ABA-response element gene transcriptions

Jump to navigation Jump to search

Associate Editor(s)-in-Chief: Henry A. Hoff

"The key cis-elements in [non-yellow coloring 1] NYC1 promoter, namely, ABA-response element (ABRE) (ACGTG), ACGT, GCCcore (GCCGCC), and ethylene-inducible 3 [EIN3-Like1] (EIN3)/EIL1-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]), can be targeted by ABA insensitive 3 (ABI3), ABI5, and ABF2, 3, 4 in the ABA-signaling pathway [60,61]. GCCGCC and EIN3/EIL1-binding sequence (T[TAG][GA]CGT[GA][TCA][TAG]) are induced by ethylene-inducible TF and EIN3/EIL1 in the ethylene signaling pathway [61]. Therefore, ABA signaling is crucial for [chlorophyll] Chl b reductase activities to catalyze the Chl degradation, the first part of leaf senescence."[1]

Consensus sequences

Main article: Consensus sequence gene transcriptions

"The ABA responsive element (ABRE) is a key cis‐regulatory element in ABA signalling. However, its consensus sequence (ACGTG(G/T)C) is present in the promoters of only about 40% of ABA‐induced genes in rice aleurone cells, suggesting other ABREs may exist."[2]

"Many ABA‐inducible genes in various species contain a conserved cis‐regulatory ABA responsive element (ABRE) with the consensus sequence ACGTG(G/T)C (Hattori et al. 2002; Shen et al. 2004)."[2]

"The [novel ABRE] ABREN, [GATCGATC], had the highest average score and highest average sites in the 1 kb upstream of the start codon of the highly ABA‐induced genes in aleurone. The CGATCGAT motif [...] was identified by Bioprospector more times, but the average score and number of sites were lower. This sequence is almost identical to the ABREN but with a leading cytosine. The ABRE [ACGTGTCC] was the third highest scoring motif."[2]

Using the ABREN (GATCGATC), the CGATCGAT motif, and the ABRE (ACGTGTCC)[2] suggests a general consensus sequence of 5'-(A/C/G)(A/C/G)(A/G/T)(C/T)(C/G)(A/G/T)(A/C/T)(C/T)-3' which would allow 1944 combinations including the principal three variations. As the ABREN has the repeat pattern "GATC" and the CGATCGAT motif is similar with "CGAT", looking for the smaller GATCGAT may be more productive, while the ABRE as "ACGTGTCC" can be searched separately.

The more reduced consensus sequence 5'-GATCGAT-3' may be a better choice while the ABRE 5'-ACGTGTCC-3' could be examined separately.

Hypotheses

  1. A1BG has no ABA-response elements in either promoter.
  2. A1BG is not transcribed by an ABA-response element.
  3. ABA-response elements do not participate in the transcription of A1BG.

ABREN samplings

Copying 5'-CCGTCTCC-3' in "⌘F" yields two between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.

Copying 5'-CAGCCACC-3' in "⌘F" yields none between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.

The last two above could be combined as 5'-C(A/C)G(C/T)C(A/T)CC-3' as another possible consensus sequence.

Copying 5'-GATCGAT-3' in "⌘F" yields none between ZSCAN22 and A1BG and none between ZNF497 and A1BG as can be found by the computer programs.

Copying 5'-T[TAG][GA]CGT[GA][TCA][TAG]-3' is 5'-T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T)-3'.

For the Basic programs testing consensus sequence 3'-GATCGAT-5' (starting with SuccessablesABA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA--.bas, looking for 3'-GATCGAT-5', 0.
  2. negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA-+.bas, looking for 3'-GATCGAT-5', 0.
  3. positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA+-.bas, looking for 3'-GATCGAT-5', 0.
  4. positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA++.bas, looking for 3'-GATCGAT-5', 0.
  5. complement, negative strand, negative direction is SuccessablesABAc--.bas, looking for 3'-CTAGCTA-5', 0.
  6. complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAc-+.bas, looking for 3'-CTAGCTA-5', 0.
  7. complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAc+-.bas, looking for 3'-CTAGCTA-5', 0.
  8. complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAc++.bas, looking for 3'-CTAGCTA-5', 0.
  9. inverse complement, negative strand, negative direction is SuccessablesABAci--.bas, looking for 3'-ATCGATC-5', 0.
  10. inverse complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci-+.bas, looking for 3'-ATCGATC-5', 0.
  11. inverse complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAci+-.bas, looking for 3'-ATCGATC-5', 0.
  12. inverse complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci++.bas, looking for 3'-ATCGATC-5', 0.
  13. inverse negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAi--.bas, looking for 3'-TAGCTAG-5', 0.
  14. inverse negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAi-+.bas, looking for 3'-TAGCTAG-5', 0.
  15. inverse positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAi+-.bas, looking for 3'-TAGCTAG-5', 0.
  16. inverse positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAi++.bas, looking for 3'-TAGCTAG-5', 0.

ABRE samplings

Copying 5'-ACGTG-3' in "⌘F" yields eight between ZSCAN22 and A1BG and one between ZNF497 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence 3'-ACGTG(G/T)C-5' (starting with SuccessablesABA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA--.bas, looking for 3'-ACGTG(G/T)C-5', 0.
  2. negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA-+.bas, looking for 3'-ACGTG(G/T)C-5', 0.
  3. positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABA+-.bas, looking for 3'-ACGTG(G/T)C-5', 1, 3'-ACGTGGC-5', 4239.
  4. positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABA++.bas, looking for 3'-ACGTG(G/T)C-5', 2, 3'-ACGTGTC-5', 1823, 3'-ACGTGGC-5', 4344.
  5. complement, negative strand, negative direction is SuccessablesABAc--.bas, looking for 3'-TGCAC(A/C)G-5', 1, 3'-TGCACCG-5', 4239.
  6. complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAc-+.bas, looking for 3'-TGCAC(A/C)G-5', 2, 3'-TGCACAG-5', 1823, 3'-TGCACCG-5', 4344.
  7. complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAc+-.bas, looking for 3'-TGCAC(A/C)G-5', 0.
  8. complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAc++.bas, looking for 3'-TGCAC(A/C)G-5', 0.
  9. inverse complement, negative strand, negative direction is SuccessablesABAci--.bas, looking for 3'-G(A/C)CACGT-5', 1, 3'-GACACGT-5', 3429.
  10. inverse complement, negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci-+.bas, looking for 3'-G(A/C)CACGT-5', 0.
  11. inverse complement, positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAci+-.bas, looking for 3'-G(A/C)CACGT-5', 0.
  12. inverse complement, positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAci++.bas, looking for 3'-G(A/C)CACGT-5', 1, 3'-GACACGT-5', 2960.
  13. inverse negative strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAi--.bas, looking for 3'-C(G/T)GTGCA-5', 0.
  14. inverse negative strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAi-+.bas, looking for 3'-C(G/T)GTGCA-5', 1, 3'-CTGTGCA-5', 2960.
  15. inverse positive strand in the negative direction (from ZSCAN22 to A1BG) is SuccessablesABAi+-.bas, looking for 3'-C(G/T)GTGCA-5', 1, 3'-CTGTGCA-5', 3429.
  16. inverse positive strand in the positive direction (from ZNF497 to A1BG) is SuccessablesABAi++.bas, looking for 3'-C(G/T)GTGCA-5', 0.

ABRE Core promoters

Main article: Core promoter gene transcriptions

Positive strand, positive direction: 5'-ACGTGGC-3' at 4344 and complement.

ABRE Proximal promoters

Main article: Proximal promoter gene transcriptions

Positive strand, negative direction: 5'-ACGTGGC-3' at 4239 and complement.

ABRE Distal promoters

Main article: Distal promoter gene transcriptions

Negative strand, negative direction: 5'-GACACGT-3' at 3429 and complement.

Positive strand, positive direction: 5'-GACACGT-3' at 2960, 5'-ACGTGTC-3' at 1823 and complements.

ACGTGTCC samplings

For the Basic programs testing consensus sequence 3'-ACGTGTCC-5' (starting with SuccessablesABA.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction is SuccessablesABA--.bas, looking for 3'-ACGTGTCC-5', 0.
  2. negative strand, positive direction is SuccessablesABA-+.bas, looking for 3'-ACGTGTCC-5', 0.
  3. positive strand, negative direction is SuccessablesABA+-.bas, looking for 3'-ACGTGTCC-5', 0.
  4. positive strand, positive direction is SuccessablesABA++.bas, looking for 3'-ACGTGTCC-5', 0.
  5. complement, negative strand, negative direction is SuccessablesABAc--.bas, looking for 3'-TGCACAGG-5', 0.
  6. complement, negative strand, positive direction is SuccessablesABAc-+.bas, looking for 3'-TGCACAGG-5', 0.
  7. complement, positive strand, negative direction is SuccessablesABAc+-.bas, looking for 3'-TGCACAGG-5', 0.
  8. complement, positive strand, positive direction is SuccessablesABAc++.bas, looking for 3'-TGCACAGG-5', 0.
  9. inverse complement, negative strand, negative direction is SuccessablesABAci--.bas, looking for 3'-GGACACGT-5', 0.
  10. inverse complement, negative strand, positive direction is SuccessablesABAci-+.bas, looking for 3'-GGACACGT-5', 0.
  11. inverse complement, positive strand, negative direction is SuccessablesABAci+-.bas, looking for 3'-GGACACGT-5', 0.
  12. inverse complement, positive strand, positive direction is SuccessablesABAci++.bas, looking for 3'-GGACACGT-5', 0.
  13. inverse negative strand, negative direction is SuccessablesABAi--.bas, looking for 3'-CCTGTGCA-5', 0.
  14. inverse negative strand, positive direction is SuccessablesABAi-+.bas, looking for 3'-CCTGTGCA-5', 0.
  15. inverse positive strand, negative direction is SuccessablesABAi+-.bas, looking for 3'-CCTGTGCA-5', 0.
  16. inverse positive strand, positive direction is SuccessablesABAi++.bas, looking for 3'-CCTGTGCA-5', 0.

Hypoxia response element samplings

"We recently discovered a strongly conserved distal 5' [hypoxia response element] HRE and suggested that it might contribute to oxygen-regulated [Erythropoietin] EPO expression.18 This 5' HRE resides within a DNaseI hypersensitive site - 9.2 kb upstream of the EPO transcriptional start site, [WT CATACGTGCAGGGAGACACA], contains both the 5'-ACGTG-3' core [hypoxia-inducible factor] HIF DNA binding site as well as the ancillary 5'-CACA-3' element,11 and confers hypoxia-inducible exogenous reporter gene expression in Epo expressing and non-expressing cell lines.18"[3]

"We have previously shown for PAG1, another HIF-2 target gene, that a single distal - 82 kb 5' HRE resides in an isolated DNA region, bound by many additional transcription factors, and forms multiple chromatin loops both locally and over a long distance with the promoter region.21 While in this case HIF-2α did interact with the HRE, neither hypoxia nor the presence of HIF was needed for the long-range chromatin interaction with the promoter region. Only the presence of the core 5'-ACGTG-3' HIF binding DNA sequence was required to maintain this interaction, suggesting that preformed chromatin loops enable oxygen-regulated conditional gene regulation. This model has subsequently been confirmed for many other HIF target genes by genomewide approaches.38,39 Therefore, the EPO 5' HRE might well be functionally required for hypoxia-inducible gene expression by maintaining a constitutive chromatin architecture that supports promoter activity in a cell type-specific manner. The finding that only additional large but not small 5' HRE deletions fully abrogated endogenous Epo induction and HIF:promoter interaction in 3' HRE mutant Kelly cells suggests that, like in the case of the PAG1 gene, additional transcription factors bind close to the consensus HRE sequence and are involved in chromatin looping and trans-activation of the EPO promoter. We still have no explanation why a small 5' HRE deletion alone inhibited HIF-promoter interaction, but in combination with a 3' HRE mutation partially rescued the inhibitory effect of the 3' HRE mutation. Nonetheless, it is without precedent that the extended 5' HRE strongly cis-enhanced HIF binding to the promoter and 3' HRE."[3]

"Putative EPO promoter HREs. Location of two conserved potential promoter HREs (pHRE1 and pHRE2; [CACGC]) close to the GATA ([GATA]) and WT1 ([GCCTCTCCCCCACCCCCACCCGCGCACGCAC]) sites in the EPO proximal 5' region. [For human and other vertebrates] is a UCSC Genome Browser output (version hg19), including 161 transcription factor ChIP-sequencing (ChIP-seq) tracks derived from the ENCODE database (version 3), clusters of DNaseI hypersensitivity sites (HSS) from 125 cell types, and the transcriptional start site (TSS), with a closer view of the region in 50 vertebrates extracted using the 100-MULTIZ whole-genome multiple sequence alignment algorithm."[3]

Copying ACGTG in "⌘F" yields eight between ZSCAN22 and A1BG as can be found by the computer programs.

For the Basic programs testing consensus sequence ACGTG (starting with SuccessablesHxRE.bas) written to compare nucleotide sequences with the sequences on either the template strand (-), or coding strand (+), of the DNA, in the negative direction (-), or the positive direction (+), the programs are, are looking for, and found:

  1. negative strand, negative direction, looking for ACGTG, 8, ACGTG at 4339, ACGTG at 3288, ACGTG at 2760, ACGTG at 2425, ACGTG at 1999, ACGTG at 1718, ACGTG at 1346, ACGTG at 1338.
  2. negative strand, positive direction, looking for ACGTG, 1, ACGTG at 570.
  3. positive strand, negative direction, looking for ACGTG, 1, ACGTG at 4237.
  4. positive strand, positive direction, looking for ACGTG, 10, ACGTG at 4342, ACGTG at 3884, ACGTG at 3342, ACGTG at 3321, ACGTG at 2961, ACGTG at 1821, ACGTG at 1471, ACGTG at 1371, ACGTG at 1219, ACGTG at 547.
  5. complement, negative strand, negative direction, looking for TGCAC, 1, TGCAC at 4237.
  6. complement, negative strand, positive direction, looking for TGCAC, 10, TGCAC at 4342, TGCAC at 3884, TGCAC at 3342, TGCAC at 3321, TGCAC at 2961, TGCAC at 1821, TGCAC at 1471, TGCAC at 1371, TGCAC at 1219, TGCAC at 547.
  7. complement, positive strand, negative direction, looking for TGCAC, 8, TGCAC at 4339, TGCAC at 3288, TGCAC at 2760, TGCAC at 2425, TGCAC at 1999, TGCAC at 1718, TGCAC at 1346, TGCAC at 1338.
  8. complement, positive strand, positive direction, looking for TGCAC, 1, TGCAC at 570.
  9. inverse complement, negative strand, negative direction, looking for CACGT, 5, CACGT at 3429, CACGT at 2863, CACGT at 2081, CACGT at 1535, CACGT at 1470.
  10. inverse complement, negative strand, positive direction, looking for CACGT, 2, CACGT at 3254, CACGT at 569.
  11. inverse complement, positive strand, negative direction, looking for CACGT, 3, CACGT at 1772, CACGT at 531, CACGT at 342.
  12. inverse complement, positive strand, positive direction, looking for CACGT, 13, CACGT at 3960, CACGT at 3883, CACGT at 3464, CACGT at 2960, CACGT at 2800, CACGT at 2681, CACGT at 2334, CACGT at 2326, CACGT at 2063, CACGT at 1786, CACGT at 1218, CACGT at 783, CACGT at 546.
  13. inverse negative strand, negative direction, looking for GTGCA, 3, GTGCA at 1772, GTGCA at 531, GTGCA at 342.
  14. inverse negative strand, positive direction, looking for GTGCA, 13, GTGCA at 3960, GTGCA at 3883, GTGCA at 3464, GTGCA at 2960, GTGCA at 2800, GTGCA at 2681, GTGCA at 2334, GTGCA at 2326, GTGCA at 2063, GTGCA at 1786, GTGCA at 1218, GTGCA at 783, GTGCA at 546.
  15. inverse positive strand, negative direction, looking for GTGCA, 5, GTGCA at 3429, GTGCA at 2863, GTGCA at 2081, GTGCA at 1535, GTGCA at 1470.
  16. inverse positive strand, positive direction, looking for GTGCA, 2, GTGCA at 3254, GTGCA at 569.

HxRE core promoters

Main article: Core promoter gene transcriptions

Positive strand, positive direction: ACGTG at 4342, and complement.

HxRE proximal promoters

Main article: Proximal promoter gene transcriptions

Negative strand, negative direction: ACGTG at 4339, and complement.

Positive strand, negative direction: ACGTG at 4237, and complement.

HxRE distal promoters

Main article: Distal promoter gene transcriptions

Negative strand, negative direction: CACGT at 3429, ACGTG at 3288, CACGT at 2863, ACGTG at 2760, ACGTG at 2425, CACGT at 2081, ACGTG at 1999, ACGTG at 1718, CACGT at 1535, CACGT at 1470, ACGTG at 1346, ACGTG at 1338, and complements.

Positive strand, negative direction: CACGT at 1772, CACGT at 531, CACGT at 342, and complements.

Negative strand, positive direction: CACGT at 3254, ACGTG at 570, CACGT at 569, and complements.

Positive strand, positive direction: CACGT at 3960, ACGTG at 3884, CACGT at 3883, CACGT at 3464, ACGTG at 3342, ACGTG at 3321, ACGTG at 2961, CACGT at 2960, CACGT at 2800, CACGT at 2681, CACGT at 2334, CACGT at 2326, CACGT at 2063, ACGTG at 1821, CACGT at 1786, ACGTG at 1471, ACGTG at 1371, ACGTG at 1219, CACGT at 1218, CACGT at 783, ACGTG at 547, CACGT at 546, and complements.

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

Initial content for this page in some instances came from Wikiversity.

Initial content for this page in some instances came from Wikipedia.

Initial content for this page in some instances incorporates text from the United States National Library of Medicine.

See also

References

  1. ↑ Muhammad Asad Ullah Asad, Shamsu Ado Zakari, Qian Zhao, Lujian Zhou, Yu Ye and Fangmin Cheng (10 January 2019). "Abiotic Stresses Intervene with ABA Signaling to Induce Destructive Metabolic Pathways Leading to Death: Premature Leaf Senescence in Plants". International Journal of Molecular Sciences. 20 (2): 256–278. doi:10.3390/ijms20020256. PMID 30634648. Retrieved 27 August 2020.
  2. ↑ 2.0 2.1 2.2 2.3 Kenneth A. Watanabe, Arielle Homayouni, Lingkun Gu, Kuan‐Ying Huang, Tuan‐Hua David Ho, Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
  3. ↑ 3.0 3.1 3.2 Ilaria M. C. Orlando, Véronique N. Lafleur, Federica Storti, Patrick Spielmann, Lisa Crowther, Sara Santambrogio, Johannes Schödel, David Hoogewijs, David R. Mole, and Roland H. Wenger (19 December 2019). "Distal and proximal hypoxia response elements co-operate to regulate organ-specific erythropoietin gene expression". Haematologica. 105 (12): 2774–2784. doi:10.3324/haematol.2019.236406. PMID 33256376 Check |pmid= value (help). Retrieved 6 May 2021.

External links

Retrieved from "https://www.wikidoc.org/index.php?title=ABA-response_element_gene_transcriptions&oldid=1700149"