. 7. 10: 1160–1164. doi:10.4161/rna.24151. PMID 23611891.

[Malys2009-23] Malys N, Nivinskas R (2009). "Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction". Mol Microbiol. 73 (6): 1115–1127. doi:10.1111/j.1365-2958.2009.06840.x. PMID 19708923.

[Malys2010-24] Malys N, McCarthy JEG (2010). "Translation initiation: variations in the mechanism can be anticipated". Cellular and Molecular Life Sciences. 68 (6): 991–1003. doi:10.1007/s00018-010-0588-z. PMID 21076851.

[Pabo2001-25] Pabo CO, Peisach E, Grant RA (2001). "Design and selection of novel Cys2His2 zinc finger proteins". Annual Review of Biochemistry. 70: 313–40. doi:10.1146/annurev.biochem.70.1.313. PMID 11395410.

[AP-1TFN-26] NCBI (9 March 2021). "AP-1 transcription factor network". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 26 October 2021.

[Nagata-27] Toshifumi Nagata, Aeni Hosaka-Sasaki and Shoshi Kikuchi (2016). Daniel H. Gonzalez, ed. The Evolutionary Diversification of Genes that Encode Transcription Factor Proteins in Plants, In: Plant Transcription Factors Evolutionary, Structural and Functional Aspects. Academic Press. pp. 73–97. doi:10.1016/B978-0-12-800854-6.00005-1. ISBN 978-0-12-800854-6. Retrieved 28 November 2021.

[Ruiz-28] Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti, Susana Correa-Garcia (1 November 2017). "Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor LEU3" (PDF). Microbiology. doi:10.1099/mic.0.000560. Retrieved 21 February 2021.

[Mitchell-29] James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins (January 1999). "A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End" (PDF). Molecular and Cellular Biology. 19 (1): 567–576. Retrieved 5 November 2018.

[IUCN-30] IUCN SSC Amphibian Specialist Group (2019). "Geotrypetes seraphini". 2019: e.T59557A16957715. doi:10.2305/IUCN.UK.2019-1.RLTS.T59557A16957715.en. Retrieved 16 November 2021.

[HGNC342945-31] 31.0 ^31.1 HGNC (13 March 2020). "ZSCAN22 zinc finger and SCAN domain containing 22 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.

[RefSeq102465484-32] 32.0 ^32.1 RefSeq (10 September 2009). "MIR6806 microRNA 6806 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.

[AntigenWikt-33] Jag123 (7 March 2005). "antigen". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.

[ImmunogenWikt-34] SemperBlotto (21 April 2008). "immunogen". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 8 March 2020.

[AntigenWikidoc-35] 35.0 ^35.1 ^35.2 C. Michael Gibson (27 April 2008). "Antigen". Boston, Massachusetts: WikiDoc Foundation. Retrieved 8 March 2020.

[AntibodyWikt1-36] Williamsayers79 (26 February 2007). "antibody". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.

[AntibodyWikt-37] Jag123 (7 March 2005). "antibody". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.

[Market-38] Eleonora Market, F. Nina Papavasiliou (2003). "V(D)J Recombination and the Evolution of the Adaptive Immune System". PLoS Biology. 1 (1): e16. doi:10.1371/journal.pbio.0000016.

[Janeway5-39] Charles A Janeway, Jr, Paul Travers, Mark Walport, and Mark J Shlomchik (2001). Immunobiolog (5th ed. ed.). Garland Publishing. ISBN 0-8153-3642-X.

[ImmunoglobulinWikt-40] SemperBlotto (25 February 2006). "immunoglobulin". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.

[ImmunoglobulinWikt1-41] SemperBlotto (28 April 2008). "immunoglobulin". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 7 March 2020.

[RefSeq1-42] 42.0 ^42.1 ^42.2 ^42.3 RefSeq (10 December 2019). "A1BG alpha-1-B glycoprotein [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.

[Tian-43] Mei Tian, Ya-Zhou Cui, Guan-Hua Song, Mei-Juan Zong, Xiao-Yan Zhou, Yu Chen, Jin-Xiang Han (2008). "Proteomic analysis identifies MMP-9, DJ-1 and A1BG as overexpressed proteins in pancreatic juice from pancreatic ductal adenocarcinoma patients". BMC Cancer. 8: 241. doi:10.1186/1471-2407-8-241. PMC 2528014. PMID 18706098.

[Ishioka-44] 44.0 ^44.1 ^44.2 ^44.3 ^44.4 ^44.5 ^44.6 Noriaki Ishioka, Nobuhiro Takahashi, and Frank W. Putnam (April 1986). "Amino acid sequence of human plasma 𝛂₁B-glycoprotein: Homology to the immunoglobulin supergene family" (PDF). Proceedings of the National Academy of Sciences USA. 83 (8): 2363–7. doi:10.1073/pnas.83.8.2363. PMID 3458201. Retrieved 9 March 2020.

[Morris-45] 45.0 ^45.1 Katrina M. Morris, Denis O’Meally, Thiri Zaw, Xiaomin Song, Amber Gillett, Mark P. Molloy, Adam Polkinghorne, and Katherine Belova (7 October 2016). "Characterisation of the immune compounds in koala milk using a combined transcriptomic and proteomic approach". Scientific Reports. 6: 35011. doi:10.1038/srep35011. PMID 27713568. Retrieved 14 March 2020.

[Paxton-46] R. J. Paxton, G. Mooser, H. Pande, T. D. Lee, and J. E. Shively (1 February 1987). "Sequence analysis of carcinoembryonic antigen: identification of glycosylation sites and homology with the immunoglobulin supergene family" (PDF). Proceedings of the National Academy of Sciences USA. 84 (4): 920–924. doi:10.1073/pnas.84.4.920. PMID 3469650. Retrieved 26 March 2020.

[NCBI386229-47] NCBI (2 February 2016). "Conserved Protein Domain Family cl11960: Ig Superfamily". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 22 May 2020.

[NCBI372793-48] NCBI (5 August 2015). "Conserved Protein Domain Family pfam13895: Ig_2". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.

[NCBI319306-49] NCBI (16 August 2016). "Conserved Protein Domain Family cd05751: Ig1_LILR_KIR_like". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.

[NCBI214653-50] NCBI (16 January 2013). "Conserved Protein Domain Family smart00410: IG_like". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 24 May 2020.

[SpeciesWikt-51] 24.98.118.180 (28 February 2007). "species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[Species1-52] 52.0 ^52.1 Peter coxhead (22 August 2018). "Species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[Species-53] Chiswick Chap (1 December 2016). "Species". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[AceView-54] 54.0 ^54.1 ^54.2 ^54.3 "AceView: A1BG". Retrieved May 11, 2013.

[VariantWikt-55] Pdeitiker (26 July 2008). "variant". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[IsoformWikt1-56] SemperBlotto (6 January 2007). "isoform". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2 December 2018.

[IsoformWikt2-57] 72.178.245.181 (30 November 2008). "isoform". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2 December 2018.

[Eiberg-58] H Eiberg, ML Bisgaard, J Mohr (1 December 1989). "Linkage between alpha 1B-glycoprotein (A1BG) and Lutheran (LU) red blood group system: assignment to chromosome 19: new genetic variants of A1BG". Clinical genetics. 36 (6): 415–8. PMID 2591067. Retrieved 2017-10-08.

[Stehle-59] John R. Stehle Jr., Mark E. Weeks, Kai Lin, Mark C. Willingham, Amy M. Hicks, John F. Timms, Zheng Cui (January 2007). "Mass spectrometry identification of circulating alpha-1-B glycoprotein, increased in aged female C57BL/6 mice". Biochimica et Biophysica Acta (BBA) - General Subjects. 1770 (1): 79–86. doi:10.1016/j.bbagen.2006.06.020. PMID 16945486. Retrieved 2017-10-08.

[McDonough-60] 60.0 ^60.1 ^60.2 ^60.3 ^60.4 Caitrin W. McDonough, Yan Gong, Sandosh Padmanabhan, Ben Burkley, Taimour Y. Langaee, Olle Melander, Carl J. Pepine, Anna F. Dominiczak, Rhonda M. Cooper-DeHoff, and Julie A. Johnson (June 2013). "Pharmacogenomic Association of Nonsynonymous SNPs in SIGLEC12, A1BG, and the Selectin Region and Cardiovascular Outcomes" (PDF). Hypertension. 62 (1): 48–54. doi:10.1161/HYPERTENSIONAHA.111.00823. PMID 23690342. Retrieved 2017-10-08.

[GenotypeWikt1-61] DTLHS (10 January 2018). "genotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[GenotypeWikt-62] SemperBlotto (22 October 2005). "genotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[PolymorphismWikt-63] Widsith (28 March 2012). "polymorphism". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[AlleleWikt1-64] 217.105.66.98 (8 September 2016). "allele". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[AlleleWikt-65] 138.130.33.215 (7 April 2004). "allele". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 25 March 2020.

[Gahne-66] 66.0 ^66.1 B. Gahne, R. K. Juneja, and A. Stratil (June 1987). "Genetic polymorphism of human plasma alpha 1B-glycoprotein: phenotyping by immunoblotting or by a simple method of 2-D electrophoresis". Human Genetics. 76 (2): 111–5. doi:10.1007/bf00284904. PMID 3610142. Retrieved 25 March 2020.

[Juneja1989-67] R.K. Juneja, G. Beckman, M. Lukka, B. Gahne, and C. Ehnholm (1989). "Plasma α₁B-Glycoprotein Allele Frequencies in Finns and Swedish Lapps: Evidence for a New α₁B Allele". Human Heredity. 39 (1): 32–36. doi:10.1159/000153828. PMID 2759622. Retrieved 25 March 2020.

[Juneja-68] 68.0 ^68.1 R.K. Juneja, N. Saha, B. Gahne and J.S.H. Tay (1989). "Distribution of Plasma Alpha-1-B-Glycoprotein Phenotypes in Several Mongoloid Populations of East Asia". Human Heredity. 39: 218–222. doi:10.1159/000153863. PMID 2583734. Retrieved 25 March 2020.

[PhenotypeWikt2-69] 24.235.196.118 (23 September 2007). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.

[PhenotypeWikt1-70] SemperBlotto (14 February 2005). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.

[PhenotypeWikt-71] N2e (3 July 2008). "phenotype". San Francisco, California: Wikimedia Foundation, Inc. Retrieved 2016-10-04.

[Abdullah-72] Mardiaty Iryani Abdullah, Ching Chin Lee, Sarni Mat Junit, Khoon Leong Ng, and Onn Haji Hashim (13 September 2016). "Tissue and serum samples of patients with papillary thyroid cancer with and without benign background demonstrate different altered expression of proteins". Peer J. 4: e2450. doi:10.7717/peerj.2450. PMID 27672505. Retrieved 15 March 2020.

[Udby-73] 73.0 ^73.1 ^73.2 ^73.3 Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L. (12 October 2004). "Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma". Biochemistry. 43 (40): 12877–86. doi:10.1021/bi048823e. PMID 15461460. Retrieved 2011-11-28.

[74] "The Opossum: Our Marvelous Marsupial, The Social Loner". Wildlife Rescue League.

[75] Journal Of Venomous Animals And Toxins – Anti-Lethal Factor From Opossum Serum Is A Potent Antidote For Animal, Plant And Bacterial Toxins. Retrieved 2009-12-29.

[Haendler-76] 76.0 ^76.1 B Haendler, J Krätzschmar, F Theuring and W D Schleuning (July 1993). "Transcripts for cysteine-rich secretory protein-1 (CRISP-1; DE/AEG) and the novel related CRISP-3 are expressed under androgen control in the mouse salivary gland". Endocrinology. 133 (1): 192–8. doi:10.1210/en.133.1.192. PMID 8319566. Retrieved 2012-02-20.

[HGNC503538-77] 77.0 ^77.1 HGNC (10 December 2019). "A1BG-AS1 A1BG antisense RNA 1 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.

[Bai-78] 78.0 ^78.1 ^78.2 ^78.3 Jigang Bai, Bowen Yao, Liang Wang, Liankang Sun, Tianxiang Chen, Runkun Liu, Guozhi Yin, Qiuran Xu, Wei Yang (June 2019). "lncRNA A1BG-AS1 suppresses proliferation and invasion of hepatocellular carcinoma cells by targeting miR-216a-5p". 120 (6): 10310–10322. doi:10.1002/jcb.28315. PMID 30556161. Retrieved 16 May 2023.

[HGNC162968-79] 79.0 ^79.1 ^79.2 ^79.3 HGNC (10 December 2019). "ZNF497 zinc finger protein 497 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.

[HGNC100419840-80] 80.0 ^80.1 HGNC (10 December 2019). "LOC100419840 zinc finger protein 446 pseudogene [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.

[HGNC105372483-81] 81.0 ^81.1 HGNC (10 December 2019). "LOC105372483 uncharacterized LOC105372483 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.

[HGNC106479017-82] 82.0 ^82.1 HGNC (10 December 2019). "RNA5SP473 RNA, 5S ribosomal pseudogene 473 [ Homo sapiens (human) ]". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information. Retrieved 2019-12-18.

[Yang2-83] Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez. (2007). "Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters". Gene. 389 (1): 52–65. doi:10.1016/j.gene.2006.09.029. PMID 17123746. Unknown parameter |month= ignored (help)

[Saxonov2006-84] Saxonov S, Berg P, Brutlag DL (2006). "A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters". Proc Natl Acad Sci USA. 103 (5): 1412–1417. doi:10.1073/pnas.0510310103. PMC 1345710. PMID 16432200.

[Guselnikov-85] 85.0 ^85.1 ^85.2 ^85.3 ^85.4 ^85.5 ^85.6 ^85.7 ^85.8 ^85.9 Sergey V Guselnikov and Alexander V Taranin (1 June 2019). "Unraveling the LRC Evolution in Mammals: IGSF1 and A1BG Provide the Keys". Genome Biology and Evolution. 11 (6): 1586–1601. doi:10.1093/gbe/evz102. PMID 31106814. |access-date= requires |url= (help)

[1]

[2]

[3]

[4]

[5]

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25]

[26]

[27]

[28]

[29]

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

[52]

[53]

[54]

[55]

[56]

[57]

[58]

[59]

[60]

[61]

[62]

[63]

[64]

[65]

[66]

[67]

[68]

[69]

[70]

[71]

[72]

[73]

[74]

[75]

[76]

[77]

[78]

[79]

[80]

[81]

[82]

[83]

[84]

[85]

v t e Gene project
Articles	Complex locus A1BG and ZNF497 Grainyhead-like Genes in Regulating Development and Genetic Defects Lysenin Lysine: biosynthesis, catabolism and roles RIG-I like receptors ShK toxin: history, structure and therapeutic applications for autoimmune diseases
Categories	Biochemistry Biology Genetics Medicine
Laboratories	AGC box gene transcription laboratory ATA box gene transcription laboratory C and D boxes gene transcription laboratory CArG box gene transcription laboratory CGCG box gene transcription laboratory CRE box gene transcription laboratory E2 box gene transcription laboratory Enhancer box gene transcription laboratory Factor II B recognition element gene transcription laboratory GA responsive complex gene transcription laboratory GC box gene transcription laboratory H box gene transcription laboratory HNF6 gene transcription laboratory HY box gene transcription laboratory Initiator element gene transcription laboratory Metal responsive element gene transcription laboratory STAT5 gene transcription laboratory TATA box gene transcription laboratory
Lessons	A1BG gene transcription programming Amino Acids Enzymes Enzyme catalysis Enzyme structure and function Eukaryotic transcription Gene regulation in prokaryotes
Lists	Biomolecules
Modules	Module:Infobox gene Module:InfoboxImage
Original research	Gene project
Projects	Biochemistry Gene project History of biology Molecular Biology Molecular evolution Topobiology
Proposals	Gene expressions/Cost sharing and research products Gene expressions in human exploration beyond low earth orbits Gene expressions/Project narrative
Resources	5' cap Acid-base homeostasis Actins Adenines Allergies Alpha-1-B glycoprotein Ammonoids Original research/Amino acids Amphiphiles Anabolism Animal physiology Anomeric carbons Autocatalytic reactions Autonomously replicating sequences Base pairs Biology Biodegradation Biosynthesis Biosynthesis of a human protein Biosynthesis of amino acids Blood Bodily fluids Botany Brain box Calcium signaling Capping enzymes Carbohydrates Carcinoembryonic antigen gene family Catabolism Catalysis Cells Cell signaling Centrosomes Chromatins Chromoboxes Coactivators Corepressors Cofactors Consensus sequences Cytogenetics Cytokinesis Cytosines Deoxyribonucleic acids Digestion Disaccharides Dispersed promoters Dominant group metagenomes Downregulations Endochondral ossification Enzyme inhibitors Enzymology Epigenetics Epigenomes Esters Esterification Eukaryotes Eukaryotic initiation factors Evolution Exaptation Excision repair cross-complementing Factors Fatty acids Ferredoxin Foldings Foods Forkhead boxes Functional groups Genome surveillance complexes Genealogy Genes Genetics Gene transcriptions Genomes Genomics Glycoproteins Glycosides Glycosidic bond Guanines Hair color gene expressions Helicases Heredity History of agriculture Greek and Roman histories of biology Homeostasis Human amino acid synthesis Human DNAs Human genes Human RNA Human teeth Human temperatures Immunoglobulin domain cl11960 Immunoglobulin domain genes Immunoglobulin like domain cd05751 Immunoglobulin like domain pfam13895 Immunoglobulin like domain smart00410 Immunoglobulin receptor superfamily genes Immunoglobulin supergene family Inhibitory peptides Insulators Intranuclear localizations Introduction to Cell Biology Introduction to polymer chemistry Lamarckism Leucine zipper Localization Major histocompatibility complex class I gene family Major histocompatibility complex class II gene family Major histocompatibility complex class III gene family Mammalogy Mathematical molecular biology Mediator complexes Medicine Melanocytes Membranes Metagenomes Molecular biology Molecular genetics Nitrogen metabolism Nucleotide Synthesis Origin of life Orthomolecular medicine Osteoarthritis Paleanthropology Paleontology Phosphate biochemistry Phosphate budgets Phosphate reactions Post translational modifications Principles of biosynthesis Protein isoform Proteins Proteomics Regulations Ribonucleotides Ribosomes RNA polymerases RNA polymerase II holoenzymes RNA polymerase II holoenzyme complexes RNA translations Salinity Stroke management Teeth TFIIA Transports Vascular endothelial growth factor A What is a human? Upregulations Upstream and downstream ZSCAN22 Zoology
Transcription resources	A1BG gene transcription core promoters A1BG gene transcriptions A1BG regulatory elements and regions A1BG response element gene transcriptions A1BG response element negative results A1BG response element positive results ABA-response element gene transcriptions Abf1 regulatory factor gene transcriptions A box gene transcriptions ACGT-containing element gene transcriptions Activating protein gene transcriptions Activating transcription factor gene transcriptions Adenylate–uridylate rich element gene transcriptions Adr1p gene transcriptions Aft1p gene transcriptions AGC box gene transcriptions AGCE gene transcriptions Alpha-amylase conserved element gene transcriptions Amino acid response element gene transcriptions AARE-like Androgen response element gene transcriptions Angiotensinogen core promoter element gene transcriptions Antioxidant-electrophile responsive element gene transcriptions ATA box gene transcriptions Auxin response factor gene transcriptions B box gene transcriptions Bioinformatics tool gene transcriptions Box gene transcriptions Bridge gene transcriptions CAAT box gene transcriptions CadC binding domain gene transcriptions Calcineurin-responsive transcription factor gene transcriptions Calcium-response element gene transcriptions cAMP response element gene transcriptions C and D boxes gene transcriptions Carbohydrate response element gene transcriptions Carbon source-responsive element gene transcriptions Carcinoembryonic antigen gene family CARE gene transcriptions CArG box gene transcriptions CAT box gene transcriptions Cat8p gene transcriptions Cbf1 regulatory factor gene transcriptions C box gene transcriptions CCCTC-binding factor gene transcriptions C-EBP box gene transcriptions Cell-cycle box gene transcriptions Cell cycle regulation gene transcriptions CENP-B box gene transcriptions CGCG box gene transcriptions Circadian control element gene transcriptions Cold-responsive element gene transcriptions Complement copy gene transcriptions Complement-inverse copy gene transcriptions Consensus sequence gene transcriptions Copper response element gene transcriptions Core promoter gene transcriptions Coupling element gene transcriptions CRE box gene transcriptions Cytokinin response regulator gene transcriptions Cytoplasmic polyadenylation element gene transcriptions DAF-16-associated element gene transcriptions DAF-16 binding element gene transcriptions D box gene transcriptions Defense and stress-responsive element gene transcriptions Degenerate nucleotide gene transcriptions Dispersed promoter gene transcriptions Distal promoter gene transcriptions DNA melting gene transcriptions DNA damage response element gene transcriptions DNA replication-related element gene transcriptions Downstream core element gene transcriptions Downstream promoter element gene transcriptions Downstream TFIIB recognition element gene transcriptions DREB box gene transcriptions E2 box gene transcriptions EIF4E basal element gene transcriptions EIN3 binding site gene transcriptions Enhancer activity copy gene transcriptions E box gene transcriptions Element gene transcriptions Endoplasmic reticulum stress response element gene transcriptions Endosperm expression gene transcriptions Enhancer box gene transcriptions Estrogen response element gene transcriptions Ethylene responsive element gene transcriptions Factor II B recognition element gene transcriptions F box gene transcriptions Focused promoter gene transcriptions Forkhead box gene transcriptions Fur box gene transcriptions GAAC element gene transcriptions Gal4p gene transcriptions Γ-interferon activated sequence gene transcriptions GARE gene transcriptions GA responsive complex gene transcriptions GATA gene transcriptions G box gene transcriptions GC box gene transcriptions GCC box gene transcriptions Gcn4p gene transcriptions Gcr1p gene transcriptions Gene expressions General factor II D gene transcriptions General regulatory factors General transcription factor II A gene transcriptions General transcription factor II B gene transcriptions General transcription factor II D gene transcriptions General transcription factor II F gene transcriptions General transcription factor II H gene transcriptions General transcription factor gene transcriptions Gene transcriptions GGC triplet gene transcriptions Gibberellin responsive element gene transcriptions GLM box gene transcriptions Glucocorticoid response element gene transcriptions Grainy head gene transcriptions Grainy head transcription factor gene transcriptions Growth hormone response element gene transcriptions GT boxes Hac1p gene transcriptions Hair color gene expressions H and ACA box gene transcriptions H box gene transcriptions Heat-responsive element gene transcriptions Hex sequence gene transcriptions HMG box gene transcriptions HNF gene transcriptions Homeobox gene transcriptions Hsf1p gene transcriptions HY box gene transcriptions Hybrid C, A boxes Hybrid C, G boxes Hybrid C, T boxes Hypoxia-inducible factor gene transcriptions Hypoxia response elements I box gene transcriptions Initiator element gene transcriptions Initiator-like element gene transcriptions Inositol/choline-responsive elements Interaction gene transcriptions Interferon regulatory factors Inverse copy gene transcriptions Jasmonic acid-responsive element gene transcriptions K-boxes Kozak sequence gene transcriptions Kruppel-associated box gene transcriptions Krüppel-like factor gene transcriptions L box gene transcriptions Leu3 gene transcriptions M35 box gene transcriptions MADS box gene transcriptions Maf recognition element gene transcriptions M box gene transcriptions Mcm1 regulatory factor gene transcriptions Met31p box gene transcriptions Metal responsive element gene transcriptions Middle sporulation element gene transcriptions Mig1p gene transcriptions Model samplings Motif ten element gene transcriptions Msn2,4p gene transcriptions Musashi binding element gene transcriptions MYB recognition element gene transcriptions Myelocytomatosis transcription factor gene transcriptions Myocyte enhancer factor gene transcriptions N-boxes Ndt80p gene transcriptions Nuclear factor 1 Nuclear factor 𝜿B Nuclear factor gene transcriptions Nuclear factor of activated T cell gene transcriptions (NFAT) Nuclear factor Y gene transcriptions Nutrient-sensing response element gene transcriptions Oaf1p gene transcriptions ORE1 binding site gene transcriptions p53 response element gene transcriptions P63 DNA-binding site gene transcriptions P box gene transcriptions Pdr1,3p gene transcriptions Peroxisome proliferator hormone response element gene transcriptions Phosphate starvation-response transcription factor gene transcriptions Pollen1 element gene transcriptions Polycomb response element gene transcriptions Preinitiation complex Preinitiation complex gene transcriptions Pribnow box gene transcriptions Prolamin box gene transcriptions Promoter gene transcriptions Proximal promoter gene transcriptions Promoter occurrence gene transcriptions Pyrimidine box gene transcriptions Q element gene transcriptions Rap1 regulatory factor gene transcriptions Reb1 general regulatory factor gene transcriptions Retinoblastoma control element gene transcriptions Retinoic acid response element gene transcriptions Rgt1p gene transcriptions Rlm1p gene transcriptions RNA polymerase II gene transcriptions RNA polymerase II holoenzyme complex Root specific element gene transcriptions ROR-response element gene transcriptions Rox1p gene transcriptions Rpn4p gene transcriptions R response element gene transcriptions SARE gene transcriptions Seed-specific element gene transcriptions Serum response element gene transcriptions Servenius sequence gene transcriptions Shoot specific element gene transcriptions Sip4p gene transcriptions Smp1p gene transcriptions Sp1 gene transcriptions Spaceflight gene expressions Specificity protein gene transcriptions STAT gene transcriptions Ste12p gene transcriptions Sterol response element gene transcriptions Sucrose box gene transcriptions Synaptic Activity-Responsive Elements TACTAAC box gene transcriptions TAGteam gene transcriptions Tapetum box gene transcriptions TATA binding protein associated factor gene transcriptions TATA binding protein gene transcriptions TATA box gene transcriptions TAT box gene transcriptions TATC box gene transcriptions Tbf1 regulatory factor gene transcriptions T box gene transcriptions TCCACCATA element gene transcriptions TC element gene transcriptions TCT gene transcriptions TEA consensus sequence gene transcriptions Tec1p gene transcriptions Telomeric repeat DNA-binding factor gene transcriptions Tetradecanoylphorbol-13-acetate response element gene transcriptions TGF-β control elements (TCEs) TGF-β inhibitory elements (TIEs) Thyroid hormone response element gene transcriptions Transcriptional regulation Transcription bubble gene transcriptions Transcription factor gene transcriptions Transcription factor 3 gene transcriptions Transcription factory gene transcriptions Transcription start site gene transcriptions Translational control sequence gene transcriptions U box gene transcriptions Unfolded protein response element gene transcriptions Upstream response element gene transcriptions Upstream stimulatory factor gene transcriptions UTR promoter gene transcriptions V and P box gene transcriptions V box gene transcriptions Vhr1p gene transcriptions Vitamin D response element gene transcriptions W box gene transcriptions X box gene transcriptions Xbp1p gene transcriptions X core promoter element gene transcriptions Xenobiotic response element gene transcriptions Xenobiotic responsive element gene transcriptions Yap1p,2p gene transcriptions Y box gene transcriptions YY1 gene transcriptions Zap1p gene transcriptions Z box gene transcriptions Zinc responsive element gene transcriptions

@@ Line 6: / Line 6: @@
 | accessdate = 2012-11-09 }}</ref> The protein encoded by this gene is a plasma glycoprotein of unknown function. The protein shows sequence similarity to the variable regions of some immunoglobulin supergene family member proteins.
-A1BG is located on the negative DNA strand of [[chromosome 19]] from 58,858,172 – 58,864,865.<ref name="A1BG alpha-1-B glycoprotein">{{ cite web
+A1BG was located on the DNA strand of [[chromosome 19]].<ref name=A1BG>{{ cite web
 |title=A1BG alpha-1-B glycoprotein
 |url=https://www.ncbi.nlm.nih.gov/gene/1
-|accessdate=May 10, 2013 }}</ref> Additionally, A1BG is located directly adjacent to the ZSCAN22 gene (58,838,385-58,853,712) on the positive DNA strand, as well as the ZNF837 (58,878,990 - 58,892,389, complement) and ZNF497 (58865723 - 58,874,214, complement) genes on the negative strand.<ref name="A1BG alpha-1-B glycoprotein"/>
+|accessdate=May 10, 2013 }}</ref> Additionally, A1BG, in current nucleotide numbering (58,345,183-58,353,492), is located adjacent to the ZSCAN22 gene (58,326,994-58,342,332) on the positive DNA strand, as well as the ZNF837 (58,367,623 - 58,381,030, complement) and ZNF497 (58,354,357 - 58,362,751, complement) genes on the negative strand.<ref name=A1BG/>
+In the current nucleotide numbering, the A1BG untranslated region (UTR) has been expanded so that with ZSCAN22 ending at 58,342,332, the nucleotides used in this study are 58,342,333 to 58,346,892 on both strands, with the current UTR for A1BG beginning at 58,345,183. On the other side of A1BG ending at 58,353,492, the nucleotides used are 58,353,493 to 58,357,937. With ZNF497 beginning at 58,354,357, this study goes into ZNF497 to 58,357,937 or 3580 nucleotides from its downstream TSS or 4445 nucleotides from the TSS of A1BG downstream from ZNF497.
+For example, an abscisic acid responsive element (ABRE) with the consensus sequence of  ACGTG(G/T)C (Watanabe ''et al''. 2017) occurs in the positive strand in the negative direction from ZSCAN22 to A1BG as ACGTGGC ending at 4239 nucleotides from the end of ZSCAN22 or 58,346,571, where the A is at 58,346,565 inside the UTR of A1BG.
 ==Introduction==
@@ Line 30: / Line 34: @@
 If a specific gene appears to be involved in a disease-related or deleterious pathway being able to alter its expression so as to improve the person's health may be needed. To alter its expression constructively may require knowing what regulatory elements exist in the gene's nearby promoters.
-Identifying a bona fide response element is more difficult than a simple inspection. In order to attribute the response element to a candidate sequence, some observations have to be conducted using molecular, biological and biophysical methods and functional approaches. Findings may indicate that response element in the promoter is a functional element.<ref name=Gu/>
+==Response elements==
+{{main|A1BG response element gene transcriptions}}
+Identifying a bona fide response element is more difficult than a simple inspection. In order to attribute the response element to a candidate sequence, some observations have to be conducted using molecular, biological and biophysical methods and functional approaches. Findings may indicate that response element in the promoter is a functional element.<ref name=Gu>{{ cite journal
+|author=Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang
+|title=Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region
+|journal=Pediatric Research
+|date=July 2016
+|volume=80
+|issue=1
+|pages=159-168
+|url=https://www.nature.com/articles/pr201647
+|arxiv=
+|bibcode=
+|doi=10.1038/pr.2016.47
+|pmid=26991262
+|accessdate=7 September 2020 }}</ref>
 A likely response element found by simple inspection may also be inactive due to methylation.
+Response Elements: "Nucleotide sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents. These elements may be found in both promoter and enhancer regions."<ref name=MeSHNote99>{{ cite web
+|author=U.S. National Library of Medicine
+|title=Response Elements MeSH Descriptor Data 2021
+|publisher=National Institutes of Health
+|location=8600 Rockville Pike, Bethesda, MD 20894
+|date=8 July 2008
+|url=https://meshb.nlm.nih.gov/record/ui?name=response%20element
+|accessdate=22 April 2021 }}</ref>
+"Under conditions of stress, a transcription activator protein binds to the response element and stimulates transcription. If the same response element sequence is located in the control regions of different genes, then these genes will be activated by the same stimuli, thus producing a coordinated response."<ref name=Pierce>{{ cite book
+|author=Benjamin A. Pierce
+|title=Control of Gene Expression, In: ''Genetics Solutions and Problem Solving MegaManual''
+|publisher=Macmillan
+|location=
+|date=24 December 2004
+|editor=
+|pages=221
+|url=https://books.google.com/books?id=sUaIpEvX9noC&pg=PA221&lpg=PA221&source=bl&ots=14s3Xszdsw&sig=ACfU3U0VV4HsN4ekDRZJO83hxj9QidiZ8w&hl=en&sa=X&ved=2ahUKEwisu8jByJPwAhXI8p4KHRgzDx4Q6AEwBHoECAEQAw#v=onepage&f=false
+|arxiv=
+|bibcode=
+|doi=
+|pmid=
+|isbn=
+|accessdate=22 April 2021 }}</ref>
+===WD-40 repeat family===
+{{main|WD-40 repeat family}}
+"Receptor for activated C kinase (RACK1) is a highly conserved, eukaryotic protein of the WD-40 repeat family. [...] During ''Phaseolus vulgaris'' root development, RACK1 (PvRACK1) mRNA expression was induced by auxins, abscisic acid, cytokinin, and gibberellic acid."<ref name=Flores>{{ cite journal
+|author=Tania Islas-Flores, Gabriel Guillén, Xóchitl Alvarado-Affantranger, Miguel Lara-Flores, Federico Sánchez, and Marco A. Villanueva
+|title=PvRACK1 Loss-of-Function Impairs Cell Expansion and Morphogenesis in ''Phaseolus vulgaris'' L. Root Nodules
+|journal=Molecular Plant-Microbe Interactions
+|date=2011
+|volume=24
+|issue=7
+|pages=819-826
+|url=https://apsjournals.apsnet.org/doi/pdfplus/10.1094/MPMI-11-10-0261
+|arxiv=
+|bibcode=
+|doi=10.1094/MPMI-11-10-0261
+|pmid=
+|accessdate=25 April 2021 }}</ref>
+====Abscisic acid (ABA) response elements====
+{{main|ABA-response element gene transcriptions#ABRE samplings}}
+====Auxin response factors====
+{{main|Auxin response factor gene transcriptions}}
+=====ARFUs=====
+{{main|Auxin response factor gene transcriptions#TGTCTC (Ulmasov) ARFbs samplings}}
+=====ARFBs=====
+{{main|Auxin response factor gene transcriptions#TGTCGG (Boer) ARFbs samplings}}
+=====ARF2s=====
+{{main|Auxin response factor gene transcriptions#ARF (Stigliani) samplings}}
+=====ARF5s=====
+{{main|Auxin response factor gene transcriptions#ARF5 samplings}}
+====CAACTC regulatory elements====
+{{main|CARE gene transcriptions}}
+=====CAREs (Fan)=====
+{{main|CARE gene transcriptions#CARE (Fan) sampling of A1BG promoters}}
+=====CAREs (Garaeva)=====
+{{main|CARE gene transcriptions#CARE (Garaeva) samplings}}
+====Cytokinins====
+{{main|Cytokinin response regulator gene transcriptions}}
+=====ARR1s=====
+{{main|Cytokinin response regulator gene transcriptions#ARR1 Cytokinin samplings}}
+=====ARR10s=====
+{{main|Cytokinin response regulator gene transcriptions#ARR10 Cytokinin samplings}}
+=====ARR12s=====
+{{main|Cytokinin response regulator gene transcriptions#ARR12 Cytokinin samplings}}
+=====ARRFs=====
+{{main|Cytokinin response regulator gene transcriptions#ARR (Ferreira) samplings}}
+=====ARRR1s=====
+{{main|Cytokinin response regulator gene transcriptions#ARR (Rashotte1) samplings}}
+=====ARRR2s=====
+{{main|Cytokinin response regulator gene transcriptions#ARR (Rashotte2) samplings}}
+====Coupling elements====
+{{main|Coupling element gene transcriptions}}
+=====CE3Ws=====
+{{main|Coupling element gene transcriptions#CE3 (Watanabe) samplings}}
+=====CE3Ds=====
+{{main|Coupling element gene transcriptions#CE3 (Ding) samplings}}
+====EREs====
+{{main|Ethylene responsive element gene transcriptions#ERE samplings}}
+====Gibberellic acid response elements====
+{{main|GARE gene transcriptions}}
+=====GAREs=====
+{{main|GARE gene transcriptions#GARE sampling of A1BG promoters}}
+=====GAREL1s=====
+{{main|GARE gene transcriptions#GARE-like 1 samplings}}
+====Hypoxia response elements====
+{{main|Hypoxia response element gene transcriptions}}
+=====HIFs=====
+{{main|Hypoxia response element gene transcriptions#Hypoxia-inducible factor samplings}}
+=====HREs=====
+{{main|Hypoxia response element gene transcriptions#Hypoxia response element samplings}}
+=====CACAs=====
+{{main|Hypoxia response element gene transcriptions#CACA samplings}}
+====Pyrimidine boxes====
+{{main|Pyrimidine box gene transcriptions|Nuclear factor of activated T cell gene transcriptions (NFAT)}}
+====TAT boxes====
+{{main|TAT box gene transcriptions}}
+=====TATFs=====
+{{main|TAT box gene transcriptions#TAT box (Fan) samplings}}
+=====TATYs=====
+{{main|TAT box gene transcriptions#TAT box (Yang) samplings}}
+===General Regulatory Factors===
+{{main|General regulatory factors}}
+The following general regulatory factors occur in the promoters between ZSCAN22, A1BG and ZNF497 on human chromosome 19.
+====Abfms====
+{{main|Abf1 regulatory factor gene transcriptions}}
+====Rap1s====
+{{main|Rap1 regulatory factor gene transcriptions}}
+====Reb1s====
+{{main|Reb1 general regulatory factor gene transcriptions}}
+====Tbf1s====
+{{main|Tbf1 regulatory factor gene transcriptions}}
+===Basic leucine zipper (bZIP) class response elements===
+====A-boxes====
+{{main|A box gene transcriptions}}
+====ACGTs====
+{{main|ACGT-containing element gene transcriptions#ACGT samplings}}
+"A majority of the plant bZIP proteins isolated to date recognize elements with an ACGT core (Foster et al., 1994)."<ref name=Nijhawan>{{ cite journal | author = Nijhawan A, Jain M, Tyagi AK, Khurana JP
+| title = Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice
+| journal = Plant Physiology
+| volume = 146
+| issue = 2
+| pages = 333–50
+| date = February 2008
+| pmid = 18065552
+| doi = 10.1104/pp.107.112821 }}</ref>
+"Most recombinant bZIP proteins can interact with ACGT elements derived from different plant genes, albeit with different affinity. Systematic protein/DNA binding studies have shown that sequences flanking the ACGT core affect bZIP protein binding specificity. These studies have provided the basis for a concise ACGT nomenclature and defined high-affinity A-box, C-box, and G-box elements."<ref name=Foster>{{ cite journal
+|author=Randy Foster, Takeshi Izawa and Nam-Hai Chua
+|title=Plant bZIP proteins gather at ACGT elements
+|journal=FASEB
+|date=1 February 1994
+|volume=8
+|issue=2
+|pages=192-200
+|url=https://faseb.onlinelibrary.wiley.com/doi/pdfdirect/10.1096/fasebj.8.2.8119490
+|arxiv=
+|bibcode=
+|doi=10.1096/fasebj.8.2.8119490
+|pmid=8119490
+|accessdate=25 June 2021 }}</ref>
+"HY5 binds to the promoter of light-responsive genes featuring [[ACGT-containing element gene transcriptions|"ACGT-containing elements"]] such as the G-box (CACGTG), C-box (GACGTC), Z-box (ATACGGT), and A-box (TACGTA) (4, 6)."<ref name=Nawkar>{{ cite journal
+|author=Ganesh M. Nawkar, Chang Ho Kanga, Punyakishore Maibam, Joung Hun Park, Young Jun Jung, Ho Byoung Chae, Yong Hun Chi, In Jung Jung, Woe Yeon Kim, Dae-Jin Yun, and Sang Yeol Lee
+|title=HY5, a positive regulator of light signaling, negatively controls the unfolded protein response in ''Arabidopsis''
+|journal=Proceedings of the National Academy of Sciences USA
+|date=21 February 2017
+|volume=114
+|issue=8
+|pages=2084-89
+|url=https://www.pnas.org/content/pnas/114/8/2084.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1073/pnas.1609844114
+|pmid=
+|accessdate=24 June 2021 }}</ref>
+====Activating transcription factors====
+{{main|Activating transcription factor gene transcriptions}}
+=====ATFBs=====
+{{main|Activating transcription factor gene transcriptions#Activating transcription factor samplings (Burton)}}
+=====ATFKs=====
+{{main|Activating transcription factor gene transcriptions#Activating transcription factor samplings (Kilberg)}}
+====Affinity Capture-Western; Two-hybrid transcription factors====
+{{main|Aft1p gene transcriptions}}
+=====AFTs=====
+{{main|Aft1p gene transcriptions#AFT1 samplings}}
+====Box As====
+{{main|A box gene transcriptions#Box A samplings}}
+====C-boxes====
+{{main|C box gene transcriptions}}
+C-boxes come in several varieties:
+=====C-boxes (Johnson)=====
+{{main|C box gene transcriptions#Johnson C-box samplings}}
+=====C boxes (Samarsky)=====
+{{main|C box gene transcriptions#Samarsky C box samplings}}
+=====C boxes (Voronina)=====
+{{main|C box gene transcriptions#Voronina C box samplings}}
+=====C boxes (Song)=====
+{{main|C box gene transcriptions#Song C-box samplings}}
+=====C boxes (Song hybrids)=====
+{{main|C box gene transcriptions#Hybrid C, G box samplings}}
+Hybrids: C/A-box (TGACGTAT), C/G-box (TGACGTGT), C/T-box (TGACGTTA).
+====CAMPs====
+{{main|CRE box gene transcriptions#CRE samplings of the A1BG promoters}}
+====ESRE====
+{{main|Endoplasmic reticulum stress response element gene transcriptions}}
+The endoplasmic reticulum stress response element (ESRE) has two parts: (1) CCAAT and (2) CCACG which are tested separately then compared to see if any parts have any nine nucleotides between them.
+=====CCAAT=====
+{{main|Endoplasmic reticulum stress response element gene transcriptions#CCAAT samplings}}
+=====CCACG=====
+{{main|Endoplasmic reticulum stress response element gene transcriptions#CCACG samplings}}
+According to So (2018) the endoplasmic reticulum stress response element should be CCAAT-N9-CCACG. Samplings demonstrate that the ideal CCAAT-N9-CCACG or its complement inverse do not occur on either side of A1BG or close to ZSCAN22 or ZNF497.
+====Hap motif====
+{{main|CAAT box gene transcriptions#Heme-activated protein (Hap) samplings|Endoplasmic reticulum stress response element gene transcriptions#CCAAT samplings}}
+====G-boxes====
+{{main|G box gene transcriptions}}
+=====G-box (CACGTG)=====
+{{main|Phosphate starvation-response transcription factor gene transcriptions#Pho samplings|Complex locus A1BG and ZNF497#Phors}}
+====GCN4 motif====
+{{main|Gcn4p gene transcriptions}}
+=====GCREs (Gcn4)=====
+{{main|Gcn4p gene transcriptions#GCRE samplings}}
+====Migs====
+{{main|Mig1p gene transcriptions}}
+====Nuclear factors====
+{{main|Nuclear factor gene transcriptions}}
+=====NFATs=====
+{{main|Nuclear factor of activated T cell gene transcriptions (NFAT)#NFAT samplings}}
+=====HNF6s=====
+{{main|HNF gene transcriptions#HNF6 samplings}}
+====T boxes====
+{{main|T box gene transcriptions}}
+=====TboxCs=====
+{{main|T box gene transcriptions#T box (Conlon) samplings}}
+=====TboxZs=====
+{{main|T box gene transcriptions#T box (Zhang) samplings}}
+====Vboxes====
+{{main|V box gene transcriptions#V box samplings}}
+====Z-boxes====
+{{main|Z box gene transcriptions}}
+=====ZboxGs=====
+{{main|Z box gene transcriptions#General Z-box (ZboxG) samplings}}
+=====ZboxSps=====
+{{main|Z box gene transcriptions#Z-box (ZboxSp) samplings}}
+===Helix-turn-helix (HTH) transcription factors===
+{{main|Helix-turn-helix transcription factors}}
+Gene ID: 4602 is MYB [myeloblastosis] MYB proto-oncogene, transcription factor on 6q23.3: "This gene encodes a protein with three HTH DNA-binding domains that functions as a transcription regulator. This protein plays an essential role in the regulation of hematopoiesis. This gene may be aberrently expressed or rearranged or undergo translocation in leukemias and lymphomas, and is considered to be an oncogene. Alternative splicing results in multiple transcript variants."<ref name=RefSeq4602>{{ cite web
+|author=RefSeq
+|title=MYB MYB proto-oncogene, transcription factor [ Homo sapiens (human) ]
+|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
+|location=8600 Rockville Pike, Bethesda MD, 20894 USA
+|date=January 2016
+|url=https://www.ncbi.nlm.nih.gov/gene/4602
+|accessdate=7 February 2021 }}</ref>
+====CadC binding domains====
+{{main|CadC binding domain gene transcriptions#Cadaverine C samplings}}
+====Factor II B recognition elements====
+{{main|Factor II B recognition element gene transcriptions#BREu samplings}}
+====Forkhead boxes====
+{{main|Forkhead box gene transcriptions#Forkhead box samplings}}
+====Homeoboxes====
+{{main|Homeobox gene transcriptions#Homeobox samplings}}
+====Homeodomains====
+{{main|Homeobox gene transcriptions#Homeodomain samplings}}
+====HSE3 (Eastmond)====
+{{main|Hsf1p gene transcriptions#HSE3 (Eastmond) samplings}}
+====HSE4 (Eastmond)====
+{{main|Hsf1p gene transcriptions#HSE4 (Eastmond) samplings}}
+====HSE8 GAP1 (Eastmond)====
+{{main|Hsf1p gene transcriptions#HSE8 GAP1 (Eastmond) samplings}}
+====HSE9 GAP2 (Eastmond)====
+{{main|Hsf1p gene transcriptions#HSE9 GAP2 (Eastmond) samplings}}
+====Hsf (Tang)====
+{{main|Hsf1p gene transcriptions#Hsf (Tang) samplings}}
+====MREs====
+{{main|MYB recognition element gene transcriptions#MRE samplings}}
+====Tryptophan residues====
+{{main|Interferon regulatory factor gene transcriptions#Tryptophan residue samplings}}
+===Basic helix-loop-helix (bHLH) transcription factors===
+{{main|Basic helix–loop–helix}}
+"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."<ref name=Rossi>{{ cite journal
+|author=Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh
+|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
+|journal=Genome Research
+|date=21 March 2018
+|volume=28
+|issue=
+|pages=497-508
+|url=https://genome.cshlp.org/content/28/4/497.full
+|arxiv=
+|bibcode=
+|doi=10.1101/gr.229518.117
+|pmid=29563167
+|accessdate=31 August 2020 }}</ref>
+"Pho4 bound to virtually all E-boxes ''in vitro'' (96%) [...]. That was not the case ''in vivo'', where only 5% were bound by Pho4, under activating conditions as determined by ChIP-seq [Zhou and O'Shea 2011]."<ref name=Rossi/>
+"Pho4 possesses the intrinsic ability to bind every E-box, but ''in vivo'' is prevented from binding by chromatin unless assisted by chromatin remodelers (Svaren ''et al.'' 1994) that are targeted at promoter regions."<ref name=Rossi/>
+"On one end of that spectrum, typical transcription factors like Pho4 do not appear to compete with nucleosomes and instead predominantly sample motifs that already exist in the [nucleosome-free promoter regions] NFRs generated by other factors. In vitro (PB-exo), Pho4 bound nearly every instance of an E-box motif across the yeast genome. However, in vivo, Pho4 is a low-abundance protein that is recruited to the nucleus upon phosphate starvation by other factors, to act at a few dozen genes (Komeili and O'Shea 1999; Zhou and O'Shea 2011). Since Pho4 appears unable to compete with nucleosomes, competent sites that are occluded by nucleosomes are invisible to Pho4."<ref name=Rossi/>
+The Pho4 homodimer binds to DNA sequences containing the bHLH binding site CACGTG.<ref name=Shao>{{ cite journal
+|author=Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman
+|title = A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p
+|journal = Nucleic Acids Research
+|volume = 26
+|issue = 3
+|pages = 710–4
+|date= 1 February 1998
+|pmid = 9443961
+|pmc = 147311
+|doi = 10.1093/nar/26.3.710
+|url = https://academic.oup.com/nar/article/26/3/710/1052045 }}</ref>
+The upstream activating sequence (UAS) for Pho4p is CAC(A/G)T(T/G) in the promoters of ''HIS4'' and ''PHO5'' regarding phosphate limitation with respect to regulation of the purine and histidine biosynthesis pathways [66].<ref name=Tang>{{ cite journal
+|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
+|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
+|journal=Metabolites
+|date=6 August 2020
+|volume=10
+|issue=8
+|pages=320-39
+|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
+|arxiv=
+|bibcode=
+|doi=10.3390/metabo10080320
+|pmid=32781665
+|accessdate=18 September 2020 }}</ref>
+bHLH proteins typically bind to a consensus sequence called an E-box, CANNTG.<ref name="pmid10319327">{{cite journal |author=Chaudhary J, Skinner MK |title=Basic helix-loop-helix proteins can act at the E-box within the serum response element of the c-fos promoter to influence hormone-induced promoter activation in Sertoli cells |journal=Mol. Endocrinol. |volume=13 |issue=5 |pages=774–86 |date=1999 |pmid=10319327 |doi=10.1210/mend.13.5.0271 }}</ref>
+"A computer search for transcription promoter elements [...] showed the presence of a prominent TATA box 22 nucleotides upstream of the transcription start site and an [[Sp1]] site at position -42 to -33. The 5'-flanking sequence also contains three E boxes with CANNTG consensus sequences at positions -464 to -459, -90 to -85, and -52 to -47 that have been marked as [[E box]], [[E1 box]], and [[E2 box]], respectively [...]. In addition, the 5'-flanking region contains one or more [[GRE]], [[Aryl hydrocarbon receptor#DNA binding (xenobiotic response element – XRE)|XRE]], [[GATA1|GATA-1]], [[ATF4|GCN-4]], [[ETV4|PEA-3]], [[AP-1 (transcription factor)|AP1]], and [[Activating protein 2|AP2]] consensus motifs and also three imperfect CArG sites [...]."<ref name=Lenka>{{ cite journal
+|author=Nibedita Lenka, Aruna Basu, Jayati Mullick, and Narayan G. Avadhani
+|title=The role of an E box binding basic helix loop helix protein in the cardiac muscle-specific expression of the rat cytochrome oxidase subunit VIII gene
+|journal=The Journal of Biological Chemistry
+|date=22 November 1996
+|volume=271
+|issue=47
+|pages=30281–30289
+|url=http://www.jbc.org/content/271/47/30281.full.pdf
+|arxiv=
+|bibcode=
+|doi=10.1074/jbc.271.47.30281
+|pmid=
+|accessdate=7 February 2019 }}</ref>
+====AhRYs====
+{{main|Xenobiotic response element gene transcriptions#TCDD*AhR DNA-binding consensus sequence sampling}}
+====AHRE-IIs====
+{{main|Xenobiotic responsive element gene transcriptions#AHRE-II samplings}}
+====AEREs====
+{{main|Antioxidant-electrophile responsive element gene transcriptions#AERE (Lacher) samplings}}
+====CAT boxes====
+{{main|CAT box gene transcriptions#CAT box samplings}}
+====CAT-box-like elements====
+{{main|CAT box gene transcriptions#CAT-box-like element samplings}}
+===="Class C"====
+{{main|N box gene transcriptions#"Class C" (Leal) samplings}}
+===="Class I"====
+=====TCFs=====
+{{main|Transcription factor 3 gene transcriptions#TCF3 samplings}}
+====DIOXs====
+{{main|Xenobiotic response element gene transcriptions#DIOX samplings}}
+====Enhancer boxes====
+{{main|Enhancer box gene transcriptions#Enhancer box samplings}}
+=====ChoRE motifs=====
+{{main|Carbohydrate response element gene transcriptions}}
+=====CarbE1s=====
+{{main|Carbohydrate response element gene transcriptions#ATCTTG (CarbE1) samplings}}
+=====CarbE2s=====
+{{main|Carbohydrate response element gene transcriptions#CACGTG (CarbE2) samplings}}
+=====CarbE3s=====
+{{main|Carbohydrate response element gene transcriptions#TCCGCC (CarbE3) samplings}}
+=====Phors=====
+{{main|Phosphate starvation-response transcription factor gene transcriptions#Pho samplings}}
+Palindromic E-box motif (CACGTG).
+=====E2 boxes=====
+{{main|E2 box gene transcriptions#E2 box samplings}}
+====GATAs====
+{{main|GATA gene transcriptions#GATA samplings}}
+====Gln3s====
+{{main|GATA gene transcriptions#Staschke Gln3 samplings}}
+====Glucocorticoid response elements====
+{{main|Glucocorticoid response element gene transcriptions#Glu samplings}}
+====ICRE (Lopes)====
+{{main|Inositol, choline-responsive element gene transcriptions}}
+====ICRE (Schwank)====
+{{main|Inositol, choline-responsive element gene transcriptions}}
+====Pho4====
+{{main|Phosphate starvation-response transcription factor gene transcriptions#Phop samplings}}
+====QRDREs====
+{{main|Xenobiotic response element gene transcriptions#QRDRE samplings}}
+====Carbon source-responsive elements====
+{{main|Carbon source-responsive element gene transcriptions}}
+=====CATTCAs=====
+{{main|Carbon source-responsive element gene transcriptions#CATTCA samplings}}
+=====TCCGs=====
+{{main|Carbon source-responsive element gene transcriptions#TCCG samplings}}
+====XREs====
+{{main|Xenobiotic response element gene transcriptions#Xenobiotic response element samplings}}
+===Basic helix-loop-helix leucine zipper transcription factors===
+Basic helix-loop-helix leucine zipper transcription factors are, as their name indicates, transcription factors containing both [[Basic helix-loop-helix]] and [[leucine zipper]] motifs.
+Examples include [[Microphthalmia-associated transcription factor]] and [[Sterol regulatory element-binding protein]] (SREBP).
+MITF recognizes E-box (CAYRTG) and M-box (TCAYRTG or CAYRTGA) sequences in the promoter regions of target genes.<ref name=Hoek>{{cite journal | author = Hoek KS, Schlegel NC, Eichhoff OM, Widmer DS, Praetorius C, Einarsson SO, Valgeirsdottir S, Bergsteinsdottir K, Schepsky A, Dummer R, Steingrimsson E | title = Novel MITF targets identified using a two-step DNA microarray strategy | journal = Pigment Cell Melanoma Res. | volume = 21 | issue = 6 | pages = 665–76 | date = 2008 | pmid = 19067971 | doi = 10.1111/j.1755-148X.2008.00505.x }}</ref>
+[[Serum response element gene transcriptions]]: The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra>{{ cite journal
+|author=Ravi P. Misra
+|author2=Azad Bonni
+|author3=Cindy K. Miranti
+|author4=Victor M. Rivera
+|author5=Morgan Sheng
+|author6=Michael E.Greenberg
+|title=L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway
+|journal=The Journal of Biological Chemistry
+|date=14 October 1994
+|volume=269
+|issue=41
+|pages=25483-25493
+|url=http://www.jbc.org/content/269/41/25483.full.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=7929249
+|accessdate=7 December 2019 }}</ref>
+"Serum response factor (SRF) is an important transcription factor that regulates cardiac and skeletal muscle genes during development, maturation and adult aging [17,18]. SRF regulates its target genes by binding to serum response elements (SREs), which contain a consensus CC(A/T)<sub>6</sub>GG (CArG) motif."<ref name=Zhang2017>{{ cite journal
+|author=Xiaomin Zhang, Gohar Azhar, Jeanne Y. Wei
+|title=SIRT2 gene has a classic SRE element, is a downstream target of serum response factor and is likely activated during serum stimulation
+|journal=PLOS One
+|date=21 December 2017
+|volume=12
+|issue=12
+|pages=e0190011
+|url=https://journals.plos.org/plosone/article?id=10.1371/journal.pone.0190011
+|arxiv=
+|bibcode=
+|doi=10.1371/journal.pone.0190011
+|pmid=
+|accessdate=23 February 2021 }}</ref>
+====CArG boxes====
+{{main|CArG box gene transcriptions#CArG box samplings}}
+====MITF E-boxes====
+{{main|Enhancer box gene transcriptions#MITF E-box (CAYRTG) samplings}}
+=====RREs=====
+{{main|MYB recognition element gene transcriptions#RRE samplings}}
+Consensus sequence: CATCTG.
+====M-boxes====
+{{main|M box gene transcriptions}}
+=====M box (Bertolotto)=====
+{{main|M box gene transcriptions#M box (Bertolotto) samplings}}
+=====M-box (Hoek)=====
+{{main|M box gene transcriptions#M-box (Hoek) samplings}}
+=====M-box (Ripoll)=====
+{{main|M box gene transcriptions#M-box (Ripoll) samplings}}
+====SER elements====
+{{main|Serum response element gene transcriptions#SER samplings}}
+===Basic helix-span-helix===
+====Activating proteins====
+{{main|Activating protein gene transcriptions}}
+=====AP2as=====
+{{main|Activating protein gene transcriptions#AP-2 alpha consensus sequences}}
+=====APCo1s=====
+{{main|Activating protein gene transcriptions#Activating protein samplings (Cohen)}}
+=====APCo2s=====
+{{main|Activating protein gene transcriptions#Activating protein (Cohen2) samplings}}
+=====APM3Ns=====
+{{main|Activating protein gene transcriptions#Activating protein samplings (Murata, 3N)}}
+=====APM4Ns=====
+{{main|Activating protein gene transcriptions#Activating protein samplings (Murata, 4N)}}
+=====Yao1s=====
+{{main|Activating protein gene transcriptions#Activating protein samplings (Yao1)}}
+=====Yao2s=====
+{{main|Activating protein gene transcriptions#Activating protein samplings (Yao2)}}
+=====Yau3s=====
+{{main|Activating protein gene transcriptions#Activating protein samplings (Yao3)}}
+"[[Pemphigus foliaceus]] (PF) is an autoimmune disease, endemic in Brazilian rural areas, characterized by acantholysis and accompanied by complement activation, with generalized or localized distribution of painful epidermal blisters. [[CD59]] is an essential complement regulator, inhibiting formation of the membrane attack complex, and mediating signal transduction and activation of T lymphocytes. ''CD59'' has different transcripts by alternative splicing, of which only two are widely expressed, suggesting the presence of regulatory sites in their noncoding regions. To date, there is no association study with polymorphisms in ''CD59'' noncoding regions and susceptibility to autoimmune diseases. In this study, we aimed to evaluate if ''CD59'' polymorphisms have a possible regulatory effect on gene expression and susceptibility to PF. Six noncoding polymorphisms were haplotyped in 157 patients and 215 controls by sequence-specific [[polymerase chain reaction|PCR]], and CD59 mRNA levels were measured in 82 subjects, by qPCR. The ''rs861256-allele-G'' (''rs861256*G'') was associated with increased mRNA expression (''p'' = .0113) and PF susceptibility in women (OR = 4.11, ''p'' = .0001), which were also more prone to develop generalized lesions (OR = 4.3, ''p'' = .009) and to resist disease remission (OR = 3.69, ''p'' = .045). Associations were also observed for ''rs831625*G'' (OR = 3.1, ''p'' = .007) and ''rs704697*A'' (OR = 3.4, ''p'' = .006) in Euro-Brazilian women, and for ''rs704701*C'' (OR = 2.33, ''p'' = .037) in Afro-Brazilians. These alleles constitute the ''GGCCAA'' haplotype, which also increases PF susceptibility (OR = 4.9, ''p'' = .045) and marks higher mRNA expression (''p'' = .0025). [...] higher ''CD59'' transcriptional levels may be related with PF susceptibility (especially in women), probably due to the effect of genetic polymorphism and to the CD59 role in T cell signal transduction."<ref name=Silva>{{ cite journal
+|author=Amanda Salviano-Silva, Maria Luiza Petzl-Erler & Angelica Beate Winter Boldt
+|title=''CD59'' polymorphisms are associated with gene expression and different sexual susceptibility to pemphigus foliaceus
+|journal=Autoimmunity
+|date=29 April 2017
+|volume=50
+|issue=6
+|pages=377-385
+|url=https://www.tandfonline.com/doi/abs/10.1080/08916934.2017.1329830
+|arxiv=
+|bibcode=
+|doi=10.1080/08916934.2017.1329830
+|pmid=
+|accessdate=27 September 2021 }}</ref>
+===Stem-loops===
+[[Image:Stem-loop.svg|thumb|right|300px|An example of an RNA stem-loop is shown. Credit: [[c:user:Sakurambo|Sakurambo]].{{tlx|free media}}]]
+As an important secondary structure of RNA, a stem-loop can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.<ref>Svoboda, P., & Cara, A. (2006). Hairpin RNA: A secondary structure of primary importance. Cellular and Molecular Life Sciences, 63(7), 901-908.</ref>
+Hairpin loops are often elements found within the 5'UTR of prokaryotes. These structures are often bound by proteins or cause the attenuation of a transcript in order to regulate translation.<ref name=Meyer>{{cite journal|last=Meyer|first=Michelle|author2=Deiorio-Haggar K |author3=Anthony J |title=RNA structures regulating ribosomal protein biosynthesis in bacilli|journal=RNA Biology|date=July 2013|volume=10|series=7|pages=1160–1164|doi=10.4161/rna.24151|pmid=23611891 }}</ref>
+The mRNA stem-loop structure forming at the ribosome binding site may control an initiation of translation.<ref name=Malys2009>{{cite journal | author = Malys N, Nivinskas R | title = Non-canonical RNA arrangement in T4-even phages: accommodated ribosome binding site at the gene 26-25 intercistronic junction |journal = Mol Microbiol |volume = 73 | issue = 6 | pages = 1115–1127 | date = 2009 | pmid = 19708923 | doi =10.1111/j.1365-2958.2009.06840.x }}</ref><ref name=Malys2010>{{ cite journal | author = Malys N, McCarthy JEG | title = Translation initiation: variations in the mechanism can be anticipated |journal = Cellular and Molecular Life Sciences | date = 2010 | doi =10.1007/s00018-010-0588-z | pmid=21076851 | volume = 68 | issue = 6 | pages = 991–1003 }}</ref>
+{{clear}}
+====AUREs====
+{{main|Adenylate–uridylate rich element gene transcriptions#Adenylate–uridylate rich element (Bakheet) samplings}}
+====Adenylate–uridylate rich elements (Chen and Shyu, Class I)====
+{{main|Adenylate–uridylate rich element gene transcriptions#ATTTA (Chen and Shyu, Class I) samplings}}
+====Adenylate–uridylate rich elements (Chen and Shyu, Class II)====
+{{main|Adenylate–uridylate rich element gene transcriptions#UUAUUUA(U/A)(U/A) (Chen and Shyu, Class II) samplings}}
+====Adenylate–uridylate rich elements (Chen and Shyu, Class III)====
+{{main|Adenylate–uridylate rich element gene transcriptions#ATTT (Chen and Shyu, Class III)}}
+====MERs====
+{{main|Adenylate–uridylate rich element gene transcriptions#Overlapping (Siegel) mers}}
+====Constitutive decay elements====
+{{main|Adenylate–uridylate rich element gene transcriptions#Constitutive decay element (Siegel) samplings}}
+==={{chem|Cys|2|His|2}} SP / Kruppel-like factor (KLF) transcription factor family===
+The {{chem|Cys|2|His|2}}-like fold group ({{chem|Cys|2|His|2}}) is by far the best-characterized class of zinc fingers, and is common in mammalian transcription factors, where such domains adopt a simple ββα fold and have the amino acid sequence motif:<ref name=Pabo2001>{{cite journal | author = Pabo CO, Peisach E, Grant RA | title = Design and selection of novel Cys2His2 zinc finger proteins | journal = Annual Review of Biochemistry | volume = 70 | pages = 313–40 | date = 2001 | pmid = 11395410 | doi = 10.1146/annurev.biochem.70.1.313 }}</ref>
+:X<sub>2</sub>-Cys-X<sub>2,4</sub>-Cys-X<sub>12</sub>-His-X<sub>3,4,5</sub>-His
+====Alcohol dehydrogenase repressor 1====
+{{main|Adr1p gene transcriptions#ADR samplings}}
+====SP1M1s====
+{{main|Specificity protein gene transcriptions#Sp1-box 1 (Motojima) Samplings}}
+====SP1M2s====
+{{main|Specificity protein gene transcriptions#Sp1-box 2 (Motojima) Samplings}}
+====SP-1 (Sato)s====
+{{main|Specificity protein gene transcriptions#Sp-1 (Sato) samplings}}
+====SP1 (Yao)s====
+{{main|Specificity protein gene transcriptions#Sp1 (Yao) samplings}}
+====YY1Ts====
+{{main|YY1 gene transcriptions#YY1 CCATCTT samplings}}
+===AP-2/EREBP-related factors===
+====AGC boxes====
+{{main|AGC box gene transcriptions#AGC box samplings}}
+===AP-1 transcription factor network (Pathway)===
+Sixty-nine genes are included in the AP-1 transcription factor network (Pathway).<ref name=AP-1TFN>{{ cite web
+|author=NCBI
+|title=AP-1 transcription factor network
+|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
+|location=8600 Rockville Pike, Bethesda MD, 20894 USA
+|date=9 March 2021
+|url=https://pubchem.ncbi.nlm.nih.gov/pathway/Pathway%20Interaction%20Database:ap1_pathway
+|accessdate=26 October 2021 }}</ref>
+====AGCEs====
+{{main|AGCE gene transcriptions#AGCE samplings}}
+===Zinc finger DNA-binding domains===
+====AnRE1s====
+{{main|Androgen response element gene transcriptions#Androgen response element1 (Kouhpayeh) samplings}}
+====AnDRE2s====
+{{main|Androgen response element gene transcriptions#Androgen response element2 (Kouhpayeh) samplings}}
+====AnREWs====
+{{main|Androgen response element gene transcriptions#Androgen response element (Wilson) samplings}}
+====B-boxes====
+{{main|B box gene transcriptions#B box (Johnson) samplings}}
+====Box Bs====
+{{main|B box gene transcriptions#B1 box (Sanchez) samplings}}
+===β-Scaffold factors===
+"Higher animals have [transcription factor] TF genes for the basic domain, the β-scaffold factor, and other new
+structures; however, their total proportion is less than 15% and most are [zinc (Zn)-coordinating factor] ZF and [Helix-Turn-Helix] HTH genes."<ref name=Nagata>{{ cite book
+|author=Toshifumi Nagata, Aeni Hosaka-Sasaki and Shoshi Kikuchi
+|title=The Evolutionary Diversification of Genes that Encode Transcription Factor Proteins in Plants, In: ''Plant Transcription Factors Evolutionary, Structural and Functional Aspects''
+|publisher=Academic Press
+|location=
+|date=2016
+|editor=Daniel H. Gonzalez
+|pages=73-97
+|url=https://www.sciencedirect.com/science/article/pii/B9780128008546000051
+|arxiv=
+|bibcode=
+|doi=10.1016/B978-0-12-800854-6.00005-1
+|pmid=
+|isbn=978-0-12-800854-6
+|accessdate=28 November 2021 }}</ref>
+====ATA boxes====
+{{main|ATA box gene transcriptions#ATA box samplings}}
+====Γ-interferon activated sequences====
+{{main|Γ-interferon activated sequence gene transcriptions#Γ-interferon activated sequence samplings}}
+====HMG boxes====
+{{main|HMG box gene transcriptions#HMG box samplings}}
+===Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins===
+"The transcription factors Uga3, Dal81 and Leu3 belong to the class III family (Zn(II)<sub>2</sub>Cys<sub>6</sub> proteins), and they recognize highly related sequences rich in GGC triplets [15]."<ref name=Ruiz>{{ cite journal
+|author=Marcos Palavecino-Ruiz, Mariana Bermudez-Moretti, Susana Correa-Garcia
+|title=Unravelling the transcriptional regulation of Saccharomyces cerevisiae UGA genes: the dual role of transcription factor LEU3
+|journal=Microbiology
+|date=1 November 2017
+|volume=
+|issue=
+|pages=
+|url=https://www.researchgate.net/profile/Mariana_Bermudez3/publication/320571623_Unravelling_the_transcriptional_regulation_of_Saccharomyces_cerevisiae_UGA_genes_the_dual_role_of_transcription_factor_Leu3/links/5c62114c299bf1d14cbf7ade/Unravelling-the-transcriptional-regulation-of-Saccharomyces-cerevisiae-UGA-genes-the-dual-role-of-transcription-factor-Leu3.pdf
+|arxiv=
+|bibcode=
+|doi=10.1099/mic.0.000560
+|pmid=
+|accessdate=21 February 2021 }}</ref>
+====Dal81====
+====GCC boxes====
+{{main|AGC box gene transcriptions#GCC box samplings}}
+====GGC triplets====
+{{main|GGC triplet gene transcriptions#GGC samplings}}
+=====GGCGGC triplets=====
+{{main|GGC triplet gene transcriptions#GGCGGC triplet samplings}}
+====Leu3====
+{{main|Leu3 gene transcriptions#Leu samplings|GGC triplet gene transcriptions#Leu3 samplings}}
+====Uga3====
+{{main|Leu3 gene transcriptions}}
+===Hairpin-hinge-hairpin-tail===
+"In addition to this ACA box, they have the consensus H box sequence (5'-ANANNA-3') but have no other primary sequence identity. Despite this lack of primary sequence conservation, the H and ACA boxes are embedded in an evolutionarily conserved hairpin-hinge-hairpin-tail core secondary structure with the H box in the single-stranded hinge region and the ACA box in the single-stranded tail (5, 16)."<ref name=Mitchell>{{ cite journal
+|author=James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins
+|title=A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End
+|journal=Molecular and Cellular Biology
+|date=January 1999
+|volume=19
+|issue=1
+|pages=567–576
+|url=http://mcb.asm.org/content/19/1/567.full.pdf
+|arxiv=
+|bibcode=
+|doi=
+|pmid=
+|accessdate=5 November 2018 }}</ref>
+====H and ACA boxes====
+{{main|H and ACA box gene transcriptions#H and ACA boxes in promoters of A1BG}}
+====H-boxes (Grandbastien)====
+{{main|H box gene transcriptions#H-box (Grandbastien) samplings}}
+====H-boxes (Lindsay)====
+{{main|H box gene transcriptions#H-box (Lindsay) samplings}}
+====H boxes (Mitchell)====
+{{main|H box gene transcriptions#H boxes (Mitchell) samplings}}
+====H boxes (Rozhdestvensky)====
+{{main|H box gene transcriptions#H boxes (Rozhdestvensky) in promoters of A1BG}}
+===Unknown response element types===
+====ACEs====
+{{main|MYB recognition element gene transcriptions#ACE samplings}}
+====BBCABW Inrs====
+{{main|Initiator element gene transcriptions#BBCABW samplings}}
+====Calcineurin-responsive transcription factors====
+{{main|Calcineurin-responsive transcription factor gene transcriptions#CRT samplings}}
+====Carbs====
+{{main|Carbohydrate response element gene transcriptions#ACCGG (Carb) samplings}}
+====Carb1s====
+{{main|Carbohydrate response element gene transcriptions#CCCAT (Carb1) samplings}}
+====Cat8s====
+{{main|Cat8p gene transcriptions#Cat8p samplings}}
+====Cell-cycle box variants====
+{{Main|Cell-cycle box gene transcriptions#CCB variant samplings}}
+====CGCG boxes====
+{{main|CGCG box gene transcriptions#CGCG box samplings}}
+====Circadian control elements====
+{{main|Circadian control element gene transcriptions#CCE samplings}}
+====Cold-responsive elements====
+{{main|Cold-responsive element gene transcriptions#Cold-responsive element samplings}}
+====Copper response elements====
+{{main|Copper response element gene transcriptions}}
+=====CuREQs=====
+{{main|Copper response element gene transcriptions#CuRE (Quinn) samplings}}
+=====CuREPs=====
+{{main|Copper response element gene transcriptions#CuRE (Park) samplings}}
+====Cytoplasmic polyadenylation elements====
+{{main|Cytoplasmic polyadenylation element gene transcriptions#CPE samplings}}
+====DAF-16 binding elements====
+{{main|DAF-16 binding element gene transcriptions#DBE samplings}}
+====D box (Samarsky)====
+{{main|D box gene transcriptions#Dbox (Samarsky) samplings}}
+====D box (Voronina)====
+{{main|D box gene transcriptions#D box (Voronina) samplings}}
+====D-box (Motojima)====
+{{main|D box gene transcriptions#(Motojima) samplings}}
+====dBRE====
+{{main|Downstream TFIIB recognition element gene transcriptions#dBRE samplings}}
+====Downstream core elements====
+{{main|Downstream core element gene transcriptions}}
+====DCE SI====
+{{main|Downstream core element gene transcriptions#Downstream core element SI samplings}}
+====DCE SII====
+{{main|Downstream core element gene transcriptions#Downstream core element SII samplings}}
+====DCE SIII====
+{{main|Downstream core element gene transcriptions#Downstream core element SIII samplings}}
+====DPE (Juven-Gershon)====
+{{main|Downstream promoter element gene transcriptions#DPE (Juven-Gershon) samplings}}
+====DPE (Kadonaga)====
+{{main|Downstream promoter element gene transcriptions#DPE (Kadonaga) samplings}}
+====DPE (Matsumoto)====
+{{main|Downstream promoter element gene transcriptions#DPE (Matsumoto) samplings}}
+====EIN3 binding sites====
+{{main|EIN3 binding site gene transcriptions#EIN3 samplings}}
+====Endosperm expressions====
+{{main|Endosperm expression gene transcriptions#Endosperm expression samplings}}
+====Estrogen response elements====
+{{main|Estrogen response element gene transcriptions}}
+=====ERE1s=====
+{{main|Estrogen response element gene transcriptions#ERE1 (Driscoll) samplings}}
+=====ERE2s=====
+{{main|Estrogen response element gene transcriptions#EREs (Driscoll) samplings}}
+====GAAC elements====
+{{main|GAAC element gene transcriptions#GAAC element samplings}}
+====GC boxes (Briggs)====
+{{main|GC box gene transcriptions#GC box (Briggs) samplings}}
+====GC boxes (Ye)====
+{{main|GC box gene transcriptions#GC box (Ye) samplings}}
+====GC boxes (Zhang)====
+{{main|GC box gene transcriptions#GC box (Zhang) samplings}}
+====GCR1s====
+{{main|Gcr1p gene transcriptions#GCR1 samplings}}
+====GREs====
+{{main|Gibberellin responsive element gene transcriptions#GRE samplings}}
+====GT boxes (Sato)====
+{{main|TC element gene transcriptions#GT box (Sato) samplings}}
+====Hex sequences====
+{{main|Hex sequence gene transcriptions#Hex core samplings}}
+====HY boxes====
+{{main|HY box gene transcriptions#HY box samplings}}
+====IFNs====
+{{main|Interferon regulatory factor gene transcriptions#IFN-stimulated response element samplings}}
+====Inr-like, TCTs====
+{{main|Initiator element gene transcriptions#Inr-like, TCTs sampling}}
+====IRF3s====
+{{main|Interferon regulatory factor gene transcriptions#IRF-3 samplings}}
+====IRSs====
+{{main|Interferon regulatory factor gene transcriptions#IRS consensus samplings}}
+====KAR2s====
+{{main|Hac1p gene transcriptions#KAR2 samplings}}
+====MBE1s====
+{{main|Musashi binding element gene transcriptions#MBE1 samplings}}
+====MBE2s====
+{{main|Musashi binding element gene transcriptions#MBE2 samplings}}
+====MBE3s====
+{{main|Musashi binding element gene transcriptions#MBE3 samplings}}
+====NF𝜿BSs====
+{{main|Nuclear factor gene transcriptions#NF𝜿B (Sato) samplings}}
+====PREs====
+{{main|Polycomb response element gene transcriptions#Core samplings}}
+====Pribs====
+{{main|Pribnow box gene transcriptions#Pribnow box samplings}}
+====RAREs====
+{{main|Retinoic acid response element gene transcriptions#RARE samplings}}
+====Rgts====
+{{main|Rgt1p gene transcriptions#RGT samplings}}
+====ROREs====
+{{main|ROR-response element gene transcriptions#RORE samplings}}
+====SERVs====
+{{main|Servenius sequence gene transcriptions#Servenius samplings}}
+====STAT5s====
+{{main|STAT5 gene transcription laboratory#STAT5 samplings}}
+====STREs====
+{{main|Msn2,4p gene transcriptions#Stress-response element samplings}}
+====Sucroses====
+{{main|Sucrose box gene transcriptions#Sucrose box samplings}}
+====TACTs====
+{{main|TACTAAC box gene transcriptions#TACT samplings}}
+====TAGteams====
+{{main|TAGteam gene transcriptions#TAGteam samplings}}
+====TAPs====
+{{main|Tapetum box gene transcriptions#Tapetum box samplings}}
+====TATAs====
+{{main|TATA box gene transcriptions#TATA box samplings}}
+Examining the promoter regions upstream from ZSCAN22 to A1BG and downstream from ZNF497 to A1BG for TATA boxes has shown that TATA boxes in various forms are present and likely active or activable: (1) TATAAAA (Carninci 2006), (2) TATA(A/T)A(A/T) (Watson 2014), (3) TATA(A/T)AA(A/G) (Juven-Gershon 2010), and (4) TATA(A/T)A(A/T)(A/G) (Basehoar 2004).
+The TATA boxes have the pattern of appearing in only the negative direction UTRs, proximal and distals. The shorter TATA box: TATAAA does appear as above but also in the positive direction as the complement inverse TTTATA at 2588 in the distal promoter.
+====TATABs====
+{{main|TATA box gene transcriptions#TATA box (Butler 2002) samplings}}
+====TATACs====
+{{main|TATA box gene transcriptions#TATA boxes (Carninci 2006) samplings}}
+====TATAJs====
+{{main|TATA box gene transcriptions#TATA box (Juven-Gershon 2010) samplings}}
+====TATAWs====
+{{main|TATA box gene transcriptions#TATA box (Watson 2014) samplings}}
+====TEAs====
+{{main|TEA consensus sequence gene transcriptions#TEA samplings}}
+====TECs====
+{{main|Tec1p gene transcriptions#Tec1 samplings}}
+====THRs====
+{{main|Thyroid hormone response element gene transcriptions#THR samplings}}
+====TRFs====
+{{main|Telomeric repeat DNA-binding factor gene transcriptions#TRF samplings}}
+====UPREs====
+{{main|Unfolded protein response element gene transcriptions#UPRE samplings}}
+====UPRE-1s====
+{{main|Hac1p gene transcriptions#UPRE-1 samplings}}
+====URS (Sumrada, core)====
+{{main|DNA damage response element gene transcriptions#URS1 (Sumrada, core) samplings}}
+====VDREs====
+{{main|Vitamin D response element gene transcriptions#VDRE samplings}}
+====XCPE1s====
+{{main|X core promoter element gene transcriptions#XCPE1 samplings}}
+====Yaps====
+{{main|Yap1p,2p gene transcriptions#Yap samplings}}
+====YYRNWYY Inrs====
+{{main|Initiator element gene transcriptions#YYRNWYY samplings}}
+==A1BG orthologs==
+===''Geotrypetes seraphini''===
+[[Image:Geotrypetes seraphini 81151944.jpg|thumb|right|250px|''Geotrypetes seraphini'', the Gaboon caecilian, is a species of amphibian. Credit: [https://www.inaturalist.org/users/7865 Marius Burger].{{tlx|free media}}]]
+''Geotrypetes seraphini'', the Gaboon caecilian, is a species of amphibian in the family ''Dermophiidae''.<ref name=IUCN>{{cite journal |author=IUCN SSC Amphibian Specialist Group |date=2019 |title=''Geotrypetes seraphini'' |volume=2019 |page=e.T59557A16957715 |url=https://en.wikipedia.org/wiki/IUCN_Red_List
+|doi=10.2305/IUCN.UK.2019-1.RLTS.T59557A16957715.en |accessdate=16 November 2021}}</ref>
+Its A1BG ortholog has 368 aa vs 495 aa for ''Homo sapiens''.
+{{clear}}
 ==ZSCAN22==
 {{main|ZSCAN22}}
 # Gene ID: 342945 is ZSCAN22 zinc finger and SCAN domain containing 22 on 19q13.43.<ref name=HGNC342945>{{ cite web
-|vauthors=HGNC
+|author=HGNC
 |title=ZSCAN22 zinc finger and SCAN domain containing 22 [ Homo sapiens (human) ]
 |publisher=National Center for Biotechnology Information
@@ Line 45: / Line 1,097: @@
 |accessdate=2019-12-18 }}</ref> ZSCAN22 is transcribed in the negative direction from LOC100887072.<ref name=HGNC342945/>
 # Gene ID: 102465484 is MIR6806 microRNA 6806 on 19q13.43: "microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop."<ref name=RefSeq102465484>{{ cite web
-|vauthors=RefSeq
+|author=RefSeq
 |title=MIR6806 microRNA 6806 [ Homo sapiens (human) ]
 |publisher=National Center for Biotechnology Information
@@ Line 54: / Line 1,106: @@
 Of the some 111 gaps between genes on chromosome locus 19q13.43 as of 4 August 2020, gap number 88 is between ZSCAN22 and A1BG. But, there is no gap between ZNF497 and A1BG.
+==Promoters==
+The core promoter begins approximately -35 nts upstream from the transcription start site (TSS). For the numbered nucleotides between ZSCAN22 and A1BG the core promoter extends from 4425 nts up to 4460 nts (TSS). The proximal promoter extends from approximately -250 to the TSS or 4210 nts up to 4460 nts. The distal promoter begins at about 2460 nts and extends to about 4210 nts.
+From the ZNF497 side the core promoter begins about 4265 nts up to 4300 nts, the proximal promoter from 4050 nts to 4265 nts, and the distal promoter from 2300 nts to 4050 nts.
 ==Alpha-1-B glycoprotein==
 {{main|Alpha-1-B glycoprotein}}
 '''Def.''' "a substance that induces an immune response, usually foreign"<ref name=AntigenWikt>{{ cite web
-|vauthors=[[wikt:User:Jag123|Jag123]]
+|author=[[wikt:User:Jag123|Jag123]]
 |title=antigen
 |publisher=Wikimedia Foundation, Inc
@@ Line 67: / Line 1,125: @@
 '''Def.''' any "substance that elicits [an] immune response"<ref name=ImmunogenWikt>{{ cite web
-|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
+|author=[[wikt:User:SemperBlotto|SemperBlotto]]
 |title=immunogen
 |publisher=Wikimedia Foundation, Inc
@@ Line 85: / Line 1,143: @@
 '''Def.''' "a protein produced by B-lymphocytes that binds to [a specific antigen or]<ref name=AntibodyWikt1>{{ cite web
-|vauthors=[[wikt:User:Williamsayers79|Williamsayers79]]
+|author=[[wikt:User:Williamsayers79|Williamsayers79]]
 |title=antibody
 |publisher=Wikimedia Foundation, Inc
@@ Line 92: / Line 1,150: @@
 |url=https://en.wiktionary.org/wiki/antibody
 |accessdate=7 March 2020 }}</ref> an antigen"<ref name=AntibodyWikt>{{ cite web
-|vauthors=[[wikt:User:Jag123|Jag123]]
+|author=[[wikt:User:Jag123|Jag123]]
 |title=antibody
 |publisher=Wikimedia Foundation, Inc
@@ Line 114: / Line 1,172: @@
 '''Def.''' "any of the glycoproteins in blood serum that respond to invasion by foreign antigens and that protect the host by removing pathogens;"<ref name=ImmunoglobulinWikt>{{ cite web
-|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
+|author=[[wikt:User:SemperBlotto|SemperBlotto]]
 |title= immunoglobulin
 |publisher=Wikimedia Foundation, Inc
@@ Line 121: / Line 1,179: @@
 |url=https://en.wiktionary.org/wiki/immunoglobulin
 |accessdate=7 March 2020 }}</ref> "an antibody"<ref name=ImmunoglobulinWikt1>{{ cite web
-|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
+|author=[[wikt:User:SemperBlotto|SemperBlotto]]
 |title= immunoglobulin
 |publisher=Wikimedia Foundation, Inc
@@ Line 130: / Line 1,188: @@
 Gene ID: 1 is A1BG [[alpha-1-B glycoprotein]] on 19q13.43, a 54.3 kDa [[protein]] in humans that is encoded by the A1BG [[gene]].<ref name=RefSeq1>{{ cite web
-|vauthors=RefSeq
+|author=RefSeq
 |title=A1BG alpha-1-B glycoprotein [ Homo sapiens (human) ]
 |publisher=National Center for Biotechnology Information
@@ Line 200: / Line 1,258: @@
 "Immunoglobulin (Ig) domain ['''cl11960'''] found in the Ig superfamily. The Ig superfamily is a heterogenous group of proteins, built on a common fold comprised of a sandwich of two beta sheets. Members of this group are components of immunoglobulin, neuroglia, cell surface glycoproteins, such as, T-cell receptors, CD2, CD4, CD8, and membrane glycoproteins, such as, butyrophilin and chondroitin sulfate proteoglycan core protein. A predominant feature of most Ig domains is a disulfide bridge connecting the two beta-sheets with a tryptophan residue packed against the disulfide bond."<ref name=NCBI386229>{{ cite web
-|vauthors=NCBI
+|author=NCBI
 |title=Conserved Protein Domain Family cl11960: Ig Superfamily
 |publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
@@ Line 209: / Line 1,267: @@
 "This domain ['''pfam13895'''] contains immunoglobulin-like domains."<ref name=NCBI372793>{{ cite web
-|vauthors=NCBI
+|author=NCBI
 |title=Conserved Protein Domain Family pfam13895: Ig_2
 |publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
@@ Line 218: / Line 1,276: @@
 "Ig1_LILR_KIR_like: ['''cd05751'''] domain similar to the first immunoglobulin (Ig)-like domain found in Leukocyte Ig-like receptors (LILRs) and Natural killer inhibitory receptors (KIRs). This group includes LILRB1 (or LIR-1), LILRA5 (or LIR9), an activating natural cytotoxicity receptor NKp46, the immune-type receptor glycoprotein VI (GPVI), and the IgA-specific receptor Fc-alphaRI (or CD89). LILRs are a family of immunoreceptors expressed on expressed on T and B cells, on monocytes, dendritic cells, and subgroups of natural killer (NK) cells. The human LILR family contains nine proteins (LILRA1-3,and 5, and LILRB1-5). From functional assays, and as the cytoplasmic domains of various LILRs, for example LILRB1 (LIR-1), LILRB2 (LIR-2), and LILRB3 (LIR-3) contain immunoreceptor tyrosine-based inhibitory motifs (ITIMs) it is thought that LIR proteins are inhibitory receptors. Of the eight LIR family proteins, only LIR-1 (LILRB1), and LIR-2 (LILRB2), show detectable binding to class I MHC molecules; ligands for the other members have yet to be determined. The extracellular portions of the different LIR proteins contain different numbers of Ig-like domains for example, four in the case of LILRB1 (LIR-1), and LILRB2 (LIR-2), and two in the case of LILRB4 (LIR-5). The activating natural cytotoxicity receptor NKp46 is expressed in natural killer cells, and is organized as an extracellular portion having two Ig-like extracellular domains, a transmembrane domain, and a small cytoplasmic portion. GPVI, which also contains two Ig-like domains, participates in the processes of collagen-mediated platelet activation and arterial thrombus formation. Fc-alphaRI is expressed on monocytes, eosinophils, neutrophils and macrophages; it mediates IgA-induced immune effector responses such as phagocytosis, antibody-dependent cell-mediated cytotoxicity and respiratory burst."<ref name=NCBI319306>{{ cite web
-|vauthors=NCBI
+|author=NCBI
 |title=Conserved Protein Domain Family cd05751: Ig1_LILR_KIR_like
 |publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
@@ Line 227: / Line 1,285: @@
 "IG domains ['''smart00410'''] that cannot be classified into one of IGv1, IGc1, IGc2, IG."<ref name=NCBI214653>{{ cite web
-|vauthors=NCBI
+|author=NCBI
 |title=Conserved Protein Domain Family smart00410: IG_like
 |publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
@@ Line 253: / Line 1,311: @@
 '''Def.''' a "group of plants or animals having similar appearance"<ref name=SpeciesWikt>{{ cite web
-|vauthors=[[wikt:User:24.98.118.180|24.98.118.180]]
+|author=[[wikt:User:24.98.118.180|24.98.118.180]]
 |title=species
 |publisher=Wikimedia Foundation, Inc
@@ Line 283: / Line 1,341: @@
 '''Def.''' a "different sequence of a gene (locus)"<ref name=VariantWikt>{{ cite web
-|vauthors=[[wikt:User:Pdeitiker|Pdeitiker]]
+|author=[[wikt:User:Pdeitiker|Pdeitiker]]
 |title=variant
 |publisher=Wikimedia Foundation, Inc
@@ Line 292: / Line 1,350: @@
 '''Def.''' any "of several different forms of the same protein, arising from either single nucleotide polymorphisms,<ref name=IsoformWikt1>{{ cite web
-|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
+|author=[[wikt:User:SemperBlotto|SemperBlotto]]
 |title=isoform
 |publisher=Wikimedia Foundation, Inc
@@ Line 299: / Line 1,357: @@
 |url=https://en.wiktionary.org/wiki/isoform
 |accessdate=2 December 2018 }}</ref> differential splicing of mRNA, or post-translational modifications (e.g. sulfation, glycosylation, etc.)"<ref name=IsoformWikt2>{{ cite web
-|vauthors=[[wikt:User:72.178.245.181|72.178.245.181]]
+|author=[[wikt:User:72.178.245.181|72.178.245.181]]
 |title=isoform
 |publisher=Wikimedia Foundation, Inc
@@ Line 343: / Line 1,401: @@
 '''Def.''' the "part (DNA sequence) of the genetic makeup of an organism which determines a specific characteristic (phenotype) of that organism"<ref name=GenotypeWikt1>{{ cite web
-|vauthors=[[wikt:User:DTLHS|DTLHS]]
+|author=[[wikt:User:DTLHS|DTLHS]]
 |title=genotype
 |publisher=Wikimedia Foundation, Inc
@@ Line 350: / Line 1,408: @@
 |url=https://en.wiktionary.org/wiki/genotype
 |accessdate=25 March 2020 }}</ref> or a "group of organisms having the same genetic constitution" <ref name=GenotypeWikt>{{ cite web
-|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
+|author=[[wikt:User:SemperBlotto|SemperBlotto]]
 |title=genotype
 |publisher=Wikimedia Foundation, Inc
@@ Line 380: / Line 1,438: @@
 '''Def.''' the "regular existence of two or more different genotypes within a given species or population; also, variability of amino acid sequences within a gene's protein"<ref name=PolymorphismWikt>{{ cite web
-|vauthors=[[wikt:User:Widsith|Widsith]]
+|author=[[wikt:User:Widsith|Widsith]]
 |title=polymorphism
 |publisher=Wikimedia Foundation, Inc
@@ Line 389: / Line 1,447: @@
 '''Def.''' "one of a number of alternative forms of the same gene occupying a given position, [or locus],<ref name=AlleleWikt1>{{ cite web
-|vauthors=[[wikt:User:217.105.66.98|217.105.66.98]]
+|author=[[wikt:User:217.105.66.98|217.105.66.98]]
 |title=allele
 |publisher=Wikimedia Foundation, Inc
@@ Line 396: / Line 1,454: @@
 |url=https://en.wiktionary.org/wiki/allele
 |accessdate=25 March 2020 }}</ref> on a chromosome"<ref name=AlleleWikt>{{ cite web
-|vauthors=[[wikt:User:138.130.33.215|138.130.33.215]]
+|author=[[wikt:User:138.130.33.215|138.130.33.215]]
 |title=allele
 |publisher=Wikimedia Foundation, Inc
@@ Line 456: / Line 1,514: @@
 '''Def.''' the "appearance of an organism based on a single trait [multifactorial combination of genetic traits and environmental factors]<ref name=PhenotypeWikt2>{{ cite web
-|vauthors=[[wikt:User:24.235.196.118|24.235.196.118]]
+|author=[[wikt:User:24.235.196.118|24.235.196.118]]
 |title=phenotype
 |publisher=Wikimedia Foundation, Inc
@@ Line 463: / Line 1,521: @@
 |url=https://en.wiktionary.org/wiki/phenotype
 |accessdate=2016-10-04 }}</ref>, especially used in pedigrees"<ref name=PhenotypeWikt1>{{ cite web
-|vauthors=[[wikt:User:SemperBlotto|SemperBlotto]]
+|author=[[wikt:User:SemperBlotto|SemperBlotto]]
 |title=phenotype
 |publisher=Wikimedia Foundation, Inc
@@ Line 470: / Line 1,528: @@
 |url=https://en.wiktionary.org/wiki/phenotype
 |accessdate=2016-10-04 }}</ref> or any "observable characteristic of an organism, such as its morphological, developmental, biochemical or physiological properties, or its behavior"<ref name=PhenotypeWikt>{{ cite web
-|vauthors=[[wikt:User:N2e|N2e]]
+|author=[[wikt:User:N2e|N2e]]
 |title=phenotype
 |publisher=Wikimedia Foundation, Inc
@@ Line 502: / Line 1,560: @@
 The human cysteine-rich secretory protein (CRISP3) "is present in exocrine secretions and in secretory granules of neutrophilic granulocytes and is believed to play a role in innate immunity."<ref name=Udby>{{ cite journal
-|vauthors=Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L.
+|author=Udby L, Sørensen OE, Pass J, Johnsen AH, Behrendt N, Borregaard N, Kjeldsen L.
 |title=Cysteine-rich secretory protein 3 is a ligand of alpha1B-glycoprotein in human plasma
 |journal=Biochemistry
@@ Line 538: / Line 1,596: @@
 |accessdate=2012-02-20 }}</ref> "CRISP3 is highly expressed in the human cauda epididymidis and ampulla of vas deferens (Udby et al. 2005)."<ref name=Haendler/>
-==ZNF497==
+==A1BG-AS1==
-{{main|ZNF497}}
 Gene ID: 503538 is [[A1BG-AS1]] A1BG antisense RNA 1.<ref name=HGNC503538>{{ cite web
-|vauthors=HGNC
+|author=HGNC
 |title=A1BG-AS1 A1BG antisense RNA 1 [ Homo sapiens (human) ]
 |publisher=National Center for Biotechnology Information
@@ Line 548: / Line 1,606: @@
 |url=https://www.ncbi.nlm.nih.gov/gene/503538
 |accessdate=2019-12-18 }}</ref> A1BG-AS1 is transcribed in the negative direction from ZSCAN22.<ref name=HGNC503538/>
+Gene ID 503538 extends from 58,351,390 to 58,355,183. It is a long, non-coding (lnc) RNA.<ref name=Bai>{{ cite journal
+|author=Jigang Bai, Bowen Yao, Liang Wang, Liankang Sun, Tianxiang Chen, Runkun Liu, Guozhi Yin, Qiuran Xu, Wei Yang
+|title=lncRNA A1BG-AS1 suppresses proliferation and invasion of hepatocellular carcinoma cells by targeting miR-216a-5p
+|journal=
+|date=June 2019
+|volume=120
+|issue=6
+|pages=10310-10322
+|url=https://pubmed.ncbi.nlm.nih.gov/30556161/
+|arxiv=
+|bibcode=
+|doi=10.1002/jcb.28315
+|pmid=30556161
+|accessdate=16 May 2023 }}</ref> Extensive evidence indicates that long noncoding RNAs (lncRNAs) regulate the tumorigenesis and progression of hepatocellular carcinoma (HCC).<ref name=Bai/>
+The underexpression of A1BG-AS1 was found in HCC via analysis of The Cancer Genome Atlas database.<ref name=Bai/> A1BG-AS1 expression in HCC was markedly lower than that in noncancerous tissues.<ref name=Bai/>
+==ZNF497==
+{{main|ZNF497}}
 Gene ID: 162968 is [[ZNF497]] zinc finger protein 497.<ref name=HGNC162968>{{ cite web
-|vauthors=HGNC
+|author=HGNC
 |title=ZNF497 zinc finger protein 497 [ Homo sapiens (human) ]
 |publisher=National Center for Biotechnology Information
@@ Line 561: / Line 1,639: @@
 Gene ID: 100419840 is LOC100419840 zinc finger protein 446 pseudogene.<ref name=HGNC100419840>{{ cite web
-|vauthors=HGNC
+|author=HGNC
 |title=LOC100419840 zinc finger protein 446 pseudogene [ Homo sapiens (human) ]
 |publisher=National Center for Biotechnology Information
@@ Line 570: / Line 1,648: @@
 Gene ID: 105372483 is LOC105372483 uncharacterized LOC105372483 ncRNA.<ref name=HGNC105372483>{{ cite web
-|vauthors=HGNC
+|author=HGNC
 |title=LOC105372483 uncharacterized LOC105372483 [ Homo sapiens (human) ]
 |publisher=National Center for Biotechnology Information
@@ Line 579: / Line 1,657: @@
 Gene ID: 106479017 is RNA5SP473 RNA, 5S ribosomal pseudogene 473.<ref name=HGNC106479017>{{ cite web
-|vauthors=HGNC
+|author=HGNC
 |title=RNA5SP473 RNA, 5S ribosomal pseudogene 473 [ Homo sapiens (human) ]
 |publisher=National Center for Biotechnology Information
@@ Line 587: / Line 1,665: @@
 |accessdate=2019-12-18 }}</ref> RNA5SP473 may be transcribed in the negative direction from ZNF497.<ref name=HGNC106479017/>
-==19q13.43==
+==GC contents==
-{{main|Genes on 19q13.43}}
-==Regulatory elements and regions==
-It may be still fair to say that in the apparent present era of functional genomics, the challenge is to elucidate gene function such as that of A1BG, its likely regulatory networks and signaling pathways.<ref name=Collins>{{ cite journal
-|author=Francis S Collins, Eric D Green, Alan E Guttmacher, Mark S Guyer
-|title=A vision for the future of genomics research
-|journal=Nature
-|date=24 April 2003
-|volume=422
-|issue=6934
-|pages=835-47
-|url=https://www.ncbi.nlm.nih.gov/pubmed/12695777
-|arxiv=
-|bibcode=
-|doi=10.1038/nature01626
-|pmid=12695777
-|accessdate=9 August 2020 }}</ref> "Since regulation of gene expression ''in vivo'' mainly occurs at the transcriptional level, identifying the location of genetic regulatory elements is a key to understanding the machinery regulating gene transcription. A major goal of current genome research is to identify the locations of all gene regulatory elements, including promoters, enhancers, silencers, insulators and boundary elements, and to analyze their relationship to the current annotation of human genes."<ref name=ENCODE>{{ cite journal
-|author=The ENCODE Project Consortium
-|title=The ENCODE (ENCyclopedia of DNA Elements) Project
-|journal=Science
-|date=22 October 2004
-|volume=306
-|issue=5696
-|pages=636-640
-|url=https://www.ncbi.nlm.nih.gov/pubmed/15499007
-|arxiv=
-|bibcode=
-|doi=10.1126/science.1105136
-|pmid=15499007
-|accessdate=9 August 2020 }}</ref><ref name=ENCODE1>{{ cite journal
-|author=The ENCODE Project Consortium
-|title=Identification and analysis of functional elements in 1% of the human genome by the ENCODE pilot project
-|journal=Nature
-|date=14 June 2007
-|volume=447
-|issue=7146
-|pages=799-816
-|url=https://www.ncbi.nlm.nih.gov/pubmed/17571346
-|arxiv=
-|bibcode=
-|doi=10.1038/nature05874
-|pmid=17571346
-|accessdate=9 August 2020 }}</ref> Although "many genome-wide strategies have been developed for identifying functional elements", "no method yet has the resolution to precisely identify all regulatory elements or can be readily applied to the entire human genome."<ref name=Wang>{{ cite journal
-|author=Ya-Mei Wang, Ping Zhou, Li-Yong Wang, Zhen-Hua Li, Yao-Nan Zhang, and Yu-Xiang Zhang
-|title=Correlation Between DNase I Hypersensitive Site Distribution and Gene Expression in HeLa S3 Cells
-|journal=PLoS One
-|date=10 August 2012
-|volume=7
-|issue=8
-|pages=e2414
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3416863/#pone.0042414-The1
-|arxiv=
-|bibcode=
-|doi=10.1371/journal.pone.0042414
-|pmid=22900019
-|accessdate=9 August 2020 }}</ref>
-There is one CRISPRi-validated cis-regulatory element on 19q13.43: Gene ID: 116286197 LOC116286197. And, four Sharpr-MPRA regulatory regions: (1) Gene ID: 112553117 LOC112553117 Sharpr-MPRA regulatory region 1998, Gene ID: 112553119 LOC112553119 Sharpr-MPRA regulatory region 10473, Gene ID: 112577453 LOC112577453 Sharpr-MPRA regulatory region 7872, and Gene ID: 112577454 is Sharpr-MPRA regulatory region 9894.
-'''Def.''' nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"<ref name=MeSHD020218>{{ cite web
+Approximately "76% of human core promoters lack TATA-like elements, have a high GC content, and are enriched in Sp1 binding sites."<ref name=Yang2>{{ cite journal
-|author=MeSH
+|author=Chuhu Yang, Eugene Bolotin, Tao Jiang, Frances M. Sladek, Ernest Martinez.
-|title=Response Elements
+|title=Prevalence of the initiator over the TATA box in human and yeast genes and identification of DNA motifs enriched in human TATA-less core promoters
-|publisher=National Institutes of Health, Health & Human Services
+|journal=Gene
-|location=U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894
+|month=March 7,
-|date=8 July 2008
+|year=2007
-|url=https://meshb.nlm.nih.gov/record/ui?name=response%20element
+|volume=389
-|accessdate=2 September 2020 }}</ref> are called '''response elements'''.
-===DNase I hypersensitive sites===
-"This genomic region represents a DNase I hypersensitive site (DHS) that was predicted to be an enhancer by the ENCODE (ENCyclopedia Of DNA Elements) project based on various combinations of H3K27 acetylation and binding of p300, GATA1 and RNA polymerase II in K562 erythroleukemia cells. It was validated as a high-confidence cis-regulatory element for the ZNF582 (zinc finger protein 582) gene on chromosome 19 based on multiplex CRISPR/Cas9-mediated perturbation in K562 cells."<ref name=RefSeq116286197>{{ cite web
-|vauthors=RefSeq
-|title=LOC116286197 CRISPRi-validated cis-regulatory element chr19.6329 [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=November 2019
-|url=https://www.ncbi.nlm.nih.gov/gene/116286197
-|accessdate=25 July 2020 }}</ref>
-Gene ID: 116286197 CRISPRi-validated cis-regulatory element chr19.6329 is at NC_000019.10 (56186901..56187499).<ref name=RefSeq116286197/>
-Gene ID: 147948 ZNF582 is at NC_000019.10 (56382751..56393585, complement).<ref name=RefSeq147948>{{ cite web
-|vauthors=RefSeq
-|title=ZNF582 zinc finger protein 582 [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=February 2016
-|url=https://www.ncbi.nlm.nih.gov/gene/147948
-|accessdate=28 May 2020 }}</ref> The CRISPRi-validated cis-regulatory element chr19.6329 is (56382751 - 56186901) = 195850 nts from the beginning of ZNF582.
-===Transcriptional regulatory regions===
-"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region), with weaker activation in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 1:Tss)."<ref name=RefSeq112553117>{{ cite web
-|vauthors=RefSeq
-|title=LOC112553117 Sharpr-MPRA regulatory region 1998 [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=June 2018
-|url=https://www.ncbi.nlm.nih.gov/gene/112553117
-|accessdate=25 July 2020 }}</ref>
-"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 5:Enh, candidate strong enhancer, open chromatin). It also displayed weak repressive activity by Sharpr-MPRA in K562 erythroleukemia cells (group: K562 Repressive non-DNase unmatched - State 24:Quies, heterochromatin/dead zone)."<ref name=RefSeq112553119>{{ cite web
-|vauthors=RefSeq
-|title=Sharpr-MPRA regulatory region 10473 [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=June 2018
-|url=https://www.ncbi.nlm.nih.gov/gene/112553119
-|accessdate=16 July 2020 }}</ref>
-"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in both HepG2 liver carcinoma cells (group: HepG2 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region) and K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss)."<ref name=RefSeq112577453>{{ cite web
-|vauthors=RefSeq
-|title=Sharpr-MPRA regulatory region 7872 [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=June 2018
-|url=https://www.ncbi.nlm.nih.gov/gene/112577453
-|accessdate=1 August 2020 }}</ref>
-"This genomic sequence was predicted to be a transcriptional regulatory region based on chromatin state analysis from the ENCODE (ENCyclopedia Of DNA Elements) project. It was validated as a functional enhancer by the Sharpr-MPRA technique (Systematic high-resolution activation and repression profiling with reporter tiling using massively parallel reporter assays) in K562 erythroleukemia cells (group: K562 Activating DNase unmatched - State 1:Tss, active promoter, TSS/CpG island region), with weaker activation in HepG2 liver carcinoma cells (group: HepG2 Activating DNase matched - State 1:Tss)."<ref name=RefSeq112577454>{{ cite web
-|vauthors=RefSeq
-|title=Sharpr-MPRA regulatory region 9894 [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=June 2018
-|url=https://www.ncbi.nlm.nih.gov/gene/112577454
-|accessdate=16 July 2020 }}</ref>
-"The growth hormone-regulated transcription factors STAT5 and BCL6 coordinately regulate sex differences in mouse liver, primarily through effects in male liver, where male-biased genes are upregulated and many female-biased genes are actively repressed."<ref name=Conforto>{{ cite journal
-|author=Tara L. Conforto, Yijing Zhang, Jennifer Sherman, and David J. Waxman
-|title=Impact of CUX2 on the Female Mouse Liver Transcriptome: Activation of Female-Biased Genes and Repression of Male-Biased Genes
-|journal=Molecular and Cellular Biology
-|date=November 2012
-|volume=32
-|issue=22
-|pages=4611–4627
-|url=https://mcb.asm.org/content/mcb/32/22/4611.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1128/MCB.00886-12
-|pmid=22966202
-|accessdate=8 August 2020 }}</ref> "CUX2, a highly female-specific liver transcription factor, contributes to an analogous regulatory network in female liver. Adenoviral overexpression of CUX2 in male liver induced 36% of female-biased genes and repressed 35% of male-biased genes. In female liver, CUX2 small interfering RNA (siRNA) preferentially induced genes repressed by adenovirus expressing CUX2 (adeno-CUX2) in male liver, and it preferentially repressed genes induced by adeno-CUX2 in male liver. CUX2 binding in female liver chromatin was enriched at sites of male-biased DNase hypersensitivity and at genomic regions showing male-enriched STAT5 binding. CUX2 binding was also enriched near genes repressed by adeno-CUX2 in male liver or induced by CUX2 siRNA in female liver but not at genes induced by adeno-CUX2, indicating that CUX2 binding is preferentially associated with gene repression. Nevertheless, direct CUX2 binding was seen at several highly female-specific genes that were positively regulated by CUX2, including A1bg [A1BG in humans], Cyp2b9, Cyp3a44, Tox [TOX in humans], and Trim24 [TRIM24 in humans]."<ref name=Conforto/>
-==ABA-response elements==
-"The key ''cis''-elements in [non-yellow coloring 1] ''NYC1'' promoter, namely, ABA-response element (ABRE) (ACGTG), ACGT, GCCcore (GCCGCC), and ''ethylene-inducible 3'' [EIN3-Like1] ''(EIN3)/EIL1''-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]), can be targeted by ''ABA insensitive 3 (ABI3), ABI5,'' and ''ABF''2, 3, 4 in the ABA-signaling pathway [60,61]. GCCGCC and ''EIN3/EIL1''-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]) are induced by ethylene-inducible TF and EIN3/EIL1 in the ethylene signaling pathway [61]. Therefore, ABA signaling is crucial for [chlorophyll] Chl ''b'' reductase activities to catalyze the Chl degradation, the first part of leaf senescence."<ref name=Asad>{{ cite journal
-|author=Muhammad Asad Ullah Asad, Shamsu Ado Zakari, Qian Zhao, Lujian Zhou, Yu Ye and Fangmin Cheng
-|title=Abiotic Stresses Intervene with ABA Signaling to Induce Destructive Metabolic Pathways Leading to Death: Premature Leaf Senescence in Plants
-|journal=International Journal of Molecular Sciences
-|date=10 January 2019
-|volume=20
-|issue=2
-|pages=256-278
-|url=https://www.mdpi.com/1422-0067/20/2/256/pdf
-|arxiv=
-|bibcode=
-|doi=10.3390/ijms20020256
-|pmid=30634648
-|accessdate=27 August 2020 }}</ref>
-==Abf1 regulatory factors==
-Specific "sequences considered as exact Abf1 motif occurrences": CGTNNNNNACGA(C/T), CGTNNNNNA(C/T)GAC, CGTNNNNNA(C/T)GA(C/T), CGTNNNNN(A/G)(C/T)GA(C/T).<ref name=Rossi/>
-Copying a consensus Abf1 regulatory factor: 3'-CGTNNNNNACGAT-5' and putting the sequence in "⌘F" locates 2 to 5 of this sequence in the ZSCAN22 to A1BG direction, and none between ZNF497 and A1BG as can be found by the computer programs.
-==A boxes==
-{{main|A box gene transcriptions}}
-Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] TACGTA (A box) [...].<ref name=Landschulz/><ref name=Zhang2014/><ref name=Nijhawan/>
-"The human TGF-β1 promoter region contains two binding sequences for AP-1, designated AP-1 box A (TGACTCT) and box B (TGTCTCA), which mediate the up-regulation of promoter activity after [High glucose] HG stimulation."<ref name=Kokoroishi>{{ cite journal
-|author=Keiko Kokoroishi, Ayumu Nakashima, Shigehiro Doi, Toshinori Ueno, Toshiki Doi, Yukio Yokoyama, Kiyomasa Honda, Masami Kanawa, Yukio Kato, Nobuoki Kohno & Takao Masaki
-|title=High glucose promotes TGF-β1 production by inducing FOS expression in human peritoneal mesothelial cells
-|journal=Clinical and Experimental Nephrology
-|date=28 May 2015
-|volume=20
-|issue=1
-|pages=30-8
-|url=https://link.springer.com/article/10.1007/s10157-015-1128-9
-|arxiv=
-|bibcode=
-|doi=10.1007/s10157-015-1128-9
-|pmid=26018137
-|accessdate=14 August 2020 }}</ref>
-There is one A box on the positive strand in the negative direction (from ZSCAN22 to A1BG): 3'-TGACTCT-5' at 2788.
-There is one A box complement on the negative strand in the negative direction: 3'-ACTGAGA-5' at 2788.
-There is one A box inverse complement on the negative strand in the positive direction: 3'-AGAGTCA-5' at 2613.
-There is one A box inverse on the positive strand in the positive direction: 3'-TCTCAGT-5' at 2613.
-==Abscisic acid-responsive elements==
-Abscisic acid-responsive elements (CACGTG).<ref name=Sharma/>
-==ACA boxes==
-{{main|H and ACA box gene transcriptions}}
-The "3' end of mature hTR (45) has an ACA trinucleotide 3 nt upstream of its 3' end. In addition, the 3' region of hTR contains a single H box consensus sequence (5'-AGAGGA-3')."<ref name=Mitchell>{{ cite journal
-|author=James R. Mitchell, Jeffrey Cheng, ang Kathleen Collins
-|title=A Box H/ACA Small Nucleolar RNA-Like Domain at the Human Telomerase RNA 3' End
-|journal=Molecular and Cellular Biology
-|date=January 1999
-|volume=19
 |issue=1
-|pages=567–576
+|pages=52-65
-|url=http://mcb.asm.org/content/19/1/567.full.pdf
+|pmid=17123746
-|arxiv=
+|doi=10.1016/j.gene.2006.09.029
-|bibcode=
+|url=http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1955227/?tool=pubmed }}</ref>
-|doi=10.1128/mcb.19.1.567
-|pmid=9858580
-|accessdate=5 November 2018 }}</ref>
-==ACGT-containing elements==
-{{main|ACGT-containing element gene transcriptions}}
-{{main|MYB recognition element gene transcriptions}}
-The consensus sequence for the ACGT-containing elements (ACEs) is 5'-CACGT-3'.<ref name=Hartmann/>
+CpG islands typically occur at or near the transcription start site of genes, particularly housekeeping genes, in vertebrates.<ref name="Saxonov2006">{{ cite journal
+|author=Saxonov S, Berg P, Brutlag DL
-# ACGT elements, negative strand, negative direction: 24 between 150 and 4338 nts.
+|title=A genome-wide analysis of CpG dinucleotides in the human genome distinguishes two distinct classes of promoters
-# ACGT elements, negative strand, positive direction: 2, 3'-ACGT-5' at 569, 3'-ACGT-5' at 3254.
+|journal=Proc Natl Acad Sci USA
-# ACGT elements, positive strand, negative direction: 4, 3'-ACGT-5' at 342, 3'-ACGT-5' at 531, 3'-ACGT-5' at 1772, 3'-ACGT-5' at 4236.
+|volume=103
-# ACGT elements, positive strand, positive direction: 44 between 192 and 4341 nts.
-ACGT-containing elements include these metal responsive elements:
-# complement, negative strand, negative direction: 6 between 1348 and 4341 nts.
-# complement, positive strand, negative direction: 6 between 549 and 3323 nts.
-# inverse, negative strand, negative direction: 2, 3'-CTCACGT-5' at 1470, 3'-CACACGT-5' at 2863.
-# inverse, positive strand, negative direction: 2, 3'-CACACGT-5' at 531, 3'-CTCACGT-5' at 1772.
-# inverse, positive strand, positive direction: 6 between 546 and 3883 nts.
-ACGT-containing elements include these cAMP response elements (CRE):
-# negative strand in the negative direction (from ZSCAN22 to A1BG): 1, 3'-TGACGTCA-5' at 4317.
-==Activating protein 2==
-Consensus sequences for the Activating protein 2 (AP-2) are TCTTCCC, CTCCCA and GGCCAA.<ref name=Yao/>
-Consensus sequences for the Activating protein 2 (AP-2) are GCCTGGCC and TCCCCCGCCC.<ref name=Cohen>{{ cite journal
-|author=Isabelle R. Cohen, Susanne Grässel, Alan D. Murdoch, and Renat V. Iozzo
-|title=Structural characterization of the complete human perlecan gene and its promoter
-|journal=Proceedings of the National Academy of Sciences USA
-|date=1 November 1993
-|volume=90
-|issue=21
-|pages=10404-10408
-|url=https://www.pnas.org/content/pnas/90/21/10404.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1073/pnas.90.21.10404
-|pmid=8234307
-|accessdate=6 September 2020 }}</ref>
-==Activating transcription factors==
-"ATF4 regulates transcription of its target genes through the formation of homodimers or heterooligomers with the transcription factors Jun, AP-1 and C/EBP<sup>38,39</sup> that bind to CARE (C/EBP-ATF) responsive elements having the consensus sequence XTTXCATCA (where X = G, A or T).<sup>39</sup> In the region from -625 to -618 bp relative to the ''SESN2'' translation start codon (from -228 to -221 bp relative to the transcription start site) we found a candidate sequence for the ATF4 binding site TTTTCATCA."<ref name=Garaeva/>
-"The ATF4 binding consensus sequence has been reported as (G/A/C)TT(G/A/T)C(G/A)TCA (38), which matches the ChIP-seq data."<ref name=Burton/>
-==Aft1ps==
-The upstream activating sequence (UAS) for Aft1p is 5'-PyPuCACCCPu-3' or 5'-(C/T)(A/G)CACCC(A/G).<ref name=Tang>{{ cite journal
-|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
-|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
-|journal=Metabolites
-|date=6 August 2020
-|volume=10
-|issue=8
-|pages=320-39
-|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
-|arxiv=
-|bibcode=
-|doi=10.3390/metabo10080320
-|pmid=32781665
-|accessdate=18 September 2020 }}</ref>
-Copying 5'-TGCACCC-3' in "⌘F" yields none between ZSCAN22 and A1BG and one 5'-TGCACCCG-3' between ZNF497 and A1BG as can be found by the computer programs.
-==AGC boxes==
-{{Main|AGC box gene transcriptions}}
-An inverse AGC box occurs negative strand, negative direction, 3'-CCGCCGA-5' at 1754 nts from ZSCAN22 toward A1BG in the distal promoter with its complement on the positive strand, negative direction.
-The GCC box is the same as the AGC box.
-==Alpha-amylase conserved elements==
-Alpha-amylase conserved elements (TATCCATCCATCC).<ref name=Sharma/>
-==Amino acid response elements==
-There is only one nucleotide difference between the ''SESN2'' gene CARE and the amino acid response element (AARE) in the pseudokinase gene ''TRIB3'' with the consensus sequence (TTTGCATCA).<ref name=Garaeva/>
-==Androgen response elements==
-Androgen response elements (AREs).
-==Angiotensinogen core promoter elements==
-{{main|Angiotensinogen core promoter element gene transcriptions}}
-The consensus sequence is 3'-A/C-T-C/T-5'.<ref name=NSato>{{ cite journal
-|author=Noriyuki Sato; Tomohiro Katsuya; Hiromi Rakugi; Seiju Takami; Yukiko Nakata; Tetsuro Miki; Jitsuo Higaki; Toshio Ogihara
-|title=Association of Variants in Critical Core Promoter Element of Angiotensinogen Gene With Increased Risk of Essential Hypertension in Japanese
-|journal=Hypertension
-|date=September 1997
-|volume=30
-|issue=3 Pt 1
-|pages=321-5
-|url=http://www.ncbi.nlm.nih.gov/pubmed/9314411
-|arxiv=
-|bibcode=
-|doi=10.1161/01.HYP.30.3.321
-|pmid=9314411
-|accessdate=2012-02-20 }}</ref> The core nucleotides for AGCE1 include 3'-A/C-T-C/T-G-T-G-5', "located between the TATA box and [[Transcription start site|transcription initiation site]] (positions −25 to −1) is an authentic regulator of human AG transcription."<ref name=Yanai>{{ cite journal
-|author=Kazuyuki Yanai, Tomoko Saito, Keiko Hirota, Hideyuki Kobayashi, Kazuo Murakami and Akiyoshi Fukamizu
-|title=Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity
-|journal=The Journal of Biological Chemistry
-|date=28 November 1997
-|volume=272
-|issue=48
-|pages=30558-62
-|url=http://www.jbc.org/cgi/pmidlookup?view=long&pmid=9374551
-|arxiv=
-|bibcode=
-|doi=
-|pmid=9374551
-|accessdate=2012-02-20 }}</ref>
-# AGCE, negative strand, negative direction, looking for 3'-A/C-T-C/T-G-T-G-5': 4 between 340 and 3914 nts and complements.
-# AGCE, negative strand, positive direction, looking for 3'-A/C-T-C/T-G-T-G-5': 2, 3'-ATTGTG-5' at 2679, 3'-CTCGTG-5' at 4376 and complements.
-# AGCE, positive strand, positive direction, looking for 3'-A/C-T-C/T-G-T-G-5': 6 between 855 and 3739 and complements.
-# AGCEci, negative strand, negative direction, looking for 3'-C-A-C-A/G-A-G/T-5': 2, 3'-CACGAT-5' at 336, 3'-CACGAG-5' at 4403 and complements.
-# AGCEci, negative strand, positive direction, looking for 3'-C-A-C-A/G-A-G/T-5': 1, 3'-CACGAG-5' at 243.
-# AGCEci, positive strand, negative direction, looking for 3'-C-A-C-A/G-A-G/T-5': 10 between 435 and 4472 and complements.
-# AGCEci, positive strand, positive direction, looking for 3'-C-A-C-A/G-A-G/T-5': 3 between 107 and 3152 and complements.
-==Antioxidant/electrophile responsive elements==
-"The transcription factor Nrf2 (nuclear factor erythroid 2 p45‐related factor 2) regulates the expression of genes involved in cellular protection against damage by oxidants, electrophiles, and inflammatory agents, and in the maintenance of mitochondrial function, cellular redox, and protein homeostasis [1]. Nrf2 protein comprises seven functional domains termed Nrf2‐ECH homology (Neh) 1–7 domains [...]."<ref name=Kostova/>
-"At homeostatic conditions, Nrf2 is a short‐lived protein. Under stress conditions, Nrf2 is stabilized and translocates to the nucleus, where it binds (as a heterodimer with a member of the small Maf family of transcription factors) to the ARE/EpRE sequences in the promoter of its target genes, and activates their transcription. Nrf2 targets include genes that encode detoxification, antioxidant, and anti‐inflammatory proteins as well as proteins involved in the regulation of autophagy and clearance of damaged proteins, such as proteasomal subunits [9-11]."<ref name=Kostova/>
-"Neh1 is responsible for the formation of a heterodimer with small musculoaponeurotic fibrosarcoma (sMaf) proteins, and mediates binding to antioxidant/electrophile response element (ARE/EpRE) sequences in the promoter regions of Nrf2 target genes."<ref name=Kostova/>
-"A meta‐analysis of [Parkinson's disease] PD and [Alzheimer's disease] AD microarray datasets identified 31 common downregulated genes containing the ARE/EpRE consensus sequence in their promoters, in addition to increased levels of Nrf2 [27]."<ref name=Kostova/>
-"Nrf2 binds an upstream response element in the frataxin locus, and the anesthetic dyclonine has been shown to activate Nrf2, increase the mRNA and protein levels of frataxin and rescue frataxin‐dependent enzyme deficiencies in the iron‐sulfur enzymes aconitase and succinate dehydrogenase [54]."<ref name=Kostova>{{ cite journal
-|author=Albena T. Dinkova‐Kostova, Rumen V. Kostov and Aleksey G. Kazantsev
-|title=The role of Nrf2 signaling in counteracting neurodegenerative diseases
-|journal=The FEBS Journal
-|date=11 January 2018
-|volume=285
-|issue=19
-|pages=
-|url=https://febs.onlinelibrary.wiley.com/doi/full/10.1111/febs.14379
-|arxiv=
-|bibcode=
-|doi=10.1111/febs.14379
-|pmid=29323772
-|accessdate=21 August 2020 }}</ref>
-The "Nrf2-sMaf heterodimer recognizes DNA sequences referred to as the antioxidant/electrophile responsive element (ARE/EpRE)".<ref name=Otsuki>{{ cite journal
-|author=Akihito Otsuki, Mikiko Suzuki, Fumiki Katsuoka, Kouhei Tsuchida, Hiromi Suda, Masanobu Morita, Ritsuko Shimizu, Masayuki Yamamoto
-|title=Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection
-|journal=Free Radical Biology and Medicine
-|date=February 2016
-|volume=91
-|issue=
-|pages=45-57
-|url=https://www.sciencedirect.com/science/article/abs/pii/S0891584915011478
-|arxiv=
-|bibcode=
-|doi=10.1016/j.freeradbiomed.2015.12.005
-|pmid=26677805
-|accessdate=21 August 2020 }}</ref> "We have compared these binding sequences and found that they show a common consensus sequence, 5′-(A/G)TGA(G/C)nnnGC-3′, but these recognition elements are partially distinct from the element bound by Maf homodimers."<ref name=Otsuki/>
-==ATA boxes==
-{{main|ATA box gene transcriptions}}
-===Core promoters===
-There is the following inverse ATA box on the negative strand, negative direction: 1, 3'-AAATAA-5' at 4537 inside A1BG as the TSS is at 4460 nts from ZSCAN22.
-===Proximal promoters===
-There is the following inverse ATA box on the positive strand, negative direction: 3'-AAATAA-5' at 4221.
-There is one inverse and inverse complement between 4050 and 4300 in the positive direction: 3'-AAATAA-5' at 4142, and 3'-TTTATT-5' at 4142.
-===Distal promoters===
-There is the following ATA box on the negative strand in the negative direction: 1, 3'-AATAAA-5' at 1726 nts from ZSCAN22.
-There are the following ATA boxes on the positive strand in the negative direction: 3, 3'-AATAAA-5' at 3014, 3'-AATAAA-5' at 3335, and 3'-AATAAA-5' at 4072.
-There are the following inverse ATA boxes on the positive strand, negative direction: 4, 3'-AAATAA-5' at 3013, 3'-AAATAA-5' at 3334, 3'-AAATAA-5' at 4071, 3'-AAATAA-5' at 4075.
-There is the following ATA box on the negative strand in the positive direction: 1, 3'-AATAAA-5' at 3427. It has a complement on the positive strand in the positive direction: 1, 3'-TTATTT-5' at 3427.
-There is another inverse complement ATA box on the negative strand in the positive direction in distal promoter: 3'-TTTATT-5' at 2347. It also has an inverse in the distal promoter: 3'-AAATAA-5' at 2347.
-==Auxin response factors==
-The "genome binding of two [auxin response factors] ARFs (ARF2 and ARF5/Monopteros [MP]) differ largely because these two factors have different preferred ARF binding site (ARFbs) arrangements (orientation and spacing)."<ref name=Stigliani>{{ cite journal
-|author=Arnaud Stigliani, Raquel Martin-Arevalillo, Jérémy Lucas, Adrien Bessy, Thomas Vinos-Poyo, Victoria Mironova, Teva Vernoux, Renaud Dumas and François Parcy
-|title=Capturing Auxin Response Factors Syntax Using DNA Binding Models
-|journal=Molecular Plant
-|date=3 June 2019
-|volume=12
-|issue=6
-|pages=822-832
-|url=https://www.sciencedirect.com/science/article/pii/S167420521830306X
-|arxiv=
-|bibcode=
-|doi=10.1016/j.molp.2018.09.010
-|pmid=30336329
-|accessdate=29 August 2020 }}</ref> "ARFbs were originally defined as TGTCTC (Ulmasov et al., 1995, Guilfoyle et al., 1998), [...]. More recently, protein binding microarray (PBM) experiments suggested that TGTCGG are preferred ARFbs, [...] (Boer et al., 2014, Franco-Zorrilla et al., 2014, Liao et al., 2015)."<ref name=Stigliani/>
-A more general consensus sequence may be 1(C/G/T)-2N-3(G/T)-4G-5(C/T)-6(C/T)-7N-8N-9N-10N, where ARF2[b] is 1(C/G/T)-2(A/C/T)-3(G/T)-4G-5(C/T)-6(C/T)-7(G/T)-8(C/G)-9(A/C/T)-10(A/G/T) and ARF5/MP[b] is 1(C/G/T)-2N-3(G/T)-4G-5T-6C-7(G/T)-8N-9-10N.<ref name=Stigliani/> ARF1[b] has 4G.<ref name=Stigliani/>
-==B boxes==
-{{main|B box gene transcriptions}}
-While there appear to be at least two B boxes, TGGGCA is one B-box,<ref name=Johnson>{{ cite journal
-|author=PA Johnson, D Bunick, NB Hecht
-|title=Protein Binding Regions in the Mouse and Rat Protamine-2 Genes
-|journal=Biology of Reproduction
-|date=1991
-|volume=44
-|issue=1
-|pages=127-134
-|url=https://academic.oup.com/biolreprod/article-pdf/44/1/127/10536199/biolreprod0127.pdf
-|arxiv=
-|bibcode=
-|doi=10.1095/biolreprod44.1.127
-|pmid=2015343
-|accessdate=6 April 2019 }}</ref> where the "mP2 EB fragment used for binding was the 118 nucleotide fragment extending from the ''Dde'' I site at position -140 to the ''Dde'' I site at position -23 [...]. This fragment contains the GC, E, B, CAAT, and TATA boxes."<ref name=Johnson/>
-# negative strand in the positive direction, looking for 3'-TGGGCA-5', 4 between 27 and 4180 and complements.
-# positive strand in the negative direction, looking for 3'-TGGGCA-5', 9 between 462 and 4191 and complements.
-# inverse complement, negative strand, positive direction, looking for 3'-TGCCCA-5', 2, 3'-TGCCCA-5' at 3237, 3'-TGCCCA-5' at 3377 and complements.
-# inverse complement, positive strand, negative direction, looking for 3'-TGCCCA-5', 4 between 1458 and 4251 and complements.
-# inverse complement, positive strand, positive direction, looking for 3'-TGCCCA-5', 1, 3'-TGCCCA-5' at 3750 and complement.
-The other is associated with the human transforming growth factor b1 binding sequences.<ref name=Paratore>{{ cite journal
-|author=Amber Paratore Sanchez and Kumar Sharma
-|title=Transcription factors in the pathogenesis of diabetic nephropathy
-|journal=Expert Reviews in Molecular Medicine
-|date=July 2009
-|volume=11
-|issue=
-|pages=e13
-|url=https://www.cambridge.org/core/journals/expert-reviews-in-molecular-medicine/article/transcription-factors-in-the-pathogenesis-of-diabetic-nephropathy/5459130CB955272C047982BE21FEE256
-|arxiv=
-|bibcode=
-|doi=10.1017/S1462399409001057
-|pmid=19397838
-|accessdate=1 October 2018 }}</ref>
-And, has the consensus sequence 3'-TGTCTCA-5'. Let it be designated B1box.
-# negative strand in the negative direction, looking for 3'-TGTCTCA-5', 2, 3'-TGTCTCA-5' at 1075, 3'-TGTCTCA-5' at 2445 and complements.
-# negative strand in the positive direction, looking for 3'-TGTCTCA-5', 2, 3'-TGTCTCA-5'at 2174, 3'-TGTCTCA-5' at 2468 and complements.
-# positive strand in the negative direction, looking for 3'-TGTCTCA-5', 5 between 923 and 4373 and complements.
-# inverse complement, negative strand, negative direction, looking for 3'-TGAGACA-5', 3 between 919 and 2029 and complements.
-# inverse complement, positive strand, positive direction, looking for 3'-TGAGACA-5', 1, 3'-TGAGACA-5' at 2308 and complement.
-==B recognition elements==
-{{main|Factor II B recognition element gene transcriptions}}
-The factor II B recognition element is BRE<sup>u</sup>.
-Negative strand in the negative direction there are 3: 3'-CCACGCC-5' at 380, 3'-CCGCGCC-5' at 1762, and 3'-CCACGCC-5' at 2197 the distal promoter.
-Complement, negative strand, negative direction there us 1: 3'-CCTGCGG-5' at 1153.
-Inverse complement, positive strand, negative direction there are 4: 3'-GGCGTGG-5' at 1244, 3'-GGCGCGG-5' at 1762, 3'-GGCGTGG-5' at 1897, and 3'-GGCGTGG-5' at 3047.
-Negative strand in the positive direction there are 3: 3'-GCACGCC-5', 1302, 3'-GGACGCC-5', 1672, 3'-GGGCGCC-5', 1769.
-Positive strand in the positive direction there are 3: 3'-CCACGCC-5', 489, 3'-CGACGCC-5', 1033, 3'-CCACGCC-5', 1764.
-Inverse complement, negative strand, positive direction there is 1: 3'-GGCGCCC-5', 1770.
-Inverse complement, positive strand, positive direction there is 4: 3'-GGCGCGC-5', 682, 3'-GGCGCCG-5', 1338, 3'-GGCGCCG-5', 1438, 3'-GGCGTGG-5', 2566.
-==CadC binding domains==
-"Altogether, the specific contacts observed suggest a consensus binding motif of 5′-T-T-A-x-x-x-x-T-3′."<ref name=Schlundt>{{ cite journal
-|author=Andreas Schlundt, Sophie Buchner, Robert Janowski, Thomas Heydenreich, Ralf Heermann, Jürgen Lassak, Arie Geerlof, Ralf Stehle, Dierk Niessing, Kirsten Jung & Michael Sattler
-|title=Structure-function analysis of the DNA-binding domain of a transmembrane transcriptional activator
-|journal=Scientific Reports
-|date=21 April 2017
-|volume=7
-|issue=
-|pages=1051
-|url=https://www.nature.com/articles/s41598-017-01031-9/briefing/signup/
-|arxiv=
-|bibcode=
-|doi=10.1038/s41598-017-01031-9
-|pmid=28432336
-|accessdate=28 August 2020 }}</ref> "Dimerization of CadC enables the binding of two DBDs to the two Cad1 consensus target sites."<ref name=Schlundt/> "The DNA consensus sequence 5′-T-T-A-x-x-x-x-T-3′ is present once in the quasi-palindromic Cad1 17-mer DNA, consistent with the formation of a 1:1 complex. However, a second consensus facilitates the formation of the 2:1 complex of CadC with Cad1 41-mer DNA as evidenced by the CadC model with the minimal Cad1 26-mer DNA that spans the two AT-rich regions, i.e. consensus sites."<ref name=Schlundt/>
-==Calcium-response elements==
-The calcium-responsive transcription factor (CaRF, also known as amyotrophic lateral sclerosis 2 chromosomal region candidate gene 8 protein) acts as a transcriptional activator that mediates the calcium- and neuron-selective induction of BDNF exon III transcription and binds to the consensus calcium-response element CaRE1 5'-CTATTTCGAG-3' sequence.<ref name=Tao>{{ cite journal
-|author=Xu Tao, Anne E. West, Wen G. Chen, Gabriel Corfas, Michael E. Greenberg
-|title=A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF
-|journal=Neuron
-|date=2002
-|volume=33
-|issue=
-|pages=383-95
-|url=https://www.cell.com/neuron/fulltext/S0896-6273(01)00561-X?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS089662730100561X%3Fshowall%3Dtrue
-|arxiv=
-|bibcode=
-|doi=10.1016/S0896-6273(01)00561-X
-|pmid=11832226
-|accessdate=2 September 2020 }}</ref>
-==CAREs==
-{{main|CARE gene transcriptions}}
-A CARE occurs in the negative direction: 3'-CAACTC-5' at 86 possibly associated with ZSCAN22. But inverse CAREs occur 3'-CTCAAC-5' at 1406, 3'-CTCAAC-5' at 2592, 3'-CTCAAC-5' at 2704, 3'-CTCAAC-5' at 3115, and 3'-CTCAAC-5' at 4096.
-A CARE occurs in the positive direction: 3'-CAACTC-5' at 3292 in the positive direction. But inverse CARE occur 3'-CTCAAC-5' at 1406 and 3'-CTCAAC-5' at 1621 and 3'-CTCAAC-5' at 3290.
-==CArG boxes==
-{{main|CArG box gene transcriptions}}
-"RIN [Ripening Inhibitor] binds to DNA sequences known as the CA/T-rich-G (CArG) box, which is the general target of [[MADS box gene transcriptions|MADS box]] proteins (Ito et al., 2008)."<ref name=Fujisawa>{{ cite journal
-|author=Masaki Fujisawa, Toshitsugu Nakano, Yoko Shima and Yasuhiro Ito
-|title=A large-scale identification of direct targets of the tomato MADS box transcription factor RIPENING INHIBITOR reveals the regulation of fruit ripening
-|journal=The Plant Cell
-|date=5 February 2013
-|volume=25
-|issue=2
-|pages=371-86
-|url=http://www.plantcell.org/content/25/2/371.short
-|arxiv=
-|bibcode=
-|doi=10.1105/tpc.112.108118
-|pmid=23386264
-|accessdate=2017-02-19 }}</ref>
-There is a more general CArG box, 3'-CATTAAAAGG-5', at 3441 from ZSCAN22, or -1019 nts from the TSS of A1BG in the negative direction on the positive strand in the distal promoter.
-A second more general CArG box, 3'-CAAAAAAAAG-5', at 1399 from ZSCAN22, or -3061 nts from the A1BG TSS may be a CArG box for ZSCAN22 in the negative direction on the positive strand in the distal promoter.
-==C boxes==
-{{main|C box gene transcriptions}}
-Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] GACGTC (C box) [...].<ref name=Landschulz/><ref name=Zhang2014/><ref name=Nijhawan/>
-===Proximal promoters===
-Inverse complement, negative strand, negative direction there is 1: 3'-ACATCA-5', 4124.
-There is one C box 3'-ACATCA-5' at 4116 nts in the positive direction.
-===Distal promoters===
-There are four C boxes: 3'-AGTAGT-5' at 2888, 3'-AGTAGT-5' at 2944, 3'-AGTAGT-5' at 3418, and 3'-AGTAGT-5' at 3521 on the negative strand in the negative direction and its complement on the positive strand.
-Inverse complement, negative strand, negative direction there are 2: 3'-ACATCA-5', 2340, 3'-ACATCA-5', 2541.
-There is one complement C box: 3'-TCATCA-5' at 3251 on the negative strand in the positive direction and its complement on the positive strand.
-Inverse, negative strand, positive direction, there is 1: 3'-TGATGA-5', 2144.
-Positive strand in the positive direction there is 1: 3'-AGTAGT-5', 3251.
-==C-boxes==
-{{main|C box gene transcriptions}}
-Analysis "of the recombinant (soybean [''Glycine max''] TGACG-motif binding factor 1) STF1 protein revealed the C-box (nGACGTCn) to be a high-affinity binding site (Cheong et al., 1998). [...] To test whether STF1 and HY5 have similar DNA-binding properties, the binding properties of each were compared with eight different DNA sequences that represent G-, C-, and C/G-box motifs [TGACGTGT]. C-box sequences carrying the mammalian cAMP responsive element (CRE; TGACGTCA) motif and the Hex sequence (TGACGTGGC), a hybrid C/G-box (Cheong et al., 1998), were high-affinity binding sites for both proteins [...]."<ref name=Song2008>{{ cite journal
-|author=Young Hun Song, Cheol Min Yoo, An Pio Hong, Seong Hee Kim, Hee Jeong Jeong, Su Young Shin, Hye Jin Kim, Dae-Jin Yun, Chae Oh Lim, Jeong Dong Bahk, Sang Yeol Lee, Ron T. Nagao, Joe L. Key, and Jong Chan Hong
-|title=DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins
-|journal=Plant Physiology
-|date=April 2008
-|volume=146
-|issue=4
-|pages=1862–1877
-|url=http://www.plantphysiol.org/content/plantphysiol/146/4/1862.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1104/pp.107.113217
-|pmid=18287490
-|accessdate=26 March 2019 }}</ref>
-C-boxes are TCTTACGTCATC, AATGACGTCGAA, TCTCACGTGTGG, TTTGACGTGTGA, GATGACGTCATC, and AGAGACGTCAAC for an apparent consensus sequence of (A/G/T)(A/C/G/T)(A/T)(C/G/T)ACGT(C/G)(A/G/T)(A/G/T)(A/C/G).<ref name=Song2008/>
-GAGGCCATCT is a C-box, [...].<ref name=Johnson>{{ cite journal
-|author=PA Johnson, D Bunick, NB Hecht
-|title=Protein Binding Regions in the Mouse and Rat Protamine-2 Genes
-|journal=Biology of Reproduction
-|date=1991
-|volume=44
-|issue=1
-|pages=127-134
-|url=https://academic.oup.com/biolreprod/article-pdf/44/1/127/10536199/biolreprod0127.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=2015343
-|accessdate=6 April 2019 }}</ref>
-The human ribosomal protein L11 gene (''HRPL11'') has [...] two potential snRNA-coding sequences in intron 4: the C box beginning at +4131 (GGTGATG), [...] a D box beginning at +4237 (TCCTG), [...].<ref name=Voronina>{{ cite journal
-|author=E. N. Voronina, T. D. Kolokol’tsova, E. A. Nechaeva, and M. L. Filipenko
-|title=Structural–Functional Analysis of the Human Gene for Ribosomal Protein L11
-|journal=Molecular Biology
-|date=2003
-|volume=37
-|issue=3
-|pages=362–371
-|url=https://www.researchgate.net/profile/Elena_Voronina3/publication/263607045_Structural-Functional_Analysis_of_the_Human_Gene_for_Ribosomal_Protein_L11/links/5523af480cf27b5dc3795afa.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=
-|accessdate=11 April 2019 }}</ref>
-==CCAAT-box-binding transcription factors==
-{{main|Nuclear factor gene transcriptions}}
-CAAT boxes: CCAAT-box-binding transcription factor, TGGCA-binding protein are used by some nuclear factors.<ref name=RefSeq4774>{{ cite web
-|vauthors=RefSeq
-|title=NFIA nuclear factor I A [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=September 2011
-|url=https://www.ncbi.nlm.nih.gov/gene/4774
-|accessdate=4 May 2020 }}</ref>
-The consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.<ref name=Yao/>
-"TTAGGACAT is the C/EBP box".<ref name=Misra/>
-"ATF4 regulates transcription of its target genes through the formation of homodimers or heterooligomers with the transcription factors Jun, AP-1 and C/EBP<sup>38,39</sup> that bind to CARE (C/EBP-ATF) responsive elements having the consensus sequence XTTXCATCA (where X = G, A or T).<sup>39</sup> In the region from -625 to -618 bp relative to the ''SESN2'' translation start codon (from -228 to -221 bp relative to the transcription start site) we found a candidate sequence for the ATF4 binding site TTTTCATCA."<ref name=Garaeva>{{ cite journal
-|author=Alisa A. Garaeva, Irina E. Kovaleva, Peter M. Chumakov & Alexandra G. Evstafieva
-|title=Mitochondrial dysfunction induces ''SESN2'' gene expression through Activating Transcription Factor 4
-|journal=Cell Cycle
-|date=15 January 2016
-|volume=15
-|issue=1
-|pages=64-71
-|url=https://www.tandfonline.com/doi/full/10.1080/15384101.2015.1120929
-|arxiv=
-|bibcode=
-|doi=10.1080/15384101.2015.1120929
-|pmid=26771712
-|accessdate=5 September 2020 }}</ref>
-"The ATF4 binding consensus sequence has been reported as (G/A/C)TT(G/A/T)C(G/A)TCA (38), which matches the ChIP-seq data."<ref name=Burton>{{ cite journal
-|author=Thomas D. Burton, Anthony O. Fedele, Jianling Xie, Lauren Sandeman and Christopher G. Proud
-|title=The gene for the lysosomal protein LAMP3 is a direct target of the transcription factor ATF4
-|journal=Journal of Biological Chemistry
-|date=22 May 2020
-|volume=295
-|issue=21
-|pages=7418
-|url=https://www.jbc.org/content/early/2020/04/20/jbc.RA119.011864.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1074/jbc.RA119.011864
-|pmid=32312748
-|accessdate=5 September 2020 }}</ref>
-==Cell cycle regulation==
-Cell cycle regulation (CCCAACGGT).<ref name=Sharma/>
-==CGCG boxes==
-{{main|CGCG box gene transcriptions}}
-Negative strand in the negative direction there are 2: 3'-GCGCGT-5', 161, 3'-CCGCGC-5', 1761, in the distal promoter.
-Positive strand in the negative direction there is 1: 3'-GCGCGG-5', 1762, in the distal promoter.
-Negative strand in the positive direction there are 8: between 543 and 1650, in the distal promoter.
-Positive strand in the positive direction there are 22: between 161 and 1769, in the distal promoter.
-==Circadian control elements==
-Circadian control elements (CAANNNNATC).<ref name=Sharma/>
-==Cold-responsive elements==
-A "putative cold-responsive element (CRE) [...] is specified by a conserved 5-bp core sequence (CCGAC) typical for C-repeat (CRT)/dehydration-responsive elements (DRE) that are recognized by cold-specific transcription factors (TFs) [16]."<ref name=Pietzenuk>{{ cite journal
-|author=Björn Pietzenuk, Catarine Markus, Hervé Gaubert, Navratan Bagwan, Aldo Merotto, Etienne Bucher & Ales Pecinka
-|title=Recurrent evolution of heat-responsiveness in Brassicaceae COPIA elements
-|journal=Genome Biology
-|date=11 October 2016
-|volume=17
-|issue=
-|pages=209
-|url=https://genomebiology.biomedcentral.com/articles/10.1186/s13059-016-1072-3
-|arxiv=
-|bibcode=
-|doi=10.1186/s13059-016-1072-3
-|pmid=
-|accessdate=14 September 2020 }}</ref>
-==CRE boxes==
-{{main|CRE box gene transcriptions}}
-"Within the cAMP-responsive element of the somatostatin gene, we observed an 8-base palindrome, 5'-TGACGTCA-3', which is highly conserved in many other genes whose expression is regulated by cAMP."<ref name=Montminy>{{ cite journal
-|author=Marc R. Montminy, Kevin A. Sevarino, John A. Wagner, Gail Mandel, and Richard H. Goodman
-|title=Identification of a cyclic-AMP-responsive element within the rat somatostatin gene
-|journal=Proceedings of the National Academy of Sciences of the USA
-|date=September 1986
-|volume=83
-|issue=18
-|pages=6382-6
-|url=http://www.pnas.org/content/pnas/83/18/6682.full.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=2875459
-|accessdate=17 September 2018 }}</ref>
-Negative strand in the negative direction there is 1: 3'-TGACGTCA-5', 4317, and its complement in the proximal promoter.
-==CTCFs==
-"Experiments using chromatin immunoprecipitation exonuclease (ChIP-exo) uncovered a broad CTCF-binding motif that contains a 12–15 bp consensus sequence, 5′-NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C)-3′ (Nakahashi et al., 2013, Rhee and Pugh, 2011) [...]."<ref name=Hashimoto>{{ cite journal
-|author=Hideharu Hashimoto, Dongxue Wang, John R. Horton, Xing Zhang, Victor G. Corces and Xiaodong Cheng
-|title=Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA
-|journal=Molecular Cell
-|date=1 June 2017
-|volume=66
 |issue=5
-|pages=711-720.e3
+|pages=1412–1417
-|url=https://www.sciencedirect.com/science/article/pii/S1097276517303179
-|arxiv=
-|bibcode=
-|doi=10.1016/j.molcel.2017.05.004
-|pmid=28529057
-|accessdate=28 August 2020 }}</ref>
-==DAF-16 binding elements==
-"DAF-16 binding element (DBE), GTAAACA or TGTTTAC, and DAF-16-associated element (DAE), TGATAAG or CTTATCA, enriched in DAF-16 regulated genes [2, 4, 13, 14]. The DBE was recognized by DAF-16, and the DAE by transcription factor PQM-1 [13]."<ref name=Li>{{ cite journal
-|author=Yan-Hui Li and Gai-Gai Zhang
-|title=Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in ''Caenorhabditis elegans''
-|journal=Oncotarget
-|date=12 April 2016
-|volume=7
-|issue=15
-|pages=19185-19192
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4991374/
-|arxiv=
-|bibcode=
-|doi=10.18632/oncotarget.8313
-|pmid=2702736
-|accessdate=27 August 2020 }}</ref> Note: GTAAACA is the inverse complement (ic) of TGTTTAC and TGATAAG is the ic of CTTATCA.
-==DNA replication-related elements==
-"The promoters of ''Drosophila'' genes encoding DNA replication-related proteins contain transcription regulatory elements consisting of an 8-bp palindromic DNA replication-related element (DRE) sequence (5′-TATCGATA)."<ref name=Hirose>{{ cite journal
-|author=Fumiko Hirose, Masamitsu Yamaguchi, Akio Matsukage
-|title=Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a ''Drosophila'' Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc
-|journal=Molecular and Cellular Biology
-|date=September 1999
-|volume=19
-|issue=9
-|pages=6020-6028
-|url=https://mcb.asm.org/content/19/9/6020.full
-|arxiv=
-|bibcode=
-|doi=10.1128/MCB.19.9.6020
-|pmid=10454549
-|accessdate=4 September 2020 }}</ref>
-Copying the consensus of the DRE: 5'-TATCGATA-3' and putting the sequence in "⌘F" finds no locations for this sequence in any A1BG direction as can be found by the computer programs.
-==D boxes==
-{{main|C and D box gene transcriptions}}
-There is one D box in the distal promoter: 3'-AGTCTG-5' at 2947 on the negative strand in the negative direction and its complement on the positive strand.
-Positive strand in the negative direction there is 1: 3'-AGTCTG-5', 1355.
-Inverse complement, positive strand, negative direction there are 2: 3'-CAGACT-5', 15, 3'-CAGACT-5', 1616.
-There is one D box in the distal promoter: 3'-AGTCTG-5' at 3923 on the negative strand in the positive direction and its complement on the positive strand.
-Inverse complement, negative strand, positive direction there are 2: 3'-CAGACT-5', 1744, 3'-CAGACT-5', 2416.
-Inverse complement, positive strand, positive direction there are 3: 3'-CAGACT-5', 2943, 3'-CAGACT-5', 3006, 3'-CAGACT-5', 3924.
-D-box (TGAGTGG).<ref name=Motojima/>
-==Defense and stress-responsive elements==
-Defense and stress-responsive elements (ATTTTCTTCA).<ref name=Sharma/>
-Copying the consensus of the DRE: 5'-ATTTTCTTCA-3' and putting the sequence in "⌘F" finds no locations for this sequence in any A1BG direction as can be found by the computer programs.
-==Downstream B recognition elements==
-{{main|Downstream TFIIB recognition element gene transcriptions}}
-# negative strand in the negative direction, looking for 3'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-5', 59: between 68 and 4458 and their complements.
-# negative strand in the positive direction, looking for 3'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-5', 11: between 56 and 4397 and their complements.
-# positive strand in the negative direction, looking for 3'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-5', 31: between 43 and 4110 and their complements.
-# positive strand in the positive direction, looking for 3'-A/G-T-A/G/T-G/T-G/T-G/T-G/T-5', 19: between 72 and 4328 and their complements.
-# inverse, negative strand, negative direction, is SuccessablesdBREi--.bas, looking for 3'-G/T-G/T-G/T-G/T-A/G/T-T-A/G-5': 44 between 230 and 4454 and their complements.
-# inverse, negative strand, positive direction, is SuccessablesdBREi-+.bas, looking for 3'-G/T-G/T-G/T-G/T-A/G/T-T-A/G-5', 16: between 59 and 4398 and their complements.
-# inverse, positive strand, negative direction, is SuccessablesdBREi+-.bas, looking for 3'-G/T-G/T-G/T-G/T-A/G/T-T-A/G-5', 16: between 217 and 3945 and their complements.
-# inverse, positive strand, positive direction, is SuccessablesdBREi++.bas, looking for 3'-G/T-G/T-G/T-G/T-A/G/T-T-A/G-5', 14: between 72 and 4287 and their complements.
-==Downstream core elements==
-{{main|Downstream core element gene transcriptions}}
-In the negative direction on the negative strand, the A1BG transcription start site is at 4460 nucleotides from the last nucleotide of the gene ZSCAN22. In the positive direction on the negative strand, the A1BG transcription start site is at 4300 from well within the gene ZNF497. Downstream core elements are expected downstream of these TSSs. Occurrences before the TSSs can be found on [[Downstream core element gene transcriptions]].
-# positive strand, negative direction, looking for DCE SI: 3'-CTTC-5' at 4528.
-# negative strand, negative direction, looking for DCE SII: 3'-CTGT-5', 2, 3'-CTGT-5' at 4468 , 3'-CTGT-5' at 4507.
-# negative strand, positive direction, looking for DCE SII: 3'-CTGT-5', 1, 3'-CTGT-5' at 4392.
-# positive strand, positive direction, looking for DCE SII: 3'-CTGT-5', 1, 3'-CTGT-5' at 4332.
-# negative strand, positive direction, looking for DCE SIII: 3'-AGC-5', 1, 3'-AGC-5' at 4352.
-# positive strand, negative direction, looking for DCE SIII: 3'-AGC-5', 3, 3'-AGC-5' at 4480, 3'-AGC-5' at 4489, 3'-AGC-5' at 4520.
-# positive strand, positive direction, looking for DCE SIII: 3'-AGC-5', 1, 3'-AGC-5' at 4374.
-===Complements===
-# negative strand, negative direction, looking for DCE SIc: 3'-GAAG-5', 1, 3'-GAAG-5' at 4528.
-# negative strand, positive direction, looking for DCE SIIc: 3'-GACA-5', 1, 3'-GACA-5' at 4332.
-# positive strand, negative direction, looking for DCE SIIc: 3'-GACA-5', 2, 3'-GACA-5' at 4468, 3'-GACA-5' at 4507.
-# positive strand, positive direction, looking for DCE SIIc: 3'-GAAG-5', 1, 3'-GACA-5' at 4392.
-# negative strand, negative direction, looking for DCE SIIIc: 3'-TCG-5', 3, 3'-TCG-5' at 4480, 3'-TCG-5' at 4489, 3'-TCG-5' at 4520.
-# negative strand, positive direction, looking for DCE SIIIc: 3'-TCG-5', 1, 3'-TCG-5' at 4374.
-# positive strand, positive direction, looking for DCE SIIIc: 3'-TCG-5', 1, 3'-TCG-5' at 4352.
-===Inverse complements===
-# looking for DCE SIci: 3'-GAAG-5', same as the complements.
-# positive strand, negative direction, looking for DCE SIIci: 3'-ACAG-5', 1, 3'-ACAG-5' at 4517.
-# positive strand, positive direction, looking for DCE SIIci: 3'-ACAG-5', 1, 3'-ACAG-5' at 4366.
-# negative strand, negative direction, looking for DCE SIIIci: 3'-GCT-5', 1, 3'-GCT-5' at 4471.
-# negative strand, positive direction, looking for DCE SIIIci: 3'-GCT-5', 4, 3'-GCT-5' at 4312, 3'-GCT-5' at 4321, 3'-GCT-5' at 4372, 3'-GCT-5' at 4390.
-# positive strand, positive direction, looking for DCE SIIIci: 3'-GCT-5', 1, 3'-GCT-5' at 4356.
-===Inverses===
-# looking for DCE SIi: 3'-CTTC-5', same as the direct transcript.
-# negative strand, negative direction, looking for DCE SIIi: 3'-TGTC-5', 1, 3'-TGTC-5' at 4517.
-# negative strand, positive direction, looking for DCE SIIi: 3'-TGTC-5', 1, 3'-TGTC-5' at 4366.
-# negative strand, positive direction, looking for DCE SIIIi: 3'-CGA-5', 1, 3'-CGA-5' at 4356.
-# positive strand, negative direction, looking for DCE SIIIi: 3'-CGA-5', 1, 3'-CGA-5' at 4471.
-# positive strand, positive direction, looking for DCE SIIIi: 3'-CGA-5', 4, 3'-CGA-5' at 4312, 3'-CGA-5' at 4321, 3'-CGA-5' at 4372, 3'-CGA-5' at 4390.
-==Downstream promoter elements==
-{{main|Downstream promoter element gene transcriptions}}
-# negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesDPE--.bas, looking for 3'-A/G-G-A/T-C/T-A/C/G-5', 163: between 35 and 4546, and their complements.
-# negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesDPE-+.bas, looking for 3'-A/G-G-A/T-C/T-A/C/G-5', 73: between 37 and 4420, and their complements.
-# positive strand in the negative direction is SuccessablesDPE+-.bas, looking for 3'-A/G-G-A/T-C/T-A/C/G-5', 101: between 32 and 4507, and their complements.
-# positive strand in the positive direction is SuccessablesDPE++.bas, looking for 3'-A/G-G-A/T-C/T-A/C/G-5', 159: between 8 and 4424, and their complements.
-# inverse, negative strand, negative direction, is SuccessablesDPEi--.bas, looking for 3'-A/C/G-C/T-A/T-G-A/G-5', 58: between 32 and 4476,
-# inverse, negative strand, positive direction, is SuccessablesDPEi-+.bas, looking for 3'-A/C/G-C/T-A/T-G-A/G-5', 152: between 8 and 4424.
-# inverse, positive strand, negative direction, is SuccessablesDPEi+-.bas, looking for 3'-A/C/G-C/T-A/T-G-A/G-5', 174: between 13 and 4546,
-# inverse, positive strand, positive direction, is SuccessablesDPEi++.bas, looking for 3'-A/C/G-C/T-A/T-G-A/G-5', 95: between 30 and 4420.
-{{clear}}
-==E2 boxes==
-{{main|E2 box gene transcriptions}}
-Negative strand in the negative direction there are 5: 3'-ACAGATGT-5', 482, 3'-ACAGATGT-5', 1225, 3'-GCAGTTGG-5', 1514, 3'-ACAGATGT-5', 2989, 3'-ACAGATGT-5', 4213, in the distal promoter.
-Positive strand in the negative direction there are 2: 3'-GCAGGTGG-5', 2571, 3'-ACAGATGA-5', 3920.
-Inverse complement, negative strand, negative direction there is 1: 3'-CCACCTGT-5', 2117.
-Inverse complement, positive strand, negative direction there are 4: 3'-CCACCTGT-5', 394, 3'-ACACCTGT-5', 1131, 3'-GCAACTGC-5', 3851, 3'-ACACCTGT-5', 3970
-Negative strand in the positive direction there is 1: 3'-GCAGATGA-5', 37.
-==EIF4E basal elements==
-{{main|EIF4E basal element gene transcriptions}}
-There are no EIF4E basal element, also eIF4E, (4EBE), in either promoter.
-==Endoplasmic reticulum stress response elements==
-"The released aminoterminal of ATF6 (ATF6-N) then migrates to the nucleus and binds to the ER stress response element (ERSE) containing the consensus sequence CCAAT-N9-CCACG to activate genes encoding ER chaperones, ERAD components, and XBP1 (Chen et al., 2010; Yamamoto et al., 2004; Yoshida et al., 2001)."<ref name=So>{{ cite journal
-|author=Jae-Seon So
-|title=Roles of Endoplasmic Reticulum Stress in Immune Responses
-|journal=Molecules and Cells
-|date=31 August 2018
-|volume=41
-|issue=8
-|pages=705-16
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6125421/
-|arxiv=
-|bibcode=
-|doi=10.14348/molcells.2018.0241
-|pmid=30078231
-|accessdate=5 September 2020 }}</ref>
-==Endosperm expression==
-Endosperm expression (TGTGTCA).<ref name=Sharma/>
-==Enhancer boxes==
-{{main|Enhancer box gene transcriptions}}
-===Core promoters===
-===Proximal promoters===
-Negative strand, negative direction there is 1: 3'-CAGATG-5' at 4212.
-Positive strand, positive direction there is 1: 3'-CAAGTG-5' at 4202.
-===Distal promoters===
-Negative strand in the negative direction there are 9: between 324 and 3482.
-Positive strand in the negative direction there are 21: between 41 and 4011.
-Negative strand in the positive direction there are 26: between 196 and 4015.
-Positive strand in the positive direction there are 10: between 186 and 3936.
-==Estrogen response elements==
-Estrogen response elements (EREs).
-==Ethylene responsive elements==
-Ethylene responsive elements (ATTTCAAA).<ref name=Sharma/>
-==F boxes==
-{{main|F box gene transcriptions}}
-"Male sex determination in the ''Caenorhabditis elegans'' hermaphrodite germline requires translational repression of tra-2 mRNA by the [Germ Line Development] GLD-1 RNA binding protein."<ref name=Clifford>{{ cite journal
-|author=Robert Clifford, Min-Ho Lee, Sudhir Nayak, Mitsue Ohmachi, Flav Giorgini and Tim Schedl
-|title=FOG-2, a novel F-box containing protein, associates with the GLD-1 RNA binding protein and directs male sex determination in the ''C. elegans'' hermaphrodite germline
-|journal=Development
-|date=December 2000
-|volume=127
-|issue=24
-|pages=5265-76
-|url=https://dev.biologists.org/content/develop/127/24/5265.full.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=11076749
-|accessdate=10 August 2020 }}</ref>
-Skp, Cullin, F-box containing complex (or SCF complex)  is a multi-protein E3 [[ubiquitin ligase]] complex that catalyzes the [[ubiquitin]]ation of proteins destined for 26S [[Proteasome|proteasomal]] degradation.<ref name=Ou>{{ Cite journal
-|last1=Ou|first1=Young
-|title=The Centrosome in Higher Organisms: Structure, Composition, and Duplication
-|volume=238
-|date=2004
-|journal=International Review of Cytology
-|pages=119–182
-|isbn=978-0-12-364642-2
-|last2=Rattner|first2=J.B.
-|doi=10.1016/s0074-7696(04)38003-4
-|pmid=15364198 }}</ref>
-"Canonical F-box proteins act as bridging components of the SCF ubiquitin ligase complex; the N-terminal F-box binds a Skp1 homolog, recruiting ubiquination machinery, while a C-terminal protein-protein interaction domain binds a specific substrate for degradation."<ref name=Clifford/>
-==GAAC elements==
-{{main|GAAC element gene transcriptions}}
-# negative strand in the negative direction, looking for 3'-GAACT-5', 13: between 843 and 4294 and complements,
-# negative strand in the positive direction, looking for 3'-GAACT-5', 1, 3'-GAACT-5', 609 and complement,
-# positive strand in the negative direction, looking for 3'-GAACT-5', 2, 3'-GAACT-5', 1685, 3'-GAACT-5', 3460 and complements,
-# positive strand in the positive direction, looking for 3'-GAACT-5', 2, 3'-GAACT-5', 577, 3'-GAACT-5', 692 and complements,
-# inverse complement, negative strand, negative direction, looking for 3'-AGTTC-5', 3: between 3844 and 4178 and complements,
-# inverse complement, negative strand, positive direction, looking for 3'-AGTTC-5', 1, 3'-AGTTC-5', 761 and complement,
-# inverse complement, positive strand, negative direction, looking for 3'-AGTTC-5', 6: between 253 and 4417.
-==GA responsive elements==
-{{main|GARE gene transcriptions}}
-Only one GARE (an inverse) occurs: between ZSCAN22 and A1BG 3'-AAACAAT-5' at 230 nts and its complement.
-==GATA boxes==
-{{main|GATA gene transcriptions}}
-GTGA-box has the consensus sequence GATA.<ref name=Ye/>
-===Proximal promoters===
-Inverse complement, negative strand, positive direction there is 1: 3'-TTTATCAC-5', 4125.
-===Distal promoters===
-Positive strand in the negative direction there are 2: 3'-GGGATAGA-5', 100, 3'-ATGATAGA-5', 355.
-Inverse complement, negative strand, negative direction there is 1: 3'-GTTATCAT-5', 2500.
-Inverse complement, positive strand, negative direction there is 1: 3'-TTTATCTT-5', 1732.
-Inverse complement, negative strand, positive direction there is 1: 3'-GTTATCCC-5', 3385.
-Inverse complement, positive strand, positive direction there are 2: 3'-GCTATCAG-5', 1840, 3'-TTTATCTT-5', 2628.
-==G boxes==
-{{main|G box gene transcriptions}}
-The "perfect palindrome 5'-GCCACGTGGC-3' which is also known as the G-box motif."<ref name=Oeda>{{ cite journal
-|author=K Oeda, J Salinas, and N H Chua
-|title=A tobacco bZip transcription activator (TAF-1) binds to a G-box-like motif conserved in plant genes
-|journal=The EMBO Journal
-|month=July
-|year=1991
-|volume=10
-|issue=7
-|pages=1793–1802
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC452853/
-|arxiv=
-|bibcode=
-|doi=
-|pmid=2050116
-|accessdate=2017-02-13 }}</ref>
-"TAF-1 can bind to the G-box and related motifs and that it functions as a transcription activator."<ref name=Oeda/>
-"A G-box-related motif, containing the core sequence CACGTG is also present in the 5' regions of two other classes of light-responsive genes".<ref name=Oeda/>
-"Two distinct sequence elements, the H-box (consensus CCTACC(N)<sub>7</sub>CT) and the G-box (CACGTG), are required for stimulation of the ''chsl5'' promoter by [p-coumaric acid] 4-CA."<ref name=Loake>{{ cite journal
-|author=Gary J. Loake, Ouriel Faktor, Christopher J. Lamb, and Richard A. Dixon
-|title=Combination of H-box [CCTACC(N)<sub>7</sub>CT] and G-box (CACGTG) cis elements is necessary for feed-forward stimulation of a chalcone synthase promoter by the phenylpropanoid-pathway intermediate ''p''-coumaricacid
-|journal=Proceedings of the National Academy of Sciences USA
-|date=October 1992
-|volume=89
-|issue=
-|pages=9230-4
-|url=https://www.pnas.org/content/pnas/89/19/9230.full.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=1409628
-|accessdate=5 May 2020 }}</ref>
-Most bZIP proteins show high binding affinity for the ACGT motifs, which include CACGTG (G box) [...].<ref name=Landschulz>{{cite journal | vauthors = Landschulz WH, Johnson PF, McKnight SL | title = The leucine zipper: a hypothetical structure common to a new class of DNA binding proteins | journal = Science | volume = 240 | issue = 4860 | pages = 1759–64 | date = June 1988 | pmid = 3289117
-| doi = 10.1126/science.3289117 | bibcode = 1988Sci...240.1759L | url = https://semanticscholar.org/paper/3a61c172ddfa79ce9f4909ca6bea2f6f40f7893e }}</ref><ref name=Zhang2014>{{cite journal
-| vauthors = Z G E, Zhang YP, Zhou JH, Wang L | title = Mini review roles of the bZIP gene family in rice | journal = Genetics and Molecular Research | volume = 13 | issue = 2 | pages = 3025–36 | date = April 2014 | pmid = 24782137
-| doi = 10.4238/2014.April.16.11 }}</ref><ref name=Nijhawan>{{cite journal | vauthors = Nijhawan A, Jain M, Tyagi AK, Khurana JP | title = Genomic survey and gene expression analysis of the basic leucine zipper transcription factor family in rice | journal = Plant Physiology | volume = 146 | issue = 2 | pages = 333–50 | date = February 2008 | pmid = 18065552 | pmc = 2245831
-| doi = 10.1104/pp.107.112821 }}</ref>
-Binding "activity to the G-box of the light-responsive unit 1 (U1) region of the parsley (''Petroselinum crispum'') ''CHS'' promoter (CHS-U1: TCCACGTGGC; Schulze-Lefert et al., 1989) or the G-box of ''GmAux28'' (TCCACGTGTC) was much weaker than to the PA G-box [...]."<ref name=Song2008/>
-There are no "perfect palindrome" G boxes in either promoter.
-==GC boxes==
-{{main|GC box gene transcriptions}}
-GC box (GGGCGG).<ref name=Sato/>
-Positive strand in the negative direction there are 2; 3'-TGGGCGTGGT-5', 1898, 3'-TGGGCGTGGT-5', 3048, in the distal promoter.
-Inverse complement, negative strand, negative direction there is 1: 3'-ACTCCGCCCA-5', 3092.
-Inverse complement, positive strand, negative direction there is 1: 3'-GCTCCGCCTC-5', 1505.
-Negative strand in the positive direction there is 1: 3'-TGGGCGGGAC-5', 409.
-Inverse complement, positive strand, positive direction there is 1:, 3'-GCCACGCCCC-5', 491.
-==Gibberellin responsive elements==
-{{main|Gibberellin responsive element gene transcriptions}}
-Gibberellin responsive elements (CCTTTTG, AAACAGA).<ref name=Sharma/>
-Copying an apparent consensus sequence of CCTTTTG, AAACAGA and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and two between ZNF497 and A1BG as can be found by the computer programs.
-==Glucocorticoid response elements==
-{{main|Glucocorticoid response element gene transcriptions}}
-"DNA-binding by the GR-DBD has been well-characterized; it is highly sequence-specific, directly recognizing invariant guanine nucleotides of two AGAACA [TGTTCT] half sites called the glucocorticoid response element (GRE), and binds as a dimer in head-to-head orientation with mid-nanomolar affinity (4,12–18). [...] The consensus DNA glucocorticoid response element (GRE) is comprised of two half-sites (AGAACA) separated by a three base-pair spacer (13,15,60,61)."<ref name=Parsonnet>{{ cite journal
-|author=Nicholas V Parsonnet, Nickolaus C Lammer, Zachariah E Holmes, Robert T Batey, Deborah S Wuttke
-|title=The glucocorticoid receptor DNA-binding domain recognizes RNA hairpin structures with high affinity
-|journal=Nucleic Acids Research
-|date=5 September 2019
-|volume=47
-|issue=15
-|pages=8180-8192
-|url=https://academic.oup.com/nar/article/47/15/8180/5506867
-|arxiv=
-|bibcode=
-|doi=10.1093/nar/gkz486
-|pmid=31147715
-|accessdate=28 August 2020 }}</ref>
-Copying an apparent consensus sequence of AGAACA and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and two between ZNF497 and A1BG as can be found by the computer programs.
-==H boxes==
-{{main|H box gene transcriptions}}
-===Core promoters===
-Between ZSCAN22 and A1BG: There is one inverse and its complement 3'-AGGAGA-5' at 4428 nts.
-Between ZNF497 and A1BG: There is an inverse and its complement 3'-AGGACA-5' at 4252. There is five after the TSS: between 4387 and 4392 and their complements.
-===Proximal promoters===
-Between ZSCAN22 and A1BG: There is one H box (3'-ANANNA-5'): negative direction, negative strand, 3'-ACACGA-5' at 4402. On the positive strand in the negative direction there are 16: between 4216 and 4395, with their complements on the negative strand, negative direction.
-Between ZNF497 and A1BG: There is one H box (3'-ANANNA-5'): 3'-AGAGAA-5' at 4387 in the proximal promoter, negative strand, positive direction. There are four: between 4365 and 4392 and their complements in the positive direction.
-===Distal promoters===
-Between ZSCAN22 and A1BG, negative strand, negative direction: 3'-AGAGGA-5' at 3387, 3'-AGAGGA-5' at 3638, and 3'-AGAGGA-5' at 3675. One inverse and its complement 3'-AGGAGA-5' at 3790. There are 14 H boxes: between 788 and 4124.
-On the positive strand, negative direction, there are 127 H boxes: between 608 and 4395.
-Between ZNF497 and A1BG: There are two H boxes after nucleotide number 2300 in the negative strand and positive direction: between 420 and 530, and 3'-ACACCA-5' at 2603 and 3'-ACACCA-5' at 3825.
-There are two H boxes after nucleotide number 2300 in the positive strand and positive direction: 3'-ACACCA-5' at 204, 3'-ACACCA-5' at 528, 3'-ACACCA-5' at 3643 and 3'-ACACCA-5' at 3967.
-Regarding 3'-ANANNA-5', on the negative strand, positive direction, there are 25 H boxes: between 2591 and 4154.
-On the positive strand, positive direction there are 20 H boxes: between 2347 and 4168.
-There inverses on the negative strand in the positive direction of 31 H boxes: between 2412 and 4166.
-==HMG boxes==
-{{main|HMG box gene transcriptions}}
-"Most HMG box proteins contain two or more HMG boxes and appear to bind DNA in a relatively sequence-aspecific manner (5, 13, 15, 16 and references therein). [...] they all appear to bind to the minor groove of the A/T A/T C A A A G-motif (10, 14, 18-20)."<ref name=Laudet>{{ cite journal
-|author=Vincent Laudet, Dominique Stehelin and Hans Clevers
-|title=Ancestry and diversity of the HMG box superfamily
-|journal=Nucleic Acids Research
-|date=1993
-|volume=21
-|issue=10
-|pages=2493-501
-|url=https://academic.oup.com/nar/article-pdf/21/10/2493/4086740/21-10-2493.pdf
-|arxiv=
-|bibcode=
-|doi=10.1093/nar/21.10.2493
-|pmid=8506143
-|accessdate=2017-04-05 }}</ref>
-Copying an apparent consensus sequence of (A/T)(A/T)CAAAG and putting it in "⌘F" finds none located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-==HNFs==
-{{main|HNF gene transcriptions}}
-Gene ID: 6927 is [[HNF1A]] HNF1 homeobox A aka TCF1 on 12q24.31: "The protein encoded by this gene is a transcription factor required for the expression of several liver-specific genes. The encoded protein functions as a homodimer and binds to the inverted palindrome 5'-GTTAATNATTAAC-3'. Defects in this gene are a cause of maturity onset diabetes of the young type 3 (MODY3) and also can result in the appearance of hepatic adenomas. Alternative splicing results in multiple transcript variants encoding different isoforms."<ref name=RefSeq6927>{{ cite book
-|vauthors=RefSeq
-|title=HNF1A HNF1 homeobox A [ Homo sapiens (human) ]
-|publisher=National Center for Biotechnology Information, U.S. National Library of Medicine
-|location=8600 Rockville Pike, Bethesda MD, 20894 USA
-|date=April 2015
-|url=https://www.ncbi.nlm.nih.gov/gene/6927
-|accessdate=7 November 2018 }}</ref>
-"Canonical Wnt signaling results in the accumulation and binding of β-catenin to DNA-binding partner TCF1."<ref name=Li2020/> TCF-1 binding site is CCTTTGA.<ref name=Li2020/>
-"HNF3 can bind to the site in the absence of HNF6 (Lahuna et al. 1997)."<ref name="Gardmo">{{cite journal
-|author=Cissi Gardmo and Agneta Mode
-|date=1 December 2006
-|title=In vivo transfection of rat liver discloses binding sites conveying GH-dependent and female-specific gene expression
-|url=http://jme.endocrinology-journals.org/content/37/3/433.full
-|journal=Journal of Molecular Endocrinology
-|volume=37
-|issue=3
-|pages=433-441
-|arxiv=
-|bibcode=
-|doi=10.1677/jme.1.02116
-|pmid=17170084
-|accessdate=2017-09-01 }}</ref>
-===HNF6 core promoters===
-Inverse complement, positive strand, negative direction there is 1: 3'-TTATTAATTC-5', 4542.
-===HNF6 proximal promoters===
-Negative strand in the negative direction there is 1: 3'-TTATTAATCG-5', 4229.
-Negative strand in the positive direction there are 2: 3'-TTATTAATCA-5', 4147, 3'-TTATTGATTA-5', 4164.
-Inverse complement, positive strand, positive direction there are 1: 3'-ATATTAACAA-5', 4172.
-===HNF6 distal promoters===
-Negative strand in the negative direction there are 2: 3'-GTGTTAATAA-5', 1725, 3'-TAGTTGATAA-5', 3527.
-Positive strand in the negative direction there is 1: 3'-AAATTGATAA-5', 3361.
-Inverse complement, negative strand, negative direction there are 2: 3'-ACATGGACAT-5', 802, 3'-TAATGAACTT-5', 1301.
-Inverse complement, positive strand, negative direction there are 2: 3'-AAATTGATAA-5', 3361, 3'-TCATCAACTA-5', 3525.
-Negative strand in the positive direction there are 1: 3'-ATGTCCATGG-5', 3581.
-Positive strand in the positive direction there is 1: 3'-GAGTCCATTG-5', 3732.
-Inverse complement, positive strand, positive direction there is 1: 3'-CCATTGACTC-5', 3736.
-==Homeoboxes==
-{{main|Homeobox gene transcriptions}}
-"Transcription factors Pax-4 and Pax-6 are known to be key regulators of pancreatic cell differentiation and development. [...] The gene-targeting experiments revealed that Pax-4 and Pax-6 cannot substitute for each other in tissue with overlapping expression of both genes. [The] DNA-binding specificities of Pax-4 and Pax-6 are similar. The Pax-4 homeodomain [HD] was shown to preferentially dimerize on DNA sequences consisting of an inverted TAAT motif, separated by 4-nucleotide spacing."<ref name=Kalousova>{{ cite journal
-|author=Anna Kalousová, Vladimı́r Beneš, Jan Pačes, Václav Pačes and Zbyněk Kozmik
-|title=DNA Binding and Transactivating Properties of the Paired and Homeobox Protein Pax4
-|journal=Biochemical and Biophysical Research Communications
-|date=June 1999
-|volume=259
-|issue=3
-|pages=510-518
-|url=https://www.sciencedirect.com/science/article/abs/pii/S0006291X99908094
-|arxiv=
-|bibcode=
-|doi=
-|pmid=10364449
-|accessdate=6 May 2020 }}</ref>
-The "crucial difference between the binding sites of Antennapedia class and TTF-1 HDs is in the motifs 5'-TAAT-3', recognized by Antennapedia [a Hox gene, a subset of homeobox genes, first discovered in Drosophila which controls the formation of legs during development], and 5'-CAAG-3', preferentially bound by TTF-1. [The] binding of wild type and mutants TTF-1 HD to oligonucleotides containing either 5'-TAAT-3' or 5'-CAAG-3' indicate that only in the presence of the latter motif the Gln<sub>50</sub> in TTF-1 HD is utilized for DNA recognition."<ref name=Damante>{{ cite journal
-|author=G. Damante, D. Fabbro, L. Pelizari, D. Civitareale, S. Guazzi, M. Polycarpou-Schwartz, S. Cauci, F. Quadrifoglio, S. Formisano and R. Di Lauro
-|title=Sequence-specific DNA recognition by the thyroid transcription factor-1 homeodomain
-|journal=Nucleic Acids Research
-|date=20 June 1994
-|volume=22
-|issue=15
-|pages=3075-83
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC310278/pdf/nar00039-0221.pdf
-|arxiv=
-|bibcode=
-|doi=10.1093/nar/22.15.3075
-|pmid=7915030
-|accessdate=6 May 2020 }}</ref>
-Copying a portion of the homeobox motif of CAAG and putting it in "⌘F" finds eight located between ZSCAN22 and A1BG and 21 between ZNF497 and A1BG as can be found by the computer programs.
-==Hsf1ps==
-{{main|Hsf1p gene transcriptions}}
-The upstream activating sequence (UAS) for the Hsf1p is 5'-NGAAN-3' or 5'-(A/C/G/T)GAA(A/C/G/T)-3'.<ref name=Tang>{{ cite journal
-|author=Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling
-|title=Promoter Architecture and Promoter Engineering in ''Saccharomyces cerevisiae''
-|journal=Metabolites
-|date=6 August 2020
-|volume=10
-|issue=8
-|pages=320-39
-|url=https://www.mdpi.com/2218-1989/10/8/320/pdf
-|arxiv=
-|bibcode=
-|doi=10.3390/metabo10080320
-|pmid=32781665
-|accessdate=18 September 2020 }}</ref>
-Copying 5'-TGAAA-3' in "⌘F" yields twelve between ZSCAN22 and A1BG and 5'-CGAAC-3' one between ZNF497 and A1BG as can be found by the computer programs.
-==HY boxes==
-{{main|HY box gene transcriptions}}
-===Core promoters===
-Positive strand in the negative direction there is 1: 3'-TGAGGG-5' at 4558.
-Inverse complement, negative strand, negative direction there is 1: 3'-CCCTCA-5', 4498.
-Negative strand in the positive direction there is 1: 3'-TGTGGG-5', 4395.
-===Distal promoters===
-Negative strand in the negative direction there is 1: 3'-TGTGGG-5' at 749.
-Positive strand in the negative direction there are 4: between 88 and 3712.
-Inverse complement, negative strand, negative direction there are 3: between 2702 and 3889.
-Positive strand in the positive direction there are 2: 3'-TGTGGG-5', 2965, 3'-TGTGGG-5', 3533.
-Negative strand in the positive direction there are 3: between 258 and 3879.
-Inverse complement, negative strand, positive direction there are 3: between 88 and 3503.
-Inverse complement, positive strand, positive direction there is 5: between 494 and 3185.
-==Initiator elements (YYANWYY)==
-{{main|Initiator element gene transcriptions}}
-===Core promoters===
-There is the following Inr in the core promoter, negative strand, negative direction: 3'-TTACTCC-5' at 4557.
-There are four Inrs in the core promoter, positive strand, negative direction: between 4425 and at 4542.
-There is the following Inr in the core promoter, negative strand, positive direction: 3'-CTGCACC-5' at 4343.
-There are two Inrs in the core promoter, positive strand, positive direction: 3'-CCACTCC-5' at 4401 and 3'-CCAGACC-5' at 4416.
-===Proximal promoters===
-There are eight Inrs on the negative strand in the negative direction: between 4202 and 4557.
-There are seven Inrs on the positive strand in the negative direction: between 4327 and 4542.
-There is one Inr on the negative strand in the positive direction: 3'-CTGCACC-5' at 4343.
-There is two Inrs on the positive strand in the positive direction: 3'-CCACTCC-5' at 4401 and 3'-CCAGACC-5' at 4416.
-===Distal promoters===
-Negative strand in the negative direction there are 87: between 71 and 4188.
-Positive strand in the negative direction there are 40: between 20 and 3967.
-Inverse complement, negative strand, negative direction there are 32: between 213 and 3967.
-Negative strand in the positive direction there are 45: between 115 and 4139.
-Positive strand in the positive direction there are 75: between 40 and 4136.
-Inverse complement, negative strand, positive direction there are 61: between 53 and 4136.
-Inverse complement, positive strand, negative direction there are 100: between 17 and 4177.
-Inverse complement, positive strand, positive direction there are 75: between 524 and 4138.
-==Initiator elements (BBCABW)==
-{{main|Initiator element gene transcriptions}}
-===Core promoters===
-There are five Inrs, positive strand, negative direction: between 4423 and 4531.
-There are five Inrs, negative strand, positive direction: between 4271 and 4338.
-There are four Inrs, positive strand, positive direction: between 4269 and 4414.
-===Proximal promoters===
-There are five Inrs on the negative strand in the negative direction: between 4200 and 4359.
-There are nine Inrs on the positive strand in the negative direction: between 4233 and 4531.
-There is six Inrs on the negative strand in the positive direction: between 4195 and 4338.
-There is four Inrs on the positive strand in the positive direction: between 4269 and 4414.
-===Distal promoters===
-Negative strand in the negative direction there are 44: between 179 and 3939.
-Positive strand in the negative direction there are 59: between 39 and 3965.
-Inverse complement, negative strand, negative direction there are 46: 3'-TCTGAC-5', 16: between 62 and 3983.
-Inverse complement, positive strand, negative direction there are 54, 3'-ACTGAA-5', 18: between 78 and 4093.
-Negative strand in the positive direction there 87: between 15 and 4013.
-Positive strand in the positive direction there are 40: between 153 and 4056.
-Inverse complement, negative strand, positive direction there are 94: between 54 and 4095.
-Inverse complement, positive strand, positive direction there are 47: between 236 and 4127.
-==Jasmonic acid-responsive elements==
-{{main|Jasmonic acid-responsive element gene transcriptions}}
-Jasmonic acid-responsive elements (TGACG, CGTCA).<ref name=Sharma>{{ cite journal
-|author=Bhaskar Sharma & Joemar Taganna
-|title=Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato
-|journal=Scientific Reports
-|date=12 June 2020
-|volume=10
-|issue=9581
-|pages=
-|url=https://www.nature.com/articles/s41598-020-66553-1
-|arxiv=
-|bibcode=
-|doi=10.1038/s41598-020-66553-1
-|pmid=32533036
-|accessdate=27 August 2020 }}</ref>
-Copying an apparent consensus sequence for the jasmonic acid-responsive element (JARE)<ref name=Kim>{{ cite journal
-|author=Young Jin Kim, Dong Gwan Kim, Sun Hi Lee and Incheol Lee
-|title=Wound-induced expression of the ferulate 5-hydroxylase gene in ''Camptotheca acuminata''
-|journal=Biochimica et Biophysica Acta (BBA) - General Subjects
-|date=February 2006
-|volume=1760
-|issue=2
-|pages=182-190
-|url=https://www.sciencedirect.com/science/article/abs/pii/S0304416505003351
-|arxiv=
-|bibcode=
-|doi=10.1016/j.bbagen.2005.08.015
-|pmid=16332414
-|accessdate=9 September 2020 }}</ref> of TGACG and putting it in "⌘F" finds eight located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Krüppel-like factors==
-{{main|Krüppel-like factor gene transcriptions}}
-"Krüppel-like factor 1 (KLF1/EKLF) is a transcription factor that globally activates genes involved in erythroid cell development. [...] KLF1 belongs to the KLF family of transcription factors that binds the G-rich strand of so-called CACCC-box motifs located in regulatory regions of numerous erythroid genes."<ref name=Kulczynska>{{ cite journal
-|author=Klaudia Kulczynska, James J. Bieker, Miroslawa Siatecka
-|title=A ''Krüppel-like factor 1 (KLF1)'' Mutation Associated with Severe Congenital Dyserythropoietic Anemia Alters Its DNA-Binding Specificity
-|journal=Molecular and Cellular Biology
-|date=12 February 2020
-|volume=40
-|issue=5
-|pages=e00444-19
-|url=
-|arxiv=
-|bibcode=
-|doi=10.1128/MCB.00444-19
-|pmid=31818881
-|accessdate=29 August 2020 }}</ref>
-"Using the ''in vitro'' CASTing method, we identified a new set of sequences bound by [congenital dyserythropoietic anemia] CDA-KLF1, and based on them we defined the consensus binding site as 5′-NGG-GG(T/G)-(T/G)(T/G)(T/G)-3′. It differs from the consensus binding sites for [wild-type] WT-KLF1, 5′-NGG-G(C/T)G-(T/G)GG-3′, and for [neonatal anemia] Nan-KLF1, 5′-NGG-G(C/A)N-(T/G)GG-3′, as well."<ref name=Kulczynska/>
-An apparent consensus is GGG(A/C/G/T)(A/C/G/T)(G/T)(G/T)(G/T).
-Copying an apparent consensus sequence for the KLF of GGGTCGTG and putting it in "⌘F" finds six located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-==M35 boxes==
-{{main|M35 box gene transcriptions}}
-Negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesM35--.bas, looking for 3'-TTGACA-5', 2, 3'-TTGACA-5', 477, 3'-TTGACA-5', 4399.
-==Metal responsive elements==
-{{main|Metal responsive element gene transcriptions}}
-===Proximal promoters===
-On the positive strand in the negative direction there is an MRE 3'-TGCACTC-5' at 4341.
-===Distal promoters===
-Positive strand in the negative direction there are 6: between 891 and 3290.
-Inverse complement, negative strand, negative direction there are 2: 3'-GTGTGCA-5', 531, 3'-GAGTGCA-5', 1772.
-Inverse complement, positive strand, negative direction there are 2: 3'-GAGTGCA-5', 1470, 3'-GTGTGCA-5', 2863.
-Negative strand in the positive direction there are 11: between 453 and 3323.
-Positive strand in the positive direction there are 2: 3'-TGCGCCC-5', 872, 3'-TGCGCCC-5', 972.
-Inverse complement, negative strand, positive direction there are 10: between 546 and 3883.
-==MYB recognition elements==
-{{main|MYB recognition element gene transcriptions}}
-"These elements fit the type II MYB consensus sequence A(A/C)C(A/T)A(A/C)C, suggesting that they are MYB recognition elements (MREs)."<ref name=Rushton>{{ cite journal
-|author=Paul J Rushton and Imre E Somssich
-|title=Transcriptional control of plant genes responsive to pathogens
-|journal=Current Opinion in Plant Biology
-|date=August 1998
-|volume=1
-|issue=4
-|pages=311-5
-|url=http://arquivo.ufv.br/dbv/pgfvg/bve684/htms/pdfs_revisao/estresse/transcriptional.pdf
-|arxiv=
-|bibcode=
-|doi=10.1016/1369-5266(88)80052-9
-|pmid=10066598
-|accessdate=5 November 2018 }}</ref>
-MYB binding site involved in drought induction (TAACTG).<ref name=Sharma/>
-Copying an apparent core consensus sequence for the MYBRE of AACAAAC or TAACTG and putting it in "⌘F" finds none located between ZSCAN22 and none or one between ZNF497 and A1BG as can be found by the computer programs.
-==Myocyte enhancer factor 2 (MEF2)==
-{{main|Myocyte enhancer factor gene transcriptions}}
-Myocyte enhancer factor-2 (MEF2) [[protein]]s are a family of [[transcription factor]]s which through control of [[gene expression]] are important regulators of [[cellular differentiation]] and consequently play a critical role in embryonic development.<ref name="pmid17959722">{{ cite journal |vauthors=Potthoff MJ, Olson EN | title = MEF2: a central regulator of diverse developmental programs | journal = Development | volume = 134 | issue = 23 | pages = 4131–40 |date=December 2007 | pmid = 17959722
-| doi = 10.1242/dev.008367
-| url =  }}</ref>  In adult organisms, Mef2 proteins mediate the stress response in some tissues.<ref name="pmid17959722"/>
-"The current study delineates the conformational paradigm, clustered recognition, and comparative DNA binding preferences for MEF2A and MEF2B-specific MADS-box/MEF2 domains at the YTA(A/T)4TAR consensus motif."<ref name=Zia>{{ cite journal
-|author=Ayisha Zia, Muhammad Imran, and Sajid Rashid
-|title=In Silico Exploration of Conformational Dynamics and Novel Inhibitors for Targeting MEF2-Associated Transcriptional Activity
-|journal=Journal of Chemical Information and Modeling
-|date=7 February 2020
-|volume=60
-|issue=3
-|pages=1892-1909
-|url=https://pubs.acs.org/doi/abs/10.1021/acs.jcim.0c00008
-|arxiv=
-|bibcode=
-|doi=10.1021/acs.jcim.0c00008
-|pmid=
-|accessdate=10 September 2020 }}</ref> Y = (C/T) and R = (A/G). The consensus sequence is (C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G).<ref name=Zia/>
-Copying an apparent consensus sequence for the TTATAT or CTAATT and putting it in "⌘F" finds two (TTATAT) located between ZSCAN22 and one (CTAATT) between ZNF497 and A1BG as can be found by the computer programs.
-==Nuclear factor kappa-light-chain-enhancer of activated B cells==
-{{main|Nuclear factor gene transcriptions}}
-The "natural 11 bp 𝜿B binding site MHC H-2 [is 3'-CCCCTAAGGGG-5'] which is well ordered in our structure."<ref name=Cramer>{{ cite journal
-|author=Patrick Cramer, Christopher J. Larson, Gregory L. Verdine and Christoph W. Müller
-|title=Structure of the human NF‐κB p52 homodimer‐DNA complex at 2.1 Å resolution
-|journal=The EMBO Journal
-|date=1 December 1997
-|volume=16
-|issue=23
-|pages=7078-90
-|url=https://www.embopress.org/doi/10.1093/emboj/16.23.7078
-|arxiv=
-|bibcode=
-|doi=10.1093/emboj/16.23.7078
-|pmid=9384586
-|accessdate=3 May 2020 }}</ref>
-Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC).<ref name=Sato/>
-Copying an apparent core consensus sequence for the NF𝛋B of GAATTC and putting it in "⌘F" finds three cores located between ZSCAN22 and none between ZNF497 and A1BG as can be found by the computer programs.
-==Nuclear factor of activated T cell transcriptions==
-{{main|Nuclear factor of activated T cell gene transcriptions (NFAT)}}
-Mutation "of the core NFATp binding sequence (GGAAAA) in the IL2 promoter NFAT site entirely eliminates the function of the site, as does mutation of an adjacent non-canonical AP-1 site that is not essential for NFATp binding but that is required for formation of the NFATp-Fos-Jun complex(6, 15).<sup>3</sup>"<ref name=Jain>{{ cite journal
-|author=Jugnu Jain, Emmanuel Burgeon, Tina M. Badalian, Patrick G. Hogan and Anjana Rao
-|title=A Similar DNA-binding Motif in NFAT Family Proteins and the Rel Homology Region
-|journal=Journal of Biological Chemistry
-|date=24 February 1995
-|volume=270
-|issue=8
-|pages=4138-4145
-|url=https://www.jbc.org/content/270/8/4138.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1074/jbc.270.8.4138
-|pmid=7876165
-|accessdate=15 August 2020 }}</ref>
-Copying an apparent consensus sequence for the NFAT GGAAAA and putting it in "⌘F" finds none located between ZSCAN22 and one between ZNF497 and A1BG as can be found by the computer programs.
-==Nuclear factor 1==
-{{main|Nuclear factor gene transcriptions}}
-Nuclear factor 1 (NF-1) is a family of closely related [[transcription factor]]s that constitutively bind as dimers to specific sequences of DNA with high affinity.<ref name=Blomquist>{{ cite journal
-|vauthors=Blomquist P, Belikov S, Wrange O
-|title=Increased nuclear factor 1 binding to its nucleosomal site mediated by sequence-dependent DNA structure
-|journal=Nucleic Acids Research
-|volume=27
-|issue=2
-|pages=517–25
-|date=January 1999
-|pmid=9862974
-|pmc=148209
-|doi= 10.1093/nar/27.2.517
-|url= }}</ref> Family members contain an unusual [[DNA binding domain]] that binds to the [[recognition sequence]] 5'-TTGGCXXXXXGCCAA-3'.<ref name=Boron>{{ cite book
-|author=Walter F. Boron
-|title=Medical Physiology: A Cellular And Molecular Approach
-|publisher=Elsevier/Saunders
-|location=
-|year=2003
-|pages=125–126
-|isbn=1-4160-2328-3
-|oclc=
-|doi= }}</ref>
-Consensus sequences for the nuclear factor 1 are TGGCA, TGGCG and TGGAA.<ref name=Yao2016/>
-An apparent consensus sequence for the NF1 is TGG(A/C)(A/G).
-Copying an apparent consensus sequence for the NF1 TGGCA and putting it in "⌘F" finds none located between ZSCAN22 and five between ZNF497 and A1BG as can be found by the computer programs.
-==p63 DNA-binding sites==
-{{main|P63 DNA-binding site gene transcriptions}}
-"p63 bound preferentially to DNA fragments conforming to the 20 bp sequence 5'-RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY-3'."<ref name=Perez>{{ cite journal
-|author=C A Perez, J Ott, D J Mays & J A Pietenpol
-|title=p63 consensus DNA-binding site: identification, analysis and application into a p63MH algorithm
-|journal=Oncogene
-|date=15 November 2007
-|volume=26
-|issue=52
-|pages=7363-70
-|url=https://pubmed.ncbi.nlm.nih.gov/17563751/
-|arxiv=
-|bibcode=
-|doi=10.1038/sj.onc.1210561
-|pmid=17563751
-|accessdate=28 August 2020 }}</ref>
-The apparent consensus sequence is (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T).
-Copying an apparent consensus sequence for the P63 (GAGCGAGCCT) and putting it in "⌘F" finds none located between ZSCAN22 and one between ZNF497 and A1BG as can be found by the computer programs.
-==P boxes==
-{{main|P box gene transcriptions}}
-"As VRI [target gene: vrille (VRI)] accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus of V box: A(/G)TTA(/T)T(/C), of P-box: GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."<ref name=Yu>{{ cite journal
-|author=Wangjie Yu and Paul E. Hardin
-|title=Circadian oscillators of ''Drosophila'' and mammals
-|journal=Journal of Cell Science
 |date=2006
-|volume=119
+|pmid=16432200
-|issue=
+|pmc=1345710
-|pages=4793-5
+|doi=10.1073/pnas.0510310103 }}</ref>
-|url=http://jcs.biologists.org/content/119/23/4793.short
-|arxiv=
-|bibcode=
-|doi=10.1242/jcs.03174
-|pmid=17130292
-|accessdate=2017-02-19 }}</ref>
-Copying the apparent consensus sequence for the P box (GTAA(T/C)) and putting it in "⌘F" finds seven located between ZSCAN22 and one between ZNF497 and A1BG as can be found by the computer programs.
+The number of CG or GC pairs near the TSS for A1BG appears to be low: between ZSCAN22 and A1BG are 8.2 % CG/GC and between ZNF497 and A1BG are 15 % CG/GC.
-==Peroxisome proliferator hormone response elements==
+==19q13.43==
-{{main|Peroxisome proliferator hormone response element gene transcriptions}}
+{{main|Genes on 19q13.43}}
-"After activation by ligands, PPARs/RXRs heterodimers bind to PPRE consensus sequence (AGGTCANAGGTCA) in the promoter of their target genes."<ref name=You>{{ cite journal
-|author=Mengli You, Shuping Yuan, Juanjuan Shi, Yongzhong Hou
-|title=PPARδ signaling regulates colorectal cancer
-|journal=Current Pharmaceutical Design
-|date=1 June 2015
-|volume=21
-|issue=21
-|pages=2956-2959
-|url=https://www.ingentaconnect.com/content/ben/cpd/2015/00000021/00000021/art00006#expand/collapse
-|arxiv=
-|bibcode=
-|doi=10.2174/1381612821666150514104035
-|pmid=26004416
-|accessdate=10 September 2020 }}</ref>
-The DNA consensus sequence is AGGTCANAGGTCA, with N being any nucleotide.
+==Regulatory elements and regions==
+{{main|A1BG regulatory elements and regions}}
-Peroxisome proliferator hormone response elements (PPREs) consensus sequences are AGGGGA and TCCCCT.<ref name=Yao>{{ cite journal
+==Functions of A1BG==
-| vauthors = Yao EF, Denison MS
-| title = DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer
-| journal = Biochemistry
-| volume = 31
-| issue = 21
-| pages = 5060–7
-| date = June 1992
-| pmid = 1318077
-| doi = 10.1021/bi00136a019 }}</ref>
-Copying the apparent consensus sequence for the PPRE (AGGGGA) and putting it in "⌘F" finds none located between ZSCAN22 or three between ZNF497 and A1BG as can be found by the computer programs.
+"Receptors of the leukocyte receptor cluster (LRC) play a range of important functions in the human immune system."<ref name=Guselnikov>{{ cite journal
+|author=Sergey V Guselnikov and Alexander V Taranin
-==Phosphate starvation-response transcription factors==
+|title=Unraveling the LRC Evolution in Mammals: IGSF1 and A1BG Provide the Keys
-{{main|Phosphate starvation-response transcription factor gene transcriptions}}
+|journal=Genome Biology and Evolution
-"The [palindromic E-box motif (CACGTG)] motif is bound by the transcription factor Pho4, [and has the] class of basic helix-loop-helix DNA binding domain and core recognition sequence (Zhou and O'Shea 2011)."<ref name=Rossi>{{ cite journal
+|date=1 June 2019
-|author=Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh
+|volume=11
-|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
-|journal=Genome Research
-|date=21 March 2018
-|volume=28
-|issue=
-|pages=497-508
-|url=https://genome.cshlp.org/content/28/4/497.full
-|arxiv=
-|bibcode=
-|doi=10.1101/gr.229518.117
-|pmid=29563167
-|accessdate=31 August 2020 }}</ref>
-The Pho4 homodimer binds to DNA sequences containing the bHLH binding site 5'-CACGTG-3'.<ref name=Shao>{{ cite journal
-|author=Dalei Shao, Caretha L. Creasy, Lawrence W. Bergman
-|title = A cysteine residue in helixII of the bHLH domain is essential for homodimerization of the yeast transcription factor Pho4p
-|journal = Nucleic Acids Research
-|volume = 26
-|issue = 3
-|pages = 710–4
-|date= 1 February 1998
-|pmid = 9443961
-|pmc = 147311
-|doi = 10.1093/nar/26.3.710
-|url = https://academic.oup.com/nar/article/26/3/710/1052045 }}</ref>
-Copying the apparent consensus sequence for the Pho (CACGTG) and putting it in "⌘F" finds none located between ZSCAN22 or one between ZNF497 and A1BG as can be found by the computer programs.
-==Pollen1 elements==
-{{main|Pollen1 element gene transcriptions}}
-"Electrophoretic mobility shift assays identified a pollen-specific ''cis''-acting element POLLEN1 (AGAAA) mapped at ''AtACBP4'' (−157/−153) which interacted with nuclear proteins from flower and this was substantiated by DNase I footprinting."<ref name=Ye/>
-"Given that ''AtACBP4pro::GUS'' (−156/−67) could drive promoter activity for pollen expression, [electrophoretic mobility shift assays] EMSAs were carried out to investigate the role of the putative POLLEN1 ''cis''-element, AGAAA (−150/−146), and its adjacent co-dependent regulatory element TCCACCATA (–141/–133)."<ref name=Ye/>
-"POLLEN1 and the TCCACCATA element are co-dependent regulatory elements responsible for pollen-specific activation of tomato ''LAT52'' (Bate and Twell 1998)."<ref name=Ye/>
-Copying the consensus for POLLEN1: 3'-AGAAA-5' and putting the sequence in "⌘F" finds many locations for this sequence in the A1BG directions as can be found by the computer programs.
-==Pribnow boxes==
-{{main|Pribnow box gene transcriptions}}
-# negative strand in the negative direction, looking for 3'-TATAAT-5', 2, 3'-TATAAT-5', 3454, 3'-TATAAT-5', 3468,
-# negative strand in the positive direction, looking for 3'-TATAAT-5', 1, 3'-TATAAT-5', 729,
-# complement, positive strand, negative direction, looking for 3'-ATATTA-5', 2, 3'-ATATTA-5', 3454, 3'-ATATTA-5', 3468,
-# complement, positive strand, positive direction, looking for 3'-ATATTA-5', 1, 3'-ATATTA-5', 729,
-# inverse complement, negative strand, negative direction, looking for 3'-ATTATA-5', 2, 3'-ATTATA-5', 272, 3'-ATTATA-5', 603,
-# inverse complement, negative strand, positive direction, looking for 3'-ATTATA-5', 1, 3'-ATTATA-5', 727,
-# inverse, positive strand, negative direction, looking for 3'-TAATAT-5', 2, 3'-TAATAT-5', 272, 3'-TAATAT-5', 603,
-# inverse, positive strand, positive direction, looking for 3'-TAATAT-5', 1, 3'-TAATAT-5', 727.
-==Prolamin boxes==
-{{main|Prolamin box gene transcriptions}}
-# negative strand in the negative direction: 1, 3'-TGTAAAG-5', 2884,
-# negative strand in the positive direction: 1, 3'-TGAAAAG-5', 489,
-# positive strand in the negative direction: 1, 3'-TGAAAAG-5', 1627.
-==Pyrimidine boxes==
-{{main|Pyrimidine box gene transcriptions}}
-Pyrimidine boxes and their complements in the negative direction: 3'-CCTTTT-5' at 2459, 3'-CCTTTT-5' at 2927, and 3'-CCTTTT-5' at 2968 occur. Inverse pyrimidine boxes and their complements occur 3'-AAAAGG-5' at 105, 3'-AAAAGG-5' at 1107, 3'-AAAAGG-5' at 3345, and 3'-AAAAGG-5' at 3441.
-Pyrimidine boxes in the positive direction: 3'-CCTTTT-5' at 135 and 3'-CCTTTT-5' at 291 and their complements are close to ZNF497.
-==Q elements==
-{{main|Q element gene transcriptions}}
-"The basal regulatory elements identified include a putative TATA-box (−30/−24) for RNA polymerase binding and a CAAT box (−64/−61; [...]). Several putative floral expression-related cis-elements identified included a putative 6-nucleotide Q element (−770/−665), three GTGA boxes (−372/−369, −209/−206 and −164/−161) and four putative highly-conserved POLLEN1 boxes (−737/−733, −711/−707, −150/−146 and −36/−32; [...])."<ref name=Ye>{{ cite journal
-|author=Zi-Wei Ye, Jie Xu, Jianxin Shi, Dabing Zhang and Mee-Len Chye
-|title=Kelch-motif containing acyl-CoA binding proteins AtACBP4 and AtACBP5 are differentially expressed and function in floral lipid metabolism
-|journal=Plant Molecular Biology
-|date=January 2017
-|volume=93
-|issue=
-|pages=209-225
-|url=https://www.researchgate.net/profile/Jianxin_Shi6/publication/309799453_Kelch-motif_containing_acyl-CoA_binding_proteins_AtACBP4_and_AtACBP5_are_differentially_expressed_and_function_in_floral_lipid_metabolism/links/5d11201c458515c11cf5f6b1/Kelch-motif-containing-acyl-CoA-binding-proteins-AtACBP4-and-AtACBP5-are-differentially-expressed-and-function-in-floral-lipid-metabolism.pdf
-|arxiv=
-|bibcode=
-|doi=10.1007/s11103-016-0557-5
-|pmid=27826761
-|accessdate=7 May 2020 }}</ref>
-The consensus sequence for a Q element is 3'-AGGTCA-5'.<ref name=Ye/>
-Copying the apparent consensus sequence for the QE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 or three between ZNF497 and A1BG as can be found by the computer programs.
-==Rap1 regulatory factors==
-{{main|Rap1 regulatory factor gene transcriptions}}
-Consensus sequences: C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T).<ref name=Rossi/>
-"Rap1 is another GRF that organizes chromatin, binds promoters of genes that encode ribosomal and glycolytic proteins, and binds telomeres (Shore 1994; Ganapathi et al. 2011; Hughes and de Boer 2013). [...] DNA shape analysis revealed that Rap1 motifs possess an intrinsically wide minor groove spanning the central degenerate region of the motif that was wider at binding-competent sites [...]. A clear trend was observed between increased width of the minor groove in the central degenerate region of the motif and increased Rap1 binding in vitro."<ref name=Rossi/>
-Copying an apparent consensus sequence for Rap1 (CCCACCAACAAAA) and putting it in "⌘F" finds none located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs.
-==Reb1 general regulatory factors==
-{{main|Reb1 general regulatory factor gene transcriptions}}
-Purified "Reb1 bound [...] exact TTACCCK occurrences [...] with >60% of 780 occurrences at promoters. [And can have] the extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."<ref name=Rossi>{{ cite journal
-|author=Matthew J. Rossi, William K.M. Lai and B. Franklin Pugh
-|title=Genome-wide determinants of sequence-specific DNA binding of general regulatory factors
-|journal=Genome Research
-|date=21 March 2018
-|volume=28
-|issue=
-|pages=497-508
-|url=https://genome.cshlp.org/content/28/4/497.full
-|arxiv=
-|bibcode=
-|doi=10.1101/gr.229518.117
-|pmid=29563167
-|accessdate=31 August 2020 }}</ref> K = G, T; V = not T, N - aNy base and H = not G.
-Copying the apparent consensus sequence for Reb1 (TTACCC(G/T)) and putting it in "⌘F" finds one located between ZSCAN22 or none between ZNF497 and A1BG as can be found by the computer programs. However, an extended Reb1 (ATTACCCGAA) finds none located between ZSCAN22 or between ZNF497 and A1BG.
-==Retinoblastoma control elements==
-{{main|TC element gene transcriptions}}
-"Robbins ''et al.'' (18) have reported that expression of pRB in mouse fibroblasts suppresses transcription of c-''fos'' and have identified an element, termed the retinoblastoma control element (RCE), in the c-''fos'' promoter necessary for this suppression. More recently, sequences homologous to the RCE have been identified in the TGF-''β''1, -''β''2, and -''β''3 promoters by Kim ''et al.'' (19)."<ref name=Pietenpol>{{ cite journal
-|author=Jennifer A. Pietenpol, Karl Munger, Peter M. Howley, Roland W. Stein and Harold L. Moses
-|title=Factor-binding element in the human c-''myc'' promoter involved in transcriptional regulation by transforming growth factor ''β''1 and by the retinoblastoma gene product
-|journal=Proceedings of the National Academy of Sciences USA
-|date=November 15, 1991
-|volume=88
-|issue=22
-|pages=10227-10231
-|url=http://www.pnas.org/content/pnas/88/22/10227.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1073/pnas.88.22.10227
-|pmid=1946442
-|accessdate=5 December 2018 }}</ref>
-"Comparison of the sequence of the newly cloned mouse MMP-9 promoter region with our previous human isolate revealed that [...] four units of GGGG(T/A)GGGG sequence (GT box) were conserved between the two species."<ref name=Sato>{{ cite journal
-|author=Hiroshi Sato, Megumi Kita, and Motoharu Seiki
-|title=v-Src Activates the Expression of 92-kDa Type IV Collagenase Gene through the AP-1 Site and the GT Box Homologous to Retinoblastoma Control Elements
-|journal=The Journal of Biological Chemistry
-|date=5 November 1993
-|volume=268
-|issue=31
-|pages=23460-8
-|url=https://www.jbc.org/content/268/31/23460.full.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=8226872
-|accessdate=13 August 2020 }}</ref>
-"Expression of some matrix metalloproteinases (MMPs) are regulated by cytokines and tumor promoters, namely tumor necrosis factor-𝛂 (TNF-𝛂), epidermal growth factor, interleukin-1, and 12-''O''-tetradecanoylphorbol-13-acetate (TPA) (15-20)."<ref name=Sato/>
-Expression "of v-Src induces the synthesis of MMP-9, which is mediated by alterations in activity of binding factors for the AP-1 site and the sequence motif GGGGTGGGG (GT box). This GT box is homologous to the so-called retinoblastoma (Rb) control element (RCE) (29,30), and Rb can produce an anti-oncogene or tumor suppressor gene product (31-38) which is involved in regulating transcription of certain genes."<ref name=Sato/>
-Binding site for NF𝛋B in humans (GGAATTCCCC) with a core of (GAATTC), Sp-1 (CCGCCCC), 12-''O''-tetradecanoylphorbol-13-acetate (TPA) responsive element (TRE) (TGAGTCA), and GC box (GGGCGG).<ref name=Sato/>
-"Angiotensin II (Ang II) up-regulates plasminogen-activator inhibitor type-1 (PAI-1) expression in mesangial cells to enhance extracellular matrix formation. The proximal promoter region (bp -87 to -45) of the human ''PAI-1'' gene contains several potent binding sites for transcription factors [two phorbol-ester-response-element (TRE)-like sequences; D-box (-82 to -76) and P-box (-61 to 54), and one Sp1 binding site-like sequence, Sp1-box 1 (-72 to -67)]."<ref name=Motojima>{{ cite journal
-|author=Masaru Motojima, Takao Ando and Toshimasa Yoshioka
-|title=Sp1-like activity mediates angiotensin-II-induced plasminogen-activator inhibitor type-1 (''PAI-1'') gene expression in mesangial cells
-|journal=Biomedical Journal
-|date=10 July 2000
-|volume=349
-|issue=2
-|pages=435-441
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1221166/pdf/10880342.pdf
-|arxiv=
-|bibcode=
-|doi=10.1042/0264-6021:3490435
-|pmid=10880342
-|accessdate=13 August 2020 }}</ref>
-"The methylation-interference experiment demonstrated that human recombinant Sp1 bound to the so-called GT box (TGGGTGGGGCT, -78 to -69), which contains the Sp1-box 1."<ref name=Motojima/>
-D-box (TGAGTGG), Sp1-box 1 (GGGGCT), P-box (TGAGTTCA), Sp1-box 2 (CTGCCC), and TATA box (TATAAA).<ref name=Motojima/>
-Copying the apparent consensus sequence for the RCE, GT box, (GGGGTGGGG) and putting it in "⌘F" finds none located between ZSCAN22 or between ZNF497 and A1BG as can be found by the computer programs. However, RCE (GGGGAGGGG) finds none located between ZSCAN22 and one between ZNF497 and A1BG.
-==Retinoic acid response elements==
-{{main|Retinoic acid response element gene transcriptions}}
-Retinoic acid response elements (RAREs).
-"Retinoic acid is considered as the earliest factor for regulating anteroposterior axis of neural tube and positioning of structures in developing brain through retinoic acid response elements (RARE) consensus sequence (5′–AGGTCA–3′) in promoter regions of retinoic acid-dependent genes."<ref name=Kumar>{{ cite journal
-|author=Ashutosh Kumar, Himanshu N. Singh, Vikas Pareek, Khursheed Raza, Subrahamanyam Dantham, Pavan Kumar, Sankat Mochan and Muneeb A. Faiq
-|title=A Possible Mechanism of Zika Virus Associated Microcephaly: Imperative Role of Retinoic Acid Response Element (RARE) Consensus Sequence Repeats in the Viral Genome
-|journal=Frontiers in Human Neuroscience
-|date=9 August 2016
-|volume=10
-|issue=
-|pages=403
-|url=https://www.frontiersin.org/articles/10.3389/fnhum.2016.00403/full
-|arxiv=
-|bibcode=
-|doi=10.3389/fnhum.2016.00403
-|pmid=27555815
-|accessdate=7 September 2020 }}</ref>
-"Several studies have suggested that the target gene of the RA signal generally contains two direct-repeat half sites of the consensus sequence AGGTCA that are spaced by one to five base pairs (14,16,32,38)."<ref name=Gu>{{ cite journal
-|author=Ruoyi Gu, Jun Xu, Yixiang Lin, Jing Zhang, Huijun Wang, Wei Sheng, Duan Ma, Xiaojing Ma & Guoying Huang
-|title=Liganded retinoic acid X receptor α represses connexin 43 through a potential retinoic acid response element in the promoter region
-|journal=Pediatric Research
-|date=July 2016
-|volume=80
-|issue=1
-|pages=159-168
-|url=https://www.nature.com/articles/pr201647
-|arxiv=
-|bibcode=
-|doi=10.1038/pr.2016.47
-|pmid=26991262
-|accessdate=7 September 2020 }}</ref>
-"Xavier-Neto’s review demonstrated that the magic AGGTCA has high affinity but poor specificity (16). Some other [nuclear receptors] NRs also utilized the RARE with the same spacer models that are used by RXRs/RARs, for example, orphan receptors, [[Complex locus A1BG and ZNF497#Vitamin D response elements|vitamin D receptors]] (VDR) and [[Complex locus A1BG and ZNF497#Peroxisome proliferator hormone response elements|peroxisome proliferator-activated receptors]] (PPAR) (32,39). Identifying a bona fide RARE is more difficult than a simple inspection. In order to attribute the RARE in Cx43 to a candidate sequence, some observations have been conducted in our study using molecular, biological and biophysical methods and functional approaches. In a ligand-dependent luciferase assay, RARE was located between the −1,426 to −341 base pair position. The constitutively active mutant Cx43 RARE represses the luciferase activity in the absence of the ligand and has no response to the 9cRA. Our findings indicate that RARE in the Cx43 promoter is a functional element."<ref name=Gu/>
-Additional response elements that include the 5'-AGGTCA-3' are [[Complex locus A1BG and ZNF497#Q elements|Q elements]], [[Complex locus A1BG and ZNF497#ROR-response elements|ROR-response elements]] and [[Complex locus A1BG and ZNF497#Thyroid hormone response elements|Thyroid hormone response elements]].
-A likely general consensus sequence may be 5'-AG(A/G)TCA-3'.<ref name=Gu/>
-Copying the apparent consensus sequence for the RARE (AGGTCA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and three between ZNF497 and A1BG as can be found by the computer programs.
-==Root specific elements==
-{{main|Root specific element gene transcriptions}}
-Root specific elements (TGACGTCA).<ref name=Sharma/>
-Copying the apparent consensus sequence for the RSE (TGACGTCA) and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-==ROR-response elements==
-{{main|ROR-response element gene transcriptions}}
-RAR-related orphan receptor "ROR-γ binds DNA with specific sequence motifs AA/TNTAGGTCA (the classic RORE motif) or CT/AG/AGGNCA (the variant RORE motif)<sup>13, 31</sup>."<ref name=Wang>{{ cite journal
-|author=Junjian Wang, June X. Zou, Xiaoqian Xue, Demin Cai, Yan Zhang, Zhijian Duan, Qiuping Xiang, Joy C. Yang, Maggie C. Louie, Alexander D. Borowsky, Allen C. Gao, Christopher P. Evans, Kit S. Lam, Jianzhen Xu, Hsing-Jien Kung, Ronald M. Evans, Yong Xu, and Hong-Wu Chen
-|title=ROR-γ drives androgen receptor expression and represents a therapeutic target in castration-resistant prostate cancer
-|journal=Nature Medicine
-|date=May 2016
-|volume=22
-|issue=5
-|pages=488-496
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5030109/
-|arxiv=
-|bibcode=
-|doi=10.1038/nm.4070
-|pmid=27019329
-|accessdate=6 September 2020 }}</ref>
-Copying the apparent consensus sequence for the RORE (ATATAGGTCA) and putting it in "⌘F" finds one located between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.
-Copying the apparent consensus sequence for the variant RORE (CTGGGACA) and putting it in "⌘F" finds two located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==R response elements==
-{{main|MYB recognition element gene transcriptions}}
-The consensus sequence for the RRE is 5'-CATCTG-3'.<ref name=Hartmann>{{ cite journal
-|author=Ulrike Hartmann, Martin Sagasser, Frank Mehrtens, Ralf Stracke and Bernd Weisshaar
-|title=Differential combinatorial interactions of ''cis''-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes
-|journal=Plant Molecular Biology
-|date=January 2005
-|volume=57
-|issue=2
-|pages=155–171
-|url=http://pubman.mpdl.mpg.de/pubman/item/escidoc:1222162/component/escidoc:1222161/hartmann_weisshaar_pmb_2005.pdf
-|arxiv=
-|bibcode=
-|doi=10.1007/s11103-004-6910-0
-|pmid=15821875
-|accessdate=10 November 2018 }}</ref>
-Copying the apparent consensus sequence for the RRE (CATCTG) and putting it in "⌘F" finds none located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Seed-specific elements==
-{{main|Seed-specific element gene transcriptions}}
-Seed-specific element (CATGCATG).<ref name=Sharma/>
-Copying the apparent consensus sequence for the seed-specific element (CATGCATG) and putting it in "⌘F" finds none located between ZSCAN22 and A1BG or between ZNF497 and A1BG as can be found by the computer programs.
-==Serum response elements==
-{{main|CArG box gene transcriptions}}
-{{main|Enhancer box gene transcriptions}}
-The SRE wild type (SREwt) contains the nucleotide sequence ACAGGATGTCCATATTAGGACATCTGC, of which CCATATTAGG is the CArG box, TTAGGACAT is the C/EBP box, and CATCTG is the E box.<ref name=Misra>{{ cite journal
-|author=Ravi P. Misra, Azad Bonni, Cindy K. Miranti, Victor M. Rivera, Morgan Sheng, and Michael E.Greenberg
-|title=L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway
-|journal=The Journal of Biological Chemistry
-|date=14 October 1994
-|volume=269
-|issue=41
-|pages=25483-25493
-|url=http://www.jbc.org/content/269/41/25483.full.pdf
-|arxiv=
-|bibcode=
-|doi=
-|pmid=7929249
-|accessdate=7 December 2019 }}</ref>
-'-CCATATTAGG-3' is a CArG box that does not occur in either promoter of A1BG.
-'-CATCTG-3' is an E box that does not occur in either promoter of A1BG.
-'-TTAGGACAT-3' is a C/EBP box that does not occur in either promoter of A1BG using "⌘F".
-'-ACAGGATGT-3' is contained in the above nucleotide sequence which has one occurring between ZNF497 and A1BG using "⌘F" and none between ZSCAN22 and A1BG.
-==Servenius sequences==
-{{main|Servenius sequence gene transcriptions}}
-The "positive effect of W element may result from cooperative interactions between Z and other downstream elements such as the Servenius sequence, GGACCCT, located from -131 to -125 bp(28,38)."<ref name=Cogswell>{{ cite journal
-|author=John P. Cogswell, Patricia V. Basta, and Jenny P.-Y. Ting
-|title=X-box-binding proteins positively and negatively regulate transcription of the ''HLA-DRA'' gene through interaction with discrete upstream W and V elements
-|journal=Proceedings of the National Academy of Sciences USA
-|date=October 1990
-|volume=87
-|issue=19
-|pages=7703-7707
-|url=https://www.pnas.org/content/pnas/87/19/7703.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1073/pnas.87.19.7703
-|pmid=2120707
-|accessdate=20 August 2020 }}</ref>
-Copying the apparent consensus sequence for Servenius (GGACCCT) and putting it in "⌘F" finds three located between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Specificity proteins==
-{{main|Specificity protein gene transcriptions}}
-Sp1-box 1 (GGGGCT) and Sp1-box 2 (CTGCCC).<ref name=Motojima/>
-"Sp3 has been shown to repress transcriptional activity of Sp1 [9]."<ref name=Motojima/>
-Sp-1 (CCGCCCC).<ref name=Sato/>
-Sp1 (GCGGC).<ref name=Yao2016>{{ cite journal
-|author=D. W. Yao, J. Luo, Q. Y. He, J. Li, H. Wang, H. B. Shi, H. F. Xu, M. Wang and J. J. Loor
-|title=Characterization of the liver X receptor-dependent regulatory mechanism of goat stearoyl-coenzyme A desaturase 1 gene by linoleic acid
-|journal=Journal of Dairy Science
-|date=May 2016
-|volume=99
-|issue=5
-|pages=3945-3957
-|url=https://www.sciencedirect.com/science/article/pii/S0022030216300273
-|arxiv=
-|bibcode=
-|doi=10.3168/jds.2015-10601
-|pmid=26947306
-|accessdate=5 September 2020 }}</ref>
-An apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) is 3'-(C/G)(C/G/T)G(C/G)C(C/T)-5'. Or, each must be considered separately.
-Copying the apparent consensus sequences for Sp1 (GGGGCT), (CTGCCC) or (CCGCCCC) and putting each sequence in "⌘F" finds none located between ZSCAN22 and A1BG and four, two or none between ZNF497 and A1BG as can be found by the computer programs.
-==STATs==
-{{main|STAT gene transcriptions}}
-A "homologous IFN-𝛄 activation site (GAS) element, having the consensus sequence TTC/ANNNG/TAA, is found in the promoters of several [interferon-stimulated genes] ISG.<sup>(37–40)</sup>"<ref name=Ghislain>{{ cite journal
-|author=Julien J. Ghislain, Thomas Wong, Melody Nguyen, and Eleanor N. Fish
-|title=The Interferon-Inducible Stat2:Stat1 Heterodimer Preferentially Binds ''In Vitro'' to a Consensus Element Found in the Promoters of a Subset of Interferon-Stimulated Genes
-|journal=Journal of Interferon and Cytokine Research
-|date=June 2001
-|volume=21
 |issue=6
-|pages=379-388
+|pages=1586-1601
-|url=https://www.researchgate.net/profile/Thomas_Wong29/publication/11899907_The_Interferon-Inducible_Stat2Stat1_Heterodimer_Preferentially_Binds_In_Vitro_to_a_Consensus_Element_Found_in_the_Promoters_of_a_Subset_of_Interferon-Stimulated_Genes/links/5ade147aaca272fdaf88c226/The-Interferon-Inducible-Stat2Stat1-Heterodimer-Preferentially-Binds-In-Vitro-to-a-Consensus-Element-Found-in-the-Promoters-of-a-Subset-of-Interferon-Stimulated-Genes.pdf
+|url=
 |arxiv=
 |bibcode=
-|doi=10.1089/107999001750277
+|doi=10.1093/gbe/evz102
-|pmid=11440635
+|pmid=31106814
-|accessdate=15 August 2020 }}</ref> Consensus sequences: STAT1 - TTCC(C/G)GGAA, STAT3 - TTCC(C/G)GGAA, STAT4 - TTCCGGAA, STAT5 - TTCNNNGAA and STAT6 - TTCNNNNGAA.<ref name=Ghislain/>
+|accessdate=31 January 2021 }}</ref>
-"The GAS element is palindromic and the sequence TTCN(2-4)GAA defines the optimal binding site for all STATs, with the exception of STAT2 which appears to be defective in GAS-DNA binding [...]."<ref name=Wesoly>{{ cite journal
+"The leukocyte receptor cluster (LRC) is a family of structurally related genes for immunoregulatory receptors. Originally, the term LRC was introduced to emphasize the linkage of the genes encoding killer immunoglobulin-like receptors (KIRs), leukocyte Ig-like receptors (LILRs), and FcαR on human chromosome 19q13.4 (Wagtmann et al. 1997; Wende et al. 1999). Subsequently, it has been found that the region contains some other structurally related genes, such as ''NCR1, GPVI, LAIR1, LAIR2,'' and ''OSCAR'' (Meyaard et al. 1997; Sivori et al. 1997; Clemetson et al. 1999; Kim et al. 2002). Most recently, the LRC has been further extended by adding two more genes named ''VSTM1/SIRL1'' and ''TARM1'' (Steevels et al. 2010; Radjabova et al. 2015)."<ref name=Guselnikov/>
-|author=Joanna Wesoly, Zofia Szweykowska-Kulinska and Hans A R Bluyssen
-|title=STAT activation and differential complex formation dictate selectivity of interferon responses
-|journal=Acta Biochimica Polonica
-|date=31 March 2007
-|volume=54
-|issue=1
-|pages=27-38
-|url=https://ojs.ptbioch.edu.pl/index.php/abp/article/download/3266/2324
-|arxiv=
-|bibcode=
-|doi=10.18388/abp.2007_3266
-|pmid=17351669
-|accessdate=15 August 2020 }}</ref>
-===Proximal promoters===
+"Except for LAIR2, which is a secreted protein, all human LRC products are type I cell surface receptors with extracellular regions composed of 1–4 C2-type Ig-like domains."<ref name=Guselnikov/>
-Negative strand in the positive direction there is 1: 3'-TTCCGGGAA-5', 4247.
+The "eutherian LRC family, in addition to commonly recognized members, includes two new, IGSF1 and alpha-1-B glycoprotein (A1BG)."<ref name=Guselnikov/>
-===Distal promoters===
+"Nucleotide sequences were retrieved and analyzed using utilities at the NCBI (https://www.ncbi.nlm.nih.gov/, last accessed May 20, 2019) and Ensemble (http://www.ensembl.org, last accessed May 20, 2019) websites."<ref name=Guselnikov/>
-Positive strand in the negative direction there are 2: 3'-TTCGTTGAA-5', 3506, 3'-TTCCCTGAA-5', 3782.
+"In our previous studies, it was observed that the Ig-like domains of the frog and chicken LRC proteins reproducibly showed homology not only to known LRC members but also to the products of four mammalian genes that to our knowledge have never been considered in the phylogenetic analyses of LRC. These genes are ''VSTM1, TARM1, A1BG,'' and ''IGSF1''. ''VSTM1'' and ''TARM1'' are the most recently identified members of the human LRC (Steevels et al. 2010; Radjabova et al. 2015). ''A1BG'' encodes alpha-1 B glycoprotein, a soluble component of mammalian blood plasma that is known for half a century (Schultze et al. 1963). The protein is composed of five Ig-like domains and has been shown to bind to CRISP-3, a small polypeptide that is present in exocrine secretions of neutrophilic granulocytes and that is believed to play a role in innate immunity (Udby et al. 2004). In the human genome, ''A1BG'' maps to 19q13.4 some 3.3 Mb away from ''GPVI'' [...]."<ref name=Guselnikov/>
-Positive strand in the positive direction there is 1: 3'-TTCCATGAA-5', 128.
+"The attribution of IGSF1 and A1BG domains to the LRC was supported by their 3D structures predicted using homology modeling [...]."<ref name=Guselnikov/>
-==Ste12p==
-{{main|Ste12p gene transcriptions}}
-The upstream activating sequence (UAS) for Ste12p is 5'-TGAAAC-3'.<ref name=Tang/>
-Copying 5'-TGAAAC-3' in "⌘F" yields eleven between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.
-==Synaptic Activity-Responsive Elements==
-{{main|Synaptic Activity-Responsive Elements}}
-"A unique synaptic activity-responsive element (SARE) sequence, composed of the consensus binding sites for SRF, MEF2 and CREB, is necessary for control of transcriptional upregulation of the Arc gene in response to synaptic activity."<ref name=Tornos>{{ cite journal
-|author=Fernanda M. Rodríguez-Tornos, Iñigo San Aniceto, Beatriz Cubelos, Marta Nieto
-|title=Enrichment of Conserved Synaptic Activity-Responsive Element in Neuronal Genes Predicts a Coordinated Response of MEF2, CREB and SRF
-|journal=PLoS ONE
-|date=31 January 2013
-|volume=8
-|issue=1
-|pages=e53848
-|url=https://journals.plos.org/plosone/article/file?id=10.1371/journal.pone.0053848&type=printable
-|arxiv=
-|bibcode=
-|doi=10.1371/journal.pone.0053848
-|pmid=23382855
-|accessdate=12 November 2018 }}</ref>
-==TACTAAC boxes==
-{{main|TACTAAC box gene transcriptions}}
-"A consensus sequence TACTAA(C/T) was derived for the branch site of ''Dictyostelium'' introns."<ref name=Rivero>{{ cite journal
-|author=Francisco Rivero
-|title=mRNA processing in Dictyostelium: sequence requirements for termination and splicing
-|journal=Protist
-|month=June
-|year=2002
-|volume=153
-|issue=2
-|pages=169-76
-|url=http://www.academia.edu/download/45750040/1434-4610-0009520160518-7945-1y17rxg.pdf
-|arxiv=
-|bibcode=
-|doi=10.1078/1434-4610-00095
-|pmid=12125758
-|accessdate=2017-04-05 }}</ref>
-# positive strand in the positive direction is SuccessablesTACT++.bas, looking for 3'-TACTAA(C/T)-5', 1, 3'-TACTAAT-5', 718,
-# complement, negative strand, positive direction is SuccessablesTACTc-+.bas, looking for 3'-ATGATT(A/G)-5', 1, 3'-ATGATTA-5', 718,
-# inverse complement, positive strand, positive direction is SuccessablesTACTci++.bas, looking for 3'-(A/G)TTAGTA-5', 1, 3'-ATTAGTA-5', 709,
-# inverse, negative strand, positive direction, is SuccessablesTACTi-+.bas, looking for 3'-(C/T)AATCAT-5', 1, 3'-TAATCAT-5', 709.
-==TAGteams==
-{{main|TAGteam gene transcriptions}}
-The "heptamer consensus sequence CAGGTAG (i.e., the TAGteam) is overrepresented in regulatory regions of the earliest expressed zygotic genes [2]."<ref name=Fonseca>{{ cite journal
-|author=Rodrigo Nunes da Fonseca and Thiago M. Venancio
-|title=Maternal or zygotic: Unveiling the secrets of the Pancrustacea transcription factor zelda
-|journal=Plos Genetics
-|date=1 March 2018
-|volume=14
-|issue=3
-|pages=e1007201
-|url=https://journals.plos.org/plosgenetics/article?id=10.1371/journal.pgen.1007201
-|arxiv=
-|bibcode=
-|doi=10.1371/journal.pgen.1007201
-|pmid=29494591
-|accessdate=5 September 2020 }}</ref>
-Copying the consensus TAGteam: 5'-CAGGTAG-3' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG or no locations between ZSCAN22 and A1BG as can be found by the computer programs.
-==Tapetum boxes==
-{{main|Tapetum box gene transcriptions}}
-The consensus sequence for the TAPETUM box is TCGTGT.<ref name=Ye/>
-Copying the consensus Tapetum box: 3'-TCGTGT-5' and putting the sequence in "⌘F" finds one location between ZNF497 and A1BG and one between ZSCAN22 and A1BG as can be found by the computer programs.
-==TATA boxes==
-{{main|TATA box gene transcriptions}}
-Negative strand in the negative direction there are 2: 3'-TATATATA-5' at 1600 (or -2860 nts upstream from the TSS) and 3'-TATATAAA-5' at 1602 (or -2858 nts).
-Positive strand in the negative direction there are 3: 3'-TATAAAAG-5' at 184 (or -4276 nts), 3'-TATAAAAG-5' at 223 (or -4237 nts), and 3'-TATATAAA-5' at 2874 (or -1586 nts).
-Inverse complement, negative strand, negative direction there are 2: 3'-TATATATA-5', 1600, 3'-TTTATATA-5', 2871.
-Inverse complement, positive strand, negative direction there is 1: 3'-TTTTTATA-5', 219.
-==TAT boxes==
-{{main|TAT box gene transcriptions}}
-Only an inverse and its complement occurs between ZSCAN22 and A1BG: 3'-TACCTAT-5' at 2996 nts from ZSCAN22.
-==T boxes==
-{{main|T box gene transcriptions}}
-"The different inducing activities of Xbra, VegT and Eomesodermin suggest that the proteins might recognise different DNA target sequences. [...] All three proteins prove to recognise the same core sequence of TCACACCT with some differences in flanking nucleotides."<ref name=Conlon>{{ cite journal
-|author=Frank L. Conlon, Lynne Fairclough, Brenda M. J. Price, Elena S. Casey and J. C. Smith
-|title=Determinants of T box protein specificity
-|journal=Development
-|date=2001
-|volume=128
-|issue=19
-|pages=3749-3758
-|url=http://dev.biologists.org/content/develop/128/19/3749.full.pdf?download=true
-|arxiv=
-|bibcode=
-|doi=
-|pmid=11585801
-|accessdate=17 November 2018 }}</ref>
-Most bZIP proteins show high binding affinity for the ACGT motifs, which include [...] AACGTT (T box) [...].<ref name=Landschulz/><ref name=Zhang2014/><ref name=Nijhawan/>
-"Despite sequence variations within the Tbox DBD between family members, all members of the family appear to bind to the same DNA consensus sequence, TCACACCT. In several in vitro binding-site selection studies, members of the Tbox family were found to bind preferentially sequences containing two or more of these core motifs arranged in various orientations; however, the significance of such double sites in vivo is uncertain, as most Tbox target gene sites have been found to contain only a single consensus motif (18)."<ref name=Liu>{{ cite journal
-|author=Ce Feng Liu, Gabriel S. Brandt, Quyen Q. Hoang, Natalia Naumova, Vanja Lazarevic, Eun Sook Hwang, Job Dekker, Laurie H. Glimcher, Dagmar Ringe, and Gregory A. Petsko
-|title=Crystal structure of the DNA binding domain of the transcription factor T-bet suggests simultaneous recognition of distant genome sites
-|journal=Proceedings of the National Academy of Sciences of the USA
-|date=25 October 2016
-|volume=113
-|issue=43
-|pages=E6572-E6581
-|url=https://www.pnas.org/content/113/43/E6572
-|arxiv=
-|bibcode=
-|doi=10.1073/pnas.1613914113
-|pmid=27791029
-|accessdate=28 August 2020 }}</ref>
-Copying the consensus T boxes: 3'-TCACACCT-5' or 3'-AACGTT-5' and putting the sequence in "⌘F" finds two locations or zero for these sequences respectively between ZSCAN22 or ZNF497 and A1BG as can be found by the computer programs.
-==Telomeric repeat DNA-binding factors==
-{{main|Telomeric repeat DNA-binding factor gene transcriptions}}
-Copying the consensus telomeric repeat DNA-binding factor (TRF): 3'-TTAGGG-5' and putting the sequence in "⌘F" locates ten of this sequence between ZSCAN22 and A1BG in the negative direction and two nucleotides between ZNF497 and A1BG as can be found by the computer programs.
-In the nucleotides between ZSCAN22 and A1BG there is are ten 3'-TTAGGG-5' beginning about 300 nucleotides from ZSCAN22 or ending at about 3900 nts. There are two among the nucleotides between ZNF497 and A1BG as A1BG is approached from ZNF497.
-''Homo sapiens'' genes containing these are found using Homo sapiens "TRF (TTAGGG repeat binding factor)".<ref name=Maru>{{ cite book
-|author=Yoshiro Maru
-|title=Basic Research, In: "Inflammation and Metastasis"
-|publisher=Springer
-|location=Tokyo
-|date=2016
-|editor=
-|pages=193-231
-|url=https://link.springer.com/chapter/10.1007/978-4-431-56024-1_10
-|arxiv=
-|bibcode=
-|doi=10.1007/978-4-431-56024-1_10
-|pmid=
-|isbn=978-4-431-56022-7
-|accessdate=28 August 2020 }}</ref>
-==Thyroid hormone response elements==
-{{main|Thyroid hormone response element gene transcriptions}}
-"The arrangement of TREs within the promoter might regulate THR action by determining THR isoform binding, THR dimerization, and coregulators binding. In the classic view of how TH and its receptor stimulate gene expression, the gene promoter contains TREs consisting of a 6-bp consensus sequence (AGGTCA) organized as a direct repeat separated by 4 bp (DR4), a palindrome without spacing (PAL), or an inverted palindrome (LAP) separated by 4 to 6 bp (10–13)."<ref name=Pinto>{{ cite journal
-|author=Vitor M S Pinto, Svetlana Minakhina, Shuiqing Qiu, Aniket Sidhaye, Michael P Brotherton, Amy Suhotliv, Fredric E Wondisford
-|title=Naturally Occurring Amino Acids in Helix 10 of the Thyroid Hormone Receptor Mediate Isoform-Specific TH Gene Regulation
-|journal=Endocrinology
-|date=1 September 2017
-|volume=158
-|issue=9
-|pages=3067-3078
-|url=https://academic.oup.com/endo/article/158/9/3067/3979086
-|arxiv=
-|bibcode=
-|doi=10.1210/en.2017-00314
-|pmid=28911178
-|accessdate=5 September 2020 }}</ref>
-Copying the consensus sequence for the TRE: 5'-AGGTCA-3' and putting the sequence in "⌘F" finds no locations between ZNF497 and A1BG or two locations between ZSCAN22 and A1BG as can be found by the computer programs.
-==Upstream stimulating factors==
-{{main|Upstream stimulatory factor gene transcriptions}}
-"The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer."<ref name=Read/>
-"The regulation of insulin gene expression is dependent on sequences located upstream of the transcription start site (Clark and Docherty, 1992). Two important ''cis''-acting elements, the insulin enhancer binding site 1 (IEBI) or NIR box and the IEB2 or FAR box, have been identified in the rat insulin I gene (Karlsson ''et al.'', 1987, 1989). Located at positions -104 (IEBI/NIR) and -233 (IEB2/FAR), these elements share an identical 8 bp sequence, GCCATCTG, which contains a consensus sequence, CANNTG, characteristic of E-box elements (Kingston, 1989). E boxes are present in enhancers from a variety of genes, including immunoglobulin and muscle-specific genes, where they interact with transcription factors containing a helix-loop-helix (HLH) dimerization domain (Murre ''et al.'', 1989)."<ref name=Read>{{ cite journal
-|author=Martin L. Read, Andrew R. Clark and Kevin Docherty
-|title=The helix-loop-helix transcription factor USF (upstream stimulating factor) binds to a regulatory sequence of the human insulin gene enhancer
-|journal=Biochemical Journal
-|date=1993
-|volume=295
-|issue=
-|pages=233-237
-|url=https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1134844/pdf/biochemj00102-0234.pdf
-|arxiv=
-|bibcode=
-|doi=10.1042/bj2950233
-|pmid=8216223
-|accessdate=14 August 2020 }}</ref>
-"The IEB1 box is highly conserved among insulin genes, and is thus likely to play an important role in controlling transcription. The IEB2 site is not well conserved; in the rat insulin 2 gene the equivalent sequence is GCCACCCAGGAG, and in the human insulin gene the homologous sequence, which has been previously designated the GC2 box (Boam ''et al.'', 1990a), is GCCACCGG."<ref name=Read/>
-"Confirmation that USF bound at the IEB2 site was obtained using an oligonucleotide containing the USF binding site from the adenovirus MLP."<ref name=Read/>
-A likely general USF box consensus sequence may be 3'-GCC(A/T)NN(C/G/T)(A/G)-5'.
-===Those containing an E-box (CANNTG)===
-# Negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesUSFbox-+.bas, looking for 3'-GCC(A/T)NN(C/G/T)(A/G)-5': 1, 3'-GCCACATG-5' at 3707.
-# inverse complement, positive strand, negative direction is SuccessablesUSFboxci+-.bas, looking for 3'-(C/T)(A/C/G)NN(A/T)GGC-5': 1, 3'-CAGATGGC-5' at 3629.
-# inverse complement, positive strand, positive direction is SuccessablesUSFboxci++.bas, looking for 3'-(C/T)(A/C/G)NN(A/T)GGC-5': 1, 3'-CAGGTGGC-5' at 1845.
-===Those containing an E-box (GTNNAC)===
-# inverse negative strand, negative direction is SuccessablesUSFboxi--.bas, looking for 3'-(A/G)(C/G/T)NN(A/T)CCG-5': 1, 3'-GTCTACCG-5' at 3629.
-# inverse negative strand, positive direction is SuccessablesUSFboxi-+.bas, looking for 3'-(A/G)(C/G/T)NN(A/T)CCG-5': 1, 3'-GTCCACCG-5' at 1845.
-# inverse positive strand, positive direction is SuccessablesUSFboxi++.bas, looking for 3'-(A/G)(C/G/T)NN(A/T)CCG-5': 3, 3'-GTCCACCG-5' at 198, 3'-GTGGACCG-5' at 2570 and 3'-GTAGACCG-5' at 3406.
-# complement, negative strand, negative direction is SuccessablesUSFboxc--.bas, looking for 3'-CGG(A/T)NN(A/C/G)(C/T)-5': 2, 3'-CGGTCCAC-5' at 2079 and 3'-CGGTCCAC-5' at 3953.
-# complement, positive strand, positive direction is SuccessablesUSFboxc++.bas, looking for 3'-CGG(A/T)NN(A/C/G)(C/T)-5': 1, 3'-CGGTGTAC-5' at 3707.
-==V boxes==
-{{main|V box gene transcriptions}}
-"As VRI accumulates in the nucleus during the mid to late day, it binds VRI/PDP1ϵ binding sites (V/P-boxes) [consensus V box:A(/G)TTA(/T)T(/C), P box:GTAAT(/C)], to repress Clk and cry transcription (Hardin, 2004)."<ref name=Yu/>
-In the negative direction (from ZSCAN22 to A1BG) there are up to 81 V boxes, 28 to 4538 nts from ZSCAN22 with the apparent TSS at 4460 nts.
-In the positive direction (from ZNF497 to A1BG) there are up to 21 V boxes, 23 to 4310 nts from ZNF497 with the known TSS at 4300 nts.
-==W boxes==
-{{main|W box gene transcriptions}}
-===Proximal promoters===
-Inverse W boxes occur in the negative strand, negative direction of A1BG: 3'-GGTCAA-5' at 4416 and 3'-GGTCAA-5' at 4308.
-W boxes occur in the positive direction, positive strand of A1BG: 3'-CTGACC-5' and its complement at 4216 and inverse W boxes occur 3'-GGTCAG-5' and its complement at 4270.
-===Distal promoters===
-A W box occurs 3'-CTGACC-5' at 3749, whereas 3'-CTGACT-5' at 17, 3'-TTGACT-5' at 130, 3'-TTGACT-5' at 307, and 3'-CTGACC-5' at 734 occur close to ZSCAN22, but 3'-CTGACT-5' at 1935 could be associated ZSCAN22 or an unknown gene between it and A1BG, along with their complements, negative strand, negative direction.
-Inverse complement, positive strand, negative direction there are 5: 3'-GGTCAG-5', 440, 3'-GGTCAG-5', 577, 3'-GGTCAG-5', 713, 3'-GGTCAG-5', 2249, 3'-GGTCAG-5', 2586.
-W box inverses occur 3'-GGTCAG-5' at 1353 negative direction.
-W boxes 3'-AGTCAG-5' at 2101, 3'-GGTCAG-5' at 2221, 3'-AGTCAG-5' at 2608, 3'-AGTCAA-5' at 2614, and 3'-AGTCAG-5' at 2619 along with their complements, positive direction.
-W boxes in the positive direction occur 3'-CTGACC-5' at 1662, 3'-CTGACC-5' at 2213, 3'-TTGACC-5' at 2873, 3'-CTGACT-5' at 2945, and 3'-TTGACC-5' at 4018 that could be associated with A1BG, along with 3'-TTGACC-5' at 1953, 3'-CTGACT-5' at 2674, and 3'-TTGACT-5' at 3735.
-Inverse complement, positive strand, positive direction there are 6: 3'-GGTCAG-5', 2025, 3'-AGTCAG-5', 2099, 3'-GGTCAG-5', 2606, 3'-GGTCAG-5', 2997, 3'-GGTCAG-5', 3083, 3'-GGTCAA-5', 3380.
-==X core promoter elements==
-{{main|X core promoter element gene transcriptions}}
-# negative strand in the negative direction, looking for 3'-G/A/T-G/C-G-T/C-G-G-G/A-A-G/C-A/C-5', 1, 3'-TGGTGGGACC-5', 3744 and complement,
-# inverse complement, positive strand, negative direction, looking for 3'-G/T-G/C-T-C/T-C-C-A/G-C-G/C-C/A/T-5', 1, 3'-GCTCCCACCT-5', 392 and complement, and
-# inverse, negative strand, positive direction, looking for 3'-A/C-G/C-A-G/A-G-G-T/C-G-G/C-G/A/T-5', 1, 3'-CCAGGGTGGG-5', 102.
-==Z boxes==
-{{main|Z box gene transcriptions}}
-"The HY5 protein interacts with both the G- (CACGTG) and Z- (ATACGTGT) boxes of the light-regulated promoter of ''RbcS1A'' (ribulose bisphosphate carboxylase small subunit) and the CHS (chalcone synthase) genes (Ang et al., 1998; Chattopadhyay et al., 1998; Yadav et al., 2002)."<ref name=Song>{{ cite journal
-|author=Young Hun Song, Cheol Min Yoo, An Pio Hong, Seong Hee Kim, Hee Jeong Jeong, Su Young Shin, Hye Jin Kim, Dae-Jin Yun, Chae Oh Lim, Jeong Dong Bahk, Sang Yeol Lee, Ron T. Nagao, Joe L. Key, and Jong Chan Hong
-|title=DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins
-|journal=Plant Physiology
-|date=April 2008
-|volume=146
-|issue=4
-|pages=1862–1877
-|url=http://www.plantphysiol.org/content/plantphysiol/146/4/1862.full.pdf
-|arxiv=
-|bibcode=
-|doi=10.1104/pp.107.113217
-|pmid=18287490
-|accessdate=26 March 2019 }}</ref>
-Z-boxes 1-3 contain 5'-AGGTG-3'.<ref name=Mejlvang>{{ cite journal
-|author=Jakob Mejlvang, Marina Kriajevska, Cindy Vandewalle, Tatyana Chernova, A. Emre Sayan, Geert Berx, J. Kilian Mellon, and Eugene Tulchinsky
-|title=Direct Repression of Cyclin D1 by SIP1 Attenuates Cell Cycle Progression in Cells Undergoing an Epithelial Mesenchymal Transition
-|journal=Molecular Biology of the Cell
-|date=November 2007
-|volume=18
-|issue=11
-|pages=4615–4624
-|url=https://www.molbiolcell.org/doi/pdf/10.1091/mbc.e07-05-0406
-|arxiv=
-|bibcode=
-|doi=10.1091/mbc.e07-05-0406
-|pmid=17855508
-|accessdate=15 November 2018 }}</ref>
-# negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesZbox-+.bas, looking for 3'-A(C/T)A(C/G)GT(A/G)T-5', 1, 3'-ACAGGTGT-5' at 1969 and complement.
+"Noteworthy is that the D1 and D6 domains of IgSF1 fall into one clade with the N-terminal (d1) domains of A1BG and OSCAR (cluster B1). Closer relationship of A1BG and OSCAR was supported by clustering of the d2–d5 domains of A1BG with membrane-proximal (d2) domain of OSCAR (cluster B2)."<ref name=Guselnikov/>
-# positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesZbox++.bas, looking for 3'-A(C/T)A(C/G)GT(A/G)T-5', 1, 3'-ACACGTGT-5', 2962 and complement.
-# inverse complement, positive strand, negative direction is SuccessablesZboxci+-.bas, looking for 3'-A(C/T)AC(C/G)T(A/G)T-5', 3 between 1131 and 3970 complements.
-==Response element negative results==
+"Altogether, these results support the attribution of IGSF1 and A1BG to the LRC and suggest their relatedness to OSCAR, TARM1, and VSTM1."<ref name=Guselnikov/>
-{| class="wikitable sortable"
+"Clustering of the N-terminal domains of OSCAR, IGSF1, and A1BG with each other and with IGSF1 d6 was also reproduced. Finally, the d2 domains of OSCAR cluster with the d2–d5 domains of A1BG (fig. 5). These results further justify grouping IGSF1, A1BG, OSCAR, TARM1, and VSTM1 into a distinct group B."<ref name=Guselnikov/>
-|+ Response elements not occurring in promoters near A1BG
-|-
-! Name of elements !! Consensus sequences !! Testing !! Notes
-|-
-| [[CAAT box gene transcriptions|CAAT boxes]] || 5'-CAAT-3' || 16 || consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT
-|-
-| [[Cat8p gene transcriptions|Cat8ps]] || 5'-CGGTCCGC-3' || ⌘F || 5'-CGGNBNVMHGGA-3', 5'-CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA-3'
-|-
-| [[Cbf1 regulatory factor gene transcriptions|Cbf1 regulatory factors]] || 5'-TCACGTGA-3' || ⌘F || strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end
-|-
-| [[CENP-B box gene transcriptions|CENP-B boxes]] || 5'-TTTCGTTGGAAGCGGGA-3' || 16 || specifically localized at the centromere
-|-
-| [[Calcineurin-responsive transcription factor gene transcriptions|Crz1ps]] || 5'-TGCGCCCC-3' || ⌘F || 5'-TG(A/C)GCCNC-3'
-|-
-| [[DNA damage response element gene transcriptions|DNA damage response elements (DREs)]] || 5'-TAGCCGCCG-3' or 5'-TTTCAAT-3' || ⌘F || in the upstream repression sequence (URS)
-|-
-| [[DREB box gene transcriptions|DREB boxes]] || 5'-TACCGACAT-3' || 16 || CRT/DREB box
-|-
-| [[Forkhead box gene transcriptions|Forkhead boxes]] || 5'-(A/G)(C/T)AAA(C/T)A-3' || ⌘F || 5'-GTAAACAA-3' FOXO1
-|-
-| [[Gal4p gene transcriptions|Gal4ps]] || 5'-CGGACCGC-3' || ⌘F || 5'-CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG-3'
-|-
-| [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]] || 5'-TGACTCA-3', 5'-TGAGTCA-3' || ⌘F || ACGT motif
-|-
-| [[Gcn4p gene transcriptions|Gcn4ps]] || 5'-ATGACTCTT-3' || ⌘F || [[GLM box gene transcriptions#GCN4 motifs|GCN4 motifs]]
-|-
-| [[GLM box gene transcriptions|GLM boxes]] || 5′-(G/A)TGA(G/C)TCA(T/C)-3′ || 16 || GCN4-like motif
-|-
-| [[Γ-interferon activated sequence gene transcriptions|γ-interferon activated sequences (GAS)]] || 5'-TTCCTAGAA-3' || ⌘F || ALS-GAS1 between nt −633 and nt −625
-|-
-| [[Grainy head transcription factor gene transcriptions|Grainy head transcription factor binding sites]] || 5'-AACCGGTT-3' || ⌘F || also 5'-GACTGGTT-3'
-|-
-| [[TC element gene transcriptions|GT boxes]] || 5'-GGGGTGGGG-3' || ⌘F || (-78 to -69)
-|-
-| [[Hac1p gene transcriptions|Hac1ps]] || 5'-CAGCGTG-3' || ⌘F || Regulates the unfolded protein response
-|-
-| [[Heat-responsive element gene transcriptions|Heat-responsive elements]] || 5'-AAAAAATTTC-3' || ⌘F || four nGAAn motifs
-|-
-| [[HMG box gene transcriptions|HMG boxes]] || 5'-(A/T)(A/T)CAAAG-3' || ⌘F || two or more HMG boxes
-|-
-| [[C box gene transcriptions|Hybrid C, A boxes]] || 5'-TGACGTAT-3' || ⌘F || A at the 12 position
-|-
-| [[C box gene transcriptions|Hybrid C, G boxes]] || 5'-TGACGTGT-3' || ⌘F || G at the 12 position
-|-
-| [[C box gene transcriptions|Hybrid C, T boxes]] || 5'-TGACGTTA-3' || ⌘F || T at the 12 position
-|-
-| [[Hypoxia-inducible factor gene transcriptions|Hypoxia-inducible factors]] || 5'-GCCCTACGT-3' || ⌘F || composed of HIF-1α and HIF-1β
-|-
-| [[I box gene transcriptions|I boxes]] || 5'-GATAAG-3' || ⌘F || 5'-GGATGAGATAAGA-3'
-|-
-| [[Inositol, choline-responsive element gene transcriptions|Inositol, choline-responsive element]] || 5'-TYTTCACATGY-3' || ⌘F || 5'-TCTTCAC, TCTTCACAT-3'
-|-
-| [[L box gene transcriptions|L boxes]] || 5'-TAAATG(A/C/G)A-3' || ⌘F || L1 box
-|-
-| [[Maf recognition element gene transcriptions|MAREs]] || 5'-TGCTGA(G/C)TCAGCA-3' || ⌘F || and 5'-TGCTGA(GC/CG)TCAGCA-3'
-|-
-| [[M box gene transcriptions|M boxes]] || 5'-GTCATGTGCT-3' || ⌘F || upstream of the TATA box
-|-
-| [[Mcm1 regulatory factor gene transcriptions|Mcm1 regulatory factors]] || 5'-(A/C/T)(A/C/T)NC(C/T)(A/C/T)(A/C/T)(A/T)(A/C/T)(A/C/T)N(A/G)(C/G/T)(A/C/T)-3' || ⌘F || Genome-wide determinant search
-|-
-| [[Middle sporulation element gene transcriptions|Middle sporulation elements]] || 5'-C(A/G)CAAA(A/T)-3' || ⌘F || 5'-ACACAAA-3' (2017)
-|-
-| [[Motif ten element gene transcriptions|Motif ten elements]] || 5'-C-C/G-A-A/G-C-C/G-C/G-A-A-C-G-C/G-3' || 16 || Gene ID: 6309
-|-
-| [[Nuclear factor Y gene transcriptions|Nuclear factor Y]] || 5'-TACCGACAT-3' || ⌘F || NF-Y is a trimeric complex
-|-
-| [[Nutrient-sensing response element gene transcriptions|Nutrient-sensing response element 1]] || 5'-GTTTCATCA-3' || ⌘F || only one nucleotide difference between the ''SESN2'' CARE and the ''ASNS''
-|-
-| [[p53 response element gene transcriptions|p53 response element]] || 5'-(A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T)-3' || ⌘F (GGGCATGCCT) || two closely spaced decameric half-sites
-|-
-| [[Polycomb response element gene transcriptions|Polycomb response elements]] || 5'-CGCCATTT-3' || ⌘F || closely resembles the extended Pho-Phol consensus sequence
-|-
-| [[Rap1 regulatory factor gene transcriptions|Rap1 regulatory factors]] || 5'-C(A/C/G)(A/C/G)(A/G)(C/G/T)C(A/C/T)(A/G/T)(C/G/T)(A/G/T)(A/C/G)(A/C)(A/C/T)(A/C/T)-3' || ⌘F || Rap1 (CCCACCAACAAAA) none
-|-
-| [[Seed-specific element gene transcriptions|Seed-specific elements]] || 5'-CATGCATG-3' || ⌘F || SRE consensus: 5'-CAGCAGATTGCG-3' is none
-|-
-| [[Shoot specific element gene transcriptions|Shoot specific elements]] || 5'-GATAATGATG-3' || ⌘F || SRE consensus: 5'-CAGCAGATTGCG-3' is none
-|-
-| [[Sterol response element gene transcriptions|Sterol response elements]] || 5'-TCGTATA-3' || ⌘F || perhaps plant specific
-|-
-| [[TATC box gene transcriptions|TATCCAC boxes]] || 5'-TATCCAC-3' || 16 || GA responsive complex component
-|-
-| [[TCCACCATA element gene transcriptions|TCCACCATA elements]] || 5'-TCCACCATA-3' || ⌘F || adjacent co-dependent regulatory element of POLLEN1
-|-
-| [[Tec1p gene transcriptions|Tec1ps]] || 5'-GAATGT-3' || ⌘F || Ste12p cofactor
-|-
-| [[Tetradecanoylphorbol-13-acetate response element gene transcriptions|Tetradecanoylphorbol-13-acetate response elements (TREs)]] || 5'-TGA(G/C)TCA-3' || 16 || ''cis''-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
-|-
-| [[TC element gene transcriptions|TGF-β control elements (TCEs)]] || 5'-GAGTGGGGCG-3' || ⌘F || in mouse and rat, 5'-GCGTGGGGGA-3' in humans
-|-
-| [[TC element gene transcriptions|TGF-β inhibitory elements (TIEs)]] || 5'-GAGTGGTGA-3' || 16 || in the rat transin/stromelysin promoter
-|-
-| [[Thyroid hormone response element gene transcriptions|Thyroid hormone response elements (TREs)]] || 5'-AGGTCA-3' || ⌘F || See VDREs, X boxes
-|-
-| [[Unfolded protein response element gene transcriptions|Unfolded protein response elements (UPREs)]] || 5'-TGACGTG(G/A)-3' || ⌘F || XBP1 binds to UPRE
-|-
-| [[Vitamin D response element gene transcriptions|Vitamin D response elements (VDREs)]] || 5'-(A/G)G(G/T)(G/T)CA-3' || ⌘F || 5'-AGGTCA-3' not ⌘F
-|-
-| [[X box gene transcriptions|X boxes]] || 5'-GTTGGCATGGCAAC-3' || 16 || X2 box is 5'-AGGTCCA-3' not ⌘F
-|-
-| [[Xenobiotic response element gene transcriptions|Xenobiotic response elements (XREs)]] || 5'-(T/G)NGCGTG(A/C)(G/C)A-3' || ⌘F || contains the core sequence 5'-GCGTG-3'
-|-
-| [[Yap1p,2p gene transcriptions|Yap1p,2ps]] || 5'-TTACTAA-3' || ⌘F || Yap1p binding sites
-|-
-| [[Y box gene transcriptions|Y boxes]] || 5'-(A/G)CTAACC(A/G)(A/G)(C/T)-3' || 16 || inverted CAAT box
-|-
-|}
 ==Hypotheses==
@@ Line 2,990: / Line 1,743: @@
 ==See also==
 {{div col|colwidth=20em}}
+* [[A1BG gene transcription core promoters]]
 * [[A1BG gene transcriptions]]
+* [[A1BG regulatory elements and regions]]
+* [[A1BG response element gene transcriptions]]
+* [[A1BG response element negative results]]
+* [[A1BG response element positive results]]
 * [[Alpha-1-B glycoprotein]]
 * [[Immunoglobulin domain cl11960]]
@@ Line 3,011: / Line 1,769: @@
 <!-- footer templates -->
-{{Gene project}}{{tlx|Phosphate biochemistry}}{{Sisterlinks|Complex locus A1BG and ZNF497}}
+{{Gene project}}{{Transcription factors and intracellular receptors}}{{tlx|Phosphate biochemistry}}
 <!-- footer categories -->
-[[Category:Resources last modified in September 2020]]