A1BG response element gene transcriptions

Jump to navigation Jump to search

Associate Editor(s)-in-Chief: Henry A. Hoff

Def. nucleotide "sequences, usually upstream, which are recognized by specific regulatory transcription factors, thereby causing gene response to various regulatory agents", [that] "may be found in both promoter and enhancer regions"[1] are called response elements.

Hypotheses

Main article: Hypotheses
  1. A1BG has no response elements in either promoter.
  2. A1BG is not transcribed by a response element.
  3. Each response element does not participate in the transcription of A1BG.

Response element testing

Main article: A1BG regulatory elements and regions
Response element
Name of elements Consensus sequences Response element class Testing Activity/Notes
Abbreviations Variations Present (Y), Absent (N) Random or likely active or activable
Authors
1. ABA responsive elements

(ABREs)

ACGTG(G/T)C WD40 repeat family Y likely active or activable
2. novel ABA-response elements

(ABREN, novel ABRE)

GATCGATC, CGATCGAT, GATCGAT WD40 repeat family N ABREN, CGATCGAT motif, and core of ABREN and CGATCGAT motif.[2]
3. ABA-response element-like

(ABRE-like)

ACGTGTCC WD40 repeat family N third highest scoring motif.[2]
4. Activated B-cell Factor-1s

(ABFs)

CGTNNNNN(A/G)(C/T)GA(C/T) General Regulatory Factors Y all three regulatory factors are in the distal promoters

likely active or activable

5. Abf1 regulatory factors CGTCCTCTACGAT General Regulatory Factors N CGTNNNNNACGAT.[3]
6. A boxes TACGTA Basic leucine zipper (bZIP) Y likely active or activable
7. boxes A TGACTCT bZIP Y likely active or activable
8. Abscisic acid-responsive elements (Pho4s), G boxes CACGTG.[4] bZIP, bHLH Y likely active or activable
9. ACGT-containing elements ACGT bZIP Y likely active or activable, but UTR sequences could be random
10. Activating protein 2

(AP2)

(Cohen)

GCCTGGCC bHSH Y likely active or activable
11. Activating protein 2

(Cohen)

TCCCCCGCCC bHSH Y likely active or activable
12. Activating protein 2

(Murata)

(C/G)CCN(3,4)GG(C/G) bHSH Y likely active or activable
13. Activating proteins

(Murata)

GCCCACGGG bHSH N Activating protein 2.[5]
14. Activating protein 2

(Yao)

TCTTCCC bHSH Y likely active or activable
15. Activating protein 2

(Yao)

CTCCCA bHSH Y likely active or activable
16. Activating proteins

(AP-2)

(Yao)

GGCCAA bHSH Y likely active or activable
17. Activating transcription factors

(Burton)

(A/C/G)TT(A/G/T)C(A/G)TCA bZIP Y likely active or activable
18. Activating transcription factors

(Kilberg)

(A/G/T)TT(A/G/T)CATCA bZIP Y likely active or activable
19. Adenylate–uridylate rich elements

(AUREs)

(Bakheet)

(A/T)(A/T)(A/T)TATTTAT(A/T)(A/T) stem-loop Y likely active or activable

Negative strand, negative direction: TTTTATTTATTA at 4076

20. Adenylate–uridylate rich elements

(AREs)

(Chen and Shyu, Class I)

ATTTA stem-loop Y likely active or activable
21. Adenylate–uridylate rich elements

(AREs)

(Chen and Shyu, Class II)

TTATTTA(A/T)(A/T) stem-loop Y likely active or activable
22. Adenylate–uridylate rich elements

(AREs)

(Chen and Shyu, Class III)

ATTT stem-loop Y likely active or activable

Positive strand, negative direction: AAATAAAT at 4073

23. Adr1ps TTGG(A/G)G Cys
2His
2 zinc finger binding domain		 Y likely active or activable
24. Aft1s (C/T)(A/G)CACCC(A/G) bZIP[6] Y likely active or activable
25. AGC boxes AGCCGCC AP-2/EREBP-related factors Y likely active or activable
26. Angiotensinogen core promoter elements (A/C)T(C/T)GTG bZIP? Y likely active or activable
27. AhR responsive element or Aryl hydrocarbon responsive element II

(AHRE-II)

CATGN6C(A/T)TG bHLH Y likely active or activable
28. AhR-responsive elements

(AHRE)

(Yao)

(G/T)NGCGTG(A/C)(C/G)A bHLH N in the promoter region of AhR responsive genes
29. AhR DNA-binding consensus sequence

(AhRY)

(Yao)

GCGTGNN(A/T)NNN(C/G) bHLH Y likely active or activable for ZNF497
30. Alpha-amylase conserved elements TATCCA ? N TATCCATCCATCC.[7]
31. Amino acid response elements

(AARE)

(Maruyama)

ATTGCATCA ? N AARE1 (ATTGCATCA)[8]
32. Amino acid response elements

(AARE)

(Broer)

TTTGCATCA ? N TTTGCATCA.[9][10]
33. Amino acid response element-like

(AARE-like)

TGGTGAAAG ? N AARE-like sequence (TGGTGAAAG, named AARE3).[8]
34. Androgen response elements

(AREs)

(Kouhpayeh)

GGTACANNNTGTTCT Zinc finger DNA-binding domain N GGTACACGGTGTTCT.[11]
35. Androgen response elements

(Kouhpayeh)

GGTACAnnnTGTTCT Zinc finger DNA-binding domain Y the two portions GGTACA and TGTTCT occurring independently are likely active or activable
36. Androgen response elements

(Wilson)

AGAACANNNTGTTCT.[12] Zinc finger DNA-binding domain Y the two portions AGAACA and TGTTCT occurring independently are likely active or activable
37. Androgen response elements

(AREs)

(Wilson)

TGATTCGTGAG Zinc finger DNA-binding domain N AGAACANNNTGTTCT.[12]
38. Antioxidant-electrophile responsive elements

(Lacher)

GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A bHLH Y likely active or activable
39. Antioxidant-electrophile responsive elements

(Otsuki)

GTGAGGTCGC bHLH N GTGAGGTCGC.[13] or GCTGAGT, GCAGGCT of GC(A/C/T)(A/G/T)(A/G/T)(C/G/T)T(A/C)A[14], an antioxidant response element (ARE)
40. ATA boxes AATAAA β-Scaffold factor? Y likely active or activable
41. ATTTA elements

(Siegel)

ATTTA β-Scaffold factor? Y likely active or activable
42. Auxin response factors

(Stigliani)

(C/G/T)(A/C/T)(G/T)G(C/T)(C/T)(G/T)(C/G)(A/C/T)(A/G/T) WD40 repeat family Y likely active or activable
43. Auxin response factors

(Ulmasov)

TGTCTC WD40 repeat family Y likely active or activable
44. Auxin response factors

(Boer)

TGTCGG WD40 repeat family Y likely active or activable
45. Auxin response factors

(ARF5)

(C/G/T)N(G/T)GTC(G/T) WD40 repeat family Y likely active or activable
46. B-boxes

(Johnson)

TGGGCA Zinc finger DNA-binding domains Y likely active or activable
47. boxes B

(Sanchez)

TGTCTCA Zinc finger DNA-binding domains Y likely active or activable
48. B recognition elements

(BREu)

(G/C)(G/C)(G/A)CGCC HTH Y likely active or activable
49. CAAT boxes (C/T)(A/G)(A/G)CCAATC(A/G) bZIP N consensus sequence for the CCAAT-enhancer-binding site (C/EBP) is TAGCATT.
50. CadC binding domains TTANNNNT HTH Y likely active or activable
51. Calcineurin-responsive transcription factors TG(A/C)GCCNC ? Y likely active or activable
52. Calcium-response elements CTATTTCGAG ? N CaRE1 CTATTTCGAG.[15]
53. Carbohydrate response elements

(ChREs)

CACGTGACCGGATCTTG, TCCGCCCCCATCACGTG ? N ChoRE1, ChoRE2.[16]
54. Carbohydrate response elements ChoRE1 ACCGG ? Y likely active or activable
55. Carbohydrate response elements ChoRE2 CCCAT ? Y may be likely active or activable
56. Carbohydrate response elements Carb E1 ATCTTG bHLH? Y likely active or activable
57. Carbohydrate response elements Carb E2 CACGTG bHLH Y likely active or activable
58. Carbohydrate response elements Carb E3 TCCGCC bHLH? Y likely active or activable
59. Carbon source-responsive elements

(CSREs)

CATTCATCCG ? N confers carbon source-dependent regulation
60. TCCG elements

(TCCGs)

TCCG bHLH? Y likely active or activable
61. CAACTC regulatory elements

(CAREs)

CAACTC WD-40 repeat family Y likely active or activable
62. cAMP-responsive elements

(CREs), Aca1ps, Sko1ps

TGACGTCA bZIP Y likely active or activable, same as Root specific elements
63. CArG boxes CCAAAAAT(G/A)G bHLH Y likely active or activable
64. Cat8ps CGG(A/C/G/T)(C/G/T)(A/C/G/T)(A/C/G)(A/C)(A/C/T)GGA ? Y likely active or activable
65. CAT boxes CATTCCT bHLH Y likely active or activable
66. Cbf1 regulatory factors TCACGTGA ? N strongly bound Cbf1 motifs enriched at both ends with a "T" on the 5′ and "A" on the 3′ end.
67. C-boxes

(Johnson)

GAGGCCATCT bZIP N GAGGCCATCT.[17]
68. C boxes

(Samarsky)

AGTAGT bZIP Y likely active or activable
69. C-boxes

(Song)

GACGTC bZIP Y random or likely?
70. C/A hybrid boxes TGACGTAT bZIP N TGACGTAT.[18] A at the 12 position
71. hybrid C/G-boxes

(Song)

TGACGTGT bZIP Y random or likely?
72. C/T hybrid boxes TGACGTTA bZIP N TGACGTTA.[18] T at the 12 position
73. C boxes

(Voronina)

GGTGATG bZIP Y random or likely?
74. CCAAT-boxes-binding transcription factors

(Hap4p)

CCAAT bZIP Y random or likely?
75. CCCTC-binding factors

(CTCF)

NCA-NNA-G(A/G)N-GGC-(A/G)(C/G)(C/T) ? N NCA-NNA-G(G/A)N-GGC-(G/A)(C/G)(T/C).[19]
76. C/EBP boxes TTAGGACAT,[20] or TAGCATT.[21] bZIP N CCAAT-enhancer-binding site (C/EBP) is TAGCATT
72. Cell-cycle boxes

(CCBs)

CACGAAAA ? N "cell cycle box" is functional in either orientation, acting as an enhancer
73. Cell-cycle box variants

(CCBs)

CACGAAA, ACGAAA and C-CGAAA ? Y random or likely?, TTTCGTG at 3600, ACGAAA at 494, and TTTCGGG at 1752
74. Cell cycle regulation CCCAACGGT[7] ? N tomato genome-wide analysis
75. CENP-B boxes TTTCGTTGGAAGCGGGA ? N specifically localized at the centromere
76. CGCG boxes (A/C/G)CGCG(C/G/T) ? Y random or likely?
77. Circadian control elements CAANNNNATC ? Y random or likely?
78. Class C DNA binding sites CACGNG ? Y random or likely?, Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232
79. Cold-responsive elements CCGAC ? Y random or likely?
80. Constitutive decay elements

(CDEs)

(Siegel)

TTC(C/T)(A/G)(C/T)GAA stem-loop Y likely active or activable possibly for ZNF497
81. Copper response elements

(CuREs)

(Quinn)

TTTGC(T/G)C(A/G) ? Y random or likely?, Positive strand, negative direction: CGCGCAAA at 163
82. Copper response elements

(CuREs)

(Park)

TGTGCTCA ? Y random or likely?, Negative strand, positive direction: TGAGCACA at 3740
83. Coupling elements

(CE1)

TGCCACCGG[2] ? N CE1 (Watanabe)
84. Coupling elements

(CE3s)

(Watanabe)

GCGTGTC ? Y random or likely?, Positive strand, positive direction: GCGTGTC at 1053, only one
85. Coupling elements

(CE3s)

(Ding)

CACGCG ? Y random or likely?, No CE3s in negative direction; positive strand, positive direction: CACGCG at 1726
86. Cytokinin response regulators

(ARR1s)

AGATT(C/T) WD40 repeat family Y likely active or activable, Positive strand, negative direction: AGATTC at 2452
87. Cytokinin response regulators

(ARR10s)

(A/G)GATA(A/C)G WD40 repeat family Y likely active or activable, Negative strand, negative direction: CGTATCC at 3447
88. Cytokinin response regulators

(ARR12s)

(A/G)AGATA WD40 repeat family Y likely active or activable, Negative strand, negative direction: TATCTT at 4080
89. Cytokinin response regulators

(ARRs)

(Ferreira)

(G/A)GGAT(T/C) WD40 repeat family Y likely active or activable, Positive strand, negative direction: GATCCC at 4477, AGGATC at 4288, AGGATC at 4157, AGGATC at 4006, AATCCC at 3976, AATCCC at 3067
90. Cytokinin response regulators

(ARRs)

(Rashotte1)

GATCTT WD40 repeat family Y likely active or activable, Positive strand, negative direction: AAGATC at 3276
91. Cytokinin response regulators

(ARRs)

(Rashotte2)

(G/A)GAT(T/C) WD40 repeat family Y likely active or activable, Positive strand, negative direction: GATCC at 4476, AGATC at 4475
92. Cytoplasmic polyadenylation elements

(CPEs)

TTTTTAT ? Y likely active or activable, Negative strand, negative direction: TTTTTAT at 4220, TTTTTAT at 4070
93. DAF-16 binding elements (A/G)(C/T)AAA(C/T)A ? Y likely active or activable
94. DAF-16-associated elements

(DAE)

TGATAAG ? N DAF-16-associated element (DAE).[22]
95. D-boxes

(Mracek1)

GTTGTATAAC ? N GTTGTATAAC.[23]
96. D-boxes

(Mracek)

CTTATGTAAA (Mracek2) ? N CTTATGTAAA.[23]
97. D-boxes

(Johnson)

TCTCACA ? N TCTCACATT(A/C)AATAAGTCA is a D-box.[17]
98. D boxes

(Samarsky)

AGTCTG ? Y random or likely?
99. D boxes

(Voronina)

TCCTG ? Y random or likely?
100. D-boxes

(Motojima)

TGAGTGG ? Y random or likely?
101. Dioxin-responsive elements

(DREs)

TNGCGTG bHLH? Y likely active or activable
102. Defense and stress-responsive elements ATTTTCTTCA ? N ATTTTCTTCA.[7]
103. DNA damage response elements

(DREs)

(Smith)

TTTCAAT[24] ? N in the upstream repression sequence (URS)
104. DNA damage response elements

(DRE, core)

(Sumrada)

CCGCC ? Y random or likely?
105. DNA damage response elements

(DREs)

(Sumrada)

TAGCCGCCG of TAGCCGCCGRRRR.[25] ? N in the upstream repression sequence (URS)
106. DNA replication-related elements

(DREs)

TATCGATA ? N DNA replication-related element (DRE).[26]
107. Downstream B recognition elements (A/G)T(A/G/T)(G/T)(G/T)(G/T)(G/T) ? Y random or likely?
108. Downstream core elements

(DCEs)

CTTC...CTGT...AGC ? Y random or likely?
109. Downstream promoter elements

(DPEs)

(Juven-Gershon)

(A/G)G(A/T)(C/T)(A/C/G)T ? Y random or likely?, Negative strand, negative direction: AGGACC at 4546, AGTCCT at 4437, AGATGT at 4213, AGTTCT at 4179, GGTCCT at 4171, AGTCCT at 4139, GGACAT at 4122, AGATGT at 4063, AGTTCT at 4028, GGTTCT at 4020, GGTTGT at 3980, GGACAT at 3971, ACAACC at 3942, GGACCT at 3907, AGGACC at 3906, ACGACC at 3864, AGACCT at 3836, AGAACC at 3793, GGACCT at 3745, GGTCGT at 3732, AGGTCC at 3585, ATGACT at 3542, ATAACC at 3529, ACGTCT at 3431, GGTTCT at 3274, GGTCCT at 3250, AGTCCT at 3218, GGTTGT at 3138, AGTCCT at 3111, GGTCGT at 3071, GGACAT at 3062, AGATGT at 2989, ATATCT at 2903, GGTTAT at 2849

Positive strand, negative direction: AGACAT at 4508, AGATCC at 4476, AGAACC at 4451, AGTTCT at 4418, AGACGT at 4236, AGATGT at 3621, AGATAT at 3466, AGACAT at 3434, ATGTCT at 3833, AGGACT at 3640, ATGTCT at 2986, AGATAT at 2982, AGACAT at 2949, AGACAT at 2881

110. Downstream promoter elements

(DPEs)

(Kadonaga)

(A/G)G(A/T)CGTG ? Y random or likely?, Negative strand, negative direction: GGTCGTG at 3733, CACGTCT at 3431, GGTCGTG at 3072

Positive strand, negative direction: AGACGTG at 4237

111. Downstream promoter elements

(DPEs)

(Matsumoto)

AGTCTC ? Y random or likely?, Negative strand, negative direction: AGTCTC at 3645

Positive strand, negative direction: GAGACT at 4053

112. DREB boxes TACCGACAT ? N CRT/DREB box
113. E2 boxes (G/A)CAG(A/C/G/T)TG(A/C/G/T) ? Y random or likely?
114. EIF4E basal elements TTACCCCCCCTT ? N poly(C) motif
115. EIN3 binding sites A(C/T)G(A/T)A(C/T)CT ? Y random or likely?
116. Endoplasmic reticulum stress response elements

(ERSE)

CCAAT bZIP N CCAATGGGCTGAAAC between ZNF497 and A1BG, compare CCAAT-box and ERSE below
117. Endoplasmic reticulum stress response elements CCAAT-N9-CCACG, CCACG bZIP Y random or likely?
118. Endosperm expressions TGTGTCA ? Y random or likely?
119. Enhancer boxes CA(A/C/G/T)(A/C/G/T)TG bHLH Y random or likely?
120. Estrogen response elements

(EREs)

AGGTTA or GGTCAGGAT Cys
4		 N AGGTTATTGCCTCCT or GGTCAGGATGAC
121. Ethylene responsive elements ATTTCAAA WD40 repeat family Y likely active or activable
122. F boxes TGATAAG[27] ? N F-box overlaps the I-box
123. Forkhead boxes GTAAACAA[28] HTH, Forkhead N GTAAACAA FOXO1
124. Forkhead boxes (A/G)(C/T)AAA(C/T)A HTH, Forkhead Y likely active or activable
125. GAAC elements GAACT ? Y likely active or activable
126. Gal4ps CGGACCGC ? N CGG(A/G)NN(A/G)C(C/T)N(C/T)NCNCCG[29]
127. γ-interferon activated sequences

(GAS)

TTCCTAGAA ? N ALS-GAS1 between nt −633 and nt −625
128. Γ-interferon activated sequences

(GAS), see STAT5

TTNCNNNAA β-Scaffold factors with minor groove contacts Y random or likely?
129. GATA boxes GATA Zinc finger DNA-binding domains, bHLH Y random or likely?
130. G boxes (G/T)CCACGTG(G/T)C ? N no "perfect palindrome" G boxes in either promoter
131. GC boxes

(Briggs)

(G/T)(G/A)GGCG(G/T)(G/A)(G/A)(C/T) ? Y random or likely?
132. GC boxes

(Ye)

GGGCGG ? Y random or likely?, Negative strand, negative direction: CCGCCC at 4000, CCGCCC at 3091
133. GCC boxes GCCGCC ? Y random or likely?
134. General control nonderepressible 4 protein binding site

(GCRE, GCN4)

TGA(C/G/T)T(A/C/G)(A/T) bZIP Y random or likely?
135. GCN4 motifs TGACTCA, TGAGTCA bZIP N ACGT motif
136. Gcn4ps ATGACTCTT[29] bZIP N GCN4 motifs
137. GGC triplets CCGNNNNCGG ? Y random or likely?, Negative strand, negative direction: CCGAGTACGG at 4118
138. Gibberellic acid responsive elements

(GAREs)

TAACAAA WD40 repeat family Y likely active or activable
139. Gibberellin responsive elements

(GAREs)

(Sharma)

AAACAGA[7] WD40 repeat family Y likely active or activable
140. GARE-like 1

(Fan)

TAACA(A/G)A[30] WD40 repeat family Y likely active or activable
141. Gibberellin responsive element-like 2

(GARE-like 2)

(Fan)

TAACGTA[30] ? N "in the promoters of hydrolase genes".[30]
142. GLM boxes (G/A)TGA(G/C)TCA(T/C) ? N GCN4-like motif
143. G-protein-coupled receptors

(GCR1s), CT boxes

CTTCC ? Y random or likely?
144. Glucocorticoid response elements AGAACA bHLH Y random or likely?
145. Grainy head transcription factor binding sites AACCGGTT β-Scaffold factors with minor groove contacts N also GACTGGTT
146. GT boxes

(Motojima)

TGGGTGGGGCT ? N (-78 to -69)
147. GT boxes

(Sato)

GGGG(T/A)GGGG ? Y random or likely?, Negative strand, Positive direction: GGGGAGGGG at 2291
148. Hac1 KAR2 CAGCGTG ? Y random or likely?, Positive strand, negative direction: CAGCGTG at 740, Negative strand, positive direction: CACGCTG at 778
149. H and ACA boxes AGAGGA ? Y random or likely?
150. Hapless motifs CCAATCA ? N heterotrimeric transcription factor, HAP2/3/4.[31]
151. H-boxes

(Lindsay)

CCTACC ? Y random or likely?
152. H box

(Mitchell)

ANANNA ? Y random or likely?
153. H box

(Rozhdestvensky)

ACACCA ? Y random or likely?
154. Heat-responsive elements AAAAAATTTC Helix-turn-helix (HTH), Heat shock factors (HSFs) N four nGAAn motifs
155. Heat shock elements

(HSEs)

(Eastmond)

nGAAn-(5-bp)-nGAAnnTTCn HTH, HSFs Y random or likely?, Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
156. Heat shock elements

(HSEs)

(Eastmond)

nGA(A/G)n-(5-bp)-nGAAnnTTCn (GAP) HTH, HSFs Y random or likely?, Negative strand, positive direction: GGAATTCACATGAACCTTCA at 332
157. Heat shock elements

(HSEs)

(Eastmond)

nGAAn-(5-bp)-nGA(A/G)nnTTCn (GAP) HTH, HSFs Y random or likely?, Negative strand, negative direction: GGAATTCACATGAACCTTCA at 332
158. Heat shock elements

(HSEs)

(Eastmond)

nGAAn-(5-bp)-nGAAn-(5-bp)-nGAAn HTH, HSFs Y random or likely?, Postive strand, negative direction: AGAAGAAAAAAGAAAAGAGAAGAAA at 2831
159. Heat shock elements

(HSE1)

(Eastmond)

nGAAnnTTCnnGAAn HTH, HSFs N HSE1
160. Heat shock elements

(HSE2)

(Eastmond)

nTTCnnGAAnnTTCn HTH, HSFs N HSE2 is the inverse complement of HSE1
161. Heat shock elements

(HSE5)

(Eastmond)

nTTCn-(5-bp)-nTTCnnGAAn HTH, HSFs N HSE5
162. Heat shock elements

(HSE6)

(Eastmond)

nTTCn-nnGAAn-(5-bp)-nGAAn HTH, HSFs N HSE6
163. Heat shock elements

(HSE7)

(Eastmond)

nGA(A/G)nnTTCnnGAAn HTH, HSFs N HSE7 PFT1
164. Heat shock elements

(HSE)

(Eastmond)

nGAAnnTTCnnGA(A/G)n HTH, HSFs N HSE7 PFT2
165. Heat shock elements

(HSE10)

(Eastmond)

nTTCn-(11-bp)-nGAAn-(5 bp)-nGAAn HTH, HSFs N HSE10
166. Hex sequences TGACGTGGC ? Y random or likely?, Positive strand, positive direction: TGACGTGGC at 4344
167. High Mobility Group boxes

(HMG boxes)

(A/T)(A/T)CAAAG β-Scaffold factors with minor groove contacts Y random or likely?, Positive strand, negative direction: ATCAAAG at 2891
168. HNF6s (A/G/T)(A/T)(A/G)T(C/T)(A/C/G)AT(A/C/G/T)(A/G/T) Cys
4		 Y random or likely?, Positive strand, negative direction: TTATTAATTC at 4542, TTATTAATCG at 4229, TAGTTGATAA at 3527
169. Homeoboxes CAAG HTH Y random or likely?
170. HY boxes TG(A/T)GGG ? Y random or likely?, Negative strand, negative direction: CCCTCA at 4498, CCCTCA at 3889, CCCACA at 3184

Positive strand, negative direction: TGAGGG at 4558, TGTGGG at 3712, TGAGGG at 3652

171. Hypoxia-inducible factors

(HIF-1)

GCCCTACGTGCTGTCTCA[32] bHLH N composed of HIF-1α and HIF-1β
172. Hypoxia-inducible factors ACGTG bHLH Y likely active or activable, Negative strand: ACGTG at 4339, CACGT at 3429, ACGTG at 3288, CACGT at 2863

Positive strand: ACGTG at 4237

173. Hypoxia response elements CACGC WD40 repeat family Y likely active or activable, Negative strand, negative direction: CACGC at 2196, CACGC at 447, CACGC at 379
174. I boxes GATAAG ? N GGATGAGATAAGA
175. Initiator elements

(Inrs)

YYANWYY ? Y likely active or activable, Negative strand, negative direction: TTACTCC at 4557, TCACACT at 4361, TCGGACC at 4349, CCAGTTT at 4309, TCGGACC at 4300, GGTCCGA at 4255, CTGCACC at 4238, TCGGTCT at 4233

Positive strand, negative direction: GGAATGA at 4555, TTAATTC at 4542, TCACATT at 4533, AGTCCAA at 4502, CCACTTT at 4461, CCACTCC at 4425, CCACTCC at 4425, CCAGTTC at 4417, AGTGTGA at 4361, CTGCACT at 4340, CCGGACT at 4327, AAAATAA at 4221

176. Initiator elements

(Inrs)

BBCABW ? Y likely active or activable?, Negative strand, negative direction: TCTGGG at 4366, GTCACA at 4359, CCCACT at 4353, TGTGAC at 4336, GTCACT at 4319, TCCAGT at 4307, TCTGCA at 4236

Positive strand, negative direction: AATGAG at 4556, TTCACA at 4531, CCCACT at 4485, TCCACT at 4459, CCCAGA at 4448, TCCACT at 4423, GCCAGT at 4415, TGCACT at 4340, TGCAGT at 4317, GCCAGA at 4233

177. Initiator-like elements TTCTCT ? Y random or likely?, Negative strand: AGAGAA at 4527, TTCTCT at 3380
178. Inositol/choline-responsive elements

(ICRE)

(Case)

CANNTGAAAT ? N version of Lopes, see below
179. Inositol/choline-responsive elements

(ICRE)

(Case, Lopes)

CATGTGAAAT includes the canonical basic helix-loop-helix (bHLH) binding site CANNTG (Lopes et al. 1991) ? Y random or likely?
180. Inositol/choline-responsive elements

(ICRE)

(Lopes)

ATGTGAAAT ? N using ANNTGAAAT
181. Inositol/choline-responsive elements

(ICREs)

(Schwank)

TYTTCACATGY contains the core sequence CANNTG ? Y random or likely?
182. Interferon regulatory factor

(IRF3)

GCTTTCC ? Y random or likely?
183. Interferon-stimulated response elements

(ISREs)

AGTTTCN2TTTCN ? N consensus sequence AGTTTCN2TTTCN.[33]
184. IFN-stimulated response elements

(ISREs)

(Lu)

GAAANNGAAA ? Y random or likely?, Negative strand, positive direction: GAAATAGAAA at 2629
185. IRS consensus

(Fujii)

AANNGAAA ? Y random or likely?, Positive strand, negative direction: AAAAGAAA at 4394, AAAAGAAA at 4389, AAAAGAAA at 4382, AATAGAAA at 4081
186. Tryptophan residues

(Lu)

GAAA ? Y random or likely?, Negative strand, negative direction: TTTC at 4504, GAAA at 4461
187. Jasmonic acid-responsive elements

(JAREs)

TGACG ? Y random or likely?
188. Kozak sequences GCCGCC(A/G)CCATGG ? N GCCGCC(A/G)CCATGG[34]
189. Kozak sequences

(Matsumoto)

GAAAATGG ? N GAAAATGG[35]
190. Krüppel-like factors GGGNN(G/T)(G/T)(G/T) ? Y random or likely?
191. L boxes AAATTAACCAA ? N AAATTAACCAA[36]
192. Leu3 transcription factors (C/G)C(G/T)NNNN(A/C)G(C/G) ? Y random or likely?, Negative strand, negative direction: GCGAACTCGG at 4297, CCGAGTACGG at 4118, CCGACTCCGC at 3998, CCGTCGTAGG at 3903, CCTGGTCCGG at 3873, CCGACTCCGC at 3089
193. -35 sequence TTGACA ? Y random or likely?, Negative strand: TTGACA at 4399
194. Maf recognition element

(MAREs)

TGCTGA(G/C)TCAGCA ? N and TGCTGA(GC/CG)TCAGCA[37]
195. M boxes GTCATGTGCT ? N or AGTCATGTGCT[38]
196. Mcm1 regulatory factors TT(A/T)CCNN(A/T)TNGG(A/T)AA ? N Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.[3]
197. Mcm1 regulatory factors


(Rossi)

TTNCCNNNTNNGGNAA ? N Primary consensus sequence apparently: TT(A/T)CCNN(A/T)TNGG(A/T)AA.[3]
198. Met31ps AAACTGTG[39] ? Y random or likely?, Positive strand, negative direction: AAACTGTG at 4400
199. Metal responsive elements

(MRE)

TGC(A/G)C(A/C/G/T)C ? Y random or likely?, Positive strand: TGCACTC at 4341, TGCACTC at 3290, GTGTGCA at 2863
200. Middle sporulation element

(MSE)

(Branco)

ACACAAA ? Y random or likely?, Negative strand, negative direction: TTTGTGT at 3513
201. Midsporulation element

(MSE)

(Ozsarac)

C(A/G)CAAA(A/T) ? Y random or likely?, Negative strand, negative direction: TTTTGTG at 3512

Positive strand, negative direction: CACAAAA at 3767

202. Multicopy inhibitor of the GAL1 promoter

(MIG1)

(C/G)(C/T)GGGG bZIP Y random or likely?, Negative strand, negative direction: GTGGGG at 4445, GTGGGG at 3058

Positive strand, negative direction: CCCCAG at 4447, CTGGGG at 3037

203. Motif ten elements C(C/G)A(A/G)C(C/G)(C/G)AACG(C/G) ? N Gene ID: 6309
204. Musashi binding elements

(MBEs)

(G/A)U1–3AGU ? Y random or likely?, Positive strand, positive direction: GTAGT at 4362.
205. Myeloblastosis recognition element

(MRE)

A(A/C)C(A/T)A(A/C)C ? Y random or likely?, Negative strand: GGTAGGT at 4457, ACCAACC at 3946, ACCAACC at 3606, GGTTGTT at 3139
206. Myocyte enhancer factors

(MEFs)

(C/T)TA(A/T)(A/T)(A/T)(A/T)TA(A/G) β-Scaffold factors with minor groove contacts Y random or likely?, Negative strand, negative direction: TTATTATTAA at 4226
207. Nanos/Pumilio response elements

(PREs)

TGTAAAT ? Y random or likely?, Negative strand, negative direction: TGTAAAT at 4535
208. N-boxes

(Lee)

CCGGAA ? Y random or likely?, Negative strand, positive direction: TTCCGG at 4244
209. N-boxes

(Bai)

CACGAG ? Y random or likely?, Positive strand, negative direction: CACGAG at 4472, CACGAG at 3232
210. N-boxes

(Gao)

CACGGC or CACGAC, CACG(A/G)C ? Y random or likely?, Negative strand, negative direction: CACGAC at 3956, GTCGTG at 3733, GTCGTG at 3072
211. N-boxes

(Leal)

CACNAG ? Y random or likely?, Positive strand, negative direction: CACGAG at 4472, CACAAG at 3634, CACTAG at 3493, CACTAG at 3369, CACGAG at 3232
212. Non-DiTyrosine 80 transcription factor DNA binding domain

(Ndt80)

(A/G/T)NC(A/G)CAAA(A/T) ? Y random or likely?, Negative strand, negative direction: TTTTGTGTT at 3514

Positive strand: ACCACAAAA at 3767

213. NF‐κB/Rel family of eukaryotic transcription factors CCCCTAAGGGG β-Scaffold factors with minor groove contacts N NF-κB
214. Nuclear factor 1

(NF-1)

TTGGCNNNNNGCCAA NF I N palindromic sequence
215. Nuclear factor of activated T cells

(NFATs)

GGAAAA β-Scaffold factors with minor groove contacts Y random or likely?, Negative strand, negative direction: TTTTCC at 3441, TTTTCC at 3345

Positive strand, negative direction: GGAAAA at 2968, GGAAAA at 2927

216. Nuclear factor Ys CCAATGG(A/C)(A/G) ? N NF-Y is a trimeric complex
217. Nutrient-sensing response element 1 GTTTCATCA ? Y random or likely?
218. Oaf1 transcription factor CGGN3TNAN9-12CCG ? Y random or likely?
219. ORESARA1

(ORE1)

(Matallana)

(A/C/G)(A/C)GT(A/G)N5,6(C/T)AC(A/G) ? Y random or likely?, Negative strand, negative direction: GCGTAGAAGACACA at 3558, AAGTAGTTTCTACG at 2895
220. ORESARA1

(ORE1)

(Olsen)

T(A/G/T)(A/G)CGT(A/G)(A/C/T)(A/G/T) ? Y random or likely?, Negative strand, negative direction: TGACGTGAG at 4341, TAACGTGAG at 3290

Positive strand, negative direction: ATCACGCCA at 3282

221. p53 response elements (A/G)(A/G)(A/G)C(A/T)(A/T)G(C/T)(C/T)(C/T) β-Scaffold factors with minor groove contacts Y random or likely?, Positive strand, negative direction: AGACAAGCTT at 4186
222. p53 response elements

(Long1)

CAGGCCC β-Scaffold factors with minor groove contacts Y random or likely?, Positive strand, positive direction: GGGCCTG at 745
223. p53 response elements

(Long2)

GGGCGTG β-Scaffold factors with minor groove contacts Y random or likely?, Positive strand, negative direction: GGGCGTG at 3046
224. p63 DNA binding sites (A/G)(A/G)(A/G)C(A/G)(A/T)G(C/T)(C/T)(C/T)(A/G)(A/G)(A/G)C(A/T)(C/T)G(C/T)(C/T)(C/T) β-Scaffold factors with minor groove contacts N RRRC(A/G)(A/T)GYYYRRRC(A/T)(C/T)GYYY
225. P-box (Mena) (A/T)AAAG ? Y random or likely?, Negative strand, negative direction: CTTTT at 4395, CTTTT at 4390, CTTTT at 4383, TAAAG at 3688, TAAAG at 2884

Positive strand, negative direction: AAAAG at 4391, AAAAG at 4386, AAAAG at 4379, AAAAG at 3440, AAAAG at 3344, CTTTT at 3019, TAAAG at 2857

226. P-box

(Motojima)

TGAGTTCA ? Y random or likely?
227. P-box

(Yu)

GTAA(T/C) ? Y random or likely?, Negative strand, negative direction: ATTAC at 3658, GTAAT at 3436, GTAAC at 3285, GTAAT at 2951

Positive strand, negative direction: GTAAT at 3973, ATTAC at 3469, GTAAT at 3064

228. Pdr1p/Pdr3ps TCCGCGGA ? N Pdr1p/Pdr3p response elements (PDREs)
229. Peroxisome proliferator-activated receptor alpha CGACCCC ? Y random or likely?, Negative strand, negative direction: CGACCCC at 3037
230. Peroxisome proliferator hormone response elements

(PPREs)

AGGTCANAGGTCA ? N PPARs/RXRs heterodimers bind to PPRE
231. Pho4ps CAC(A/G)T(T/G) bHLH Y random or likely?, Negative strand, negative direction: TTACAC at 4091, AACGTG at 3288, CACGTT at 2864

Positive strand, negative direction: CACATT at 4533

232. Pollen1 elements AGAAA ? Y random or likely?, Negative strand, negative direction: TTTCT at 4505, TTTCT at 4392, TTTCT at 4387, TTTCT at 4380, TTTCT at 4083, TTTCT at 3924, TTTCT at 3665, TTTCT at 3378, TTTCT at 2892

Positive strand, negative direction: AGAAA at 4394, AGAAA at 4389, AGAAA at 4382, AGAAA at 4085, AGAAA at 4081, AGAAA at 3591, AGAAA at 3376, AGAAA at 3342

233. Pollen1 with TCCACCATA AGAAANNNNTCCACCATA ? N adjacent co-dependent regulatory element TCCACCATA
234. Polycomb response elements CGCCAT(A/T)TT ? N CGCCATTT
235. Polycomb response elements

(PRE)

GCCAT ? Y random or likely?, Positive strand, negative direction: GCCAT at 3685, ATGGC at 3629, GCCAT at 3283, ATGGC at 3005, ATGGC at 2907
236. Pribnow boxes TATAAT ? Y random or likely?, Negative strand, negative direction: TATAAT at 3468, TATAAT at 3454
237. Prolamin boxes TG(A/T)AAAG ? Y random or likely?, Negative strand, negative direction: TGTAAAG at 2884
238. Pyrimidine boxes CCTTTT WD40 repeat family Y random or likely?, Negative strand, negative direction: CCTTTT at 2968, CCTTTT at 2927

Positive strand, negative direction: AAAAGG at 3441, AAAAGG at 3345

239. Q elements

See Retinoic acid response element

AGGTCA ? Y random or likely?, Positive strand, negative direction: AGGTCA at 4307
240. Quinone reductase response element

(QRDRE)

(Yao)

TCCCCT of TCCCCTTGCGTG ? Y random
241. Rap1 regulatory factors ACCC(A/G)N(A/G)CA ? N "(ACCCRnRCA), less than half of the sites were detectably bound"[3]
242. Rap1 reduced consensus (A/G)(A/C)ACCC(A/G)N(A/G)C(A/C)(C/T)(A/C) WD40 repeat family Y random or likely?, Positive strand, positive direction: GAACCCACACCTC at 1807
243. Reb1 bound and exact occurrences TTACCC(G/T) WD40 repeat family Y random or likely?, Negative strand, negative direction: TTACCCT at 3661
244. Extended Reb1 ATTACCCGAA ? N "extended motif VTTACCCGNH (IUPAC nomenclature) (Rhee and Pugh 2011)."[3]
245. Retinoic acid response element AG(A/G)TCA ? Y random or likely?, Negative strand, negative direction: TGATCT at 3463
246. Glucose transporter gene repressor

(Rgt1)

CGG(A/G)(A/T)N(A/T)(A/T) ? Y random or likely?, Negative strand, negative direction: ATTTTCCG at 3442
247. Rlm1ps CTATATATAG ? N CTA(T/A)4TAG
248. classic RORE motif

(RORE)

A(A/T)NTAGGTCA ? Y random or likely?
249. variant RORE motif C(T/A)(G/A)GGNCA ? Y random or likely?, Negative strand, negative direction: CTGGGACA at 4369, CTGGGACA at 4208
250. Rox1ps RRRTAACAAGAG ? N Heme-dependent repressor of hypoxic genes.[29]
251. Rpn4ps GGTGGCAAA ? N proteasome genes
252. R response elements

(RRE)

CATCTG ? Y random or likely?, Negative strand, negative direction: CAGATG at 4212, CAGATG at 2988

Positive strand, negative direction: CAGATG at 3919, CAGATG at 3627, CAGATG at 3620

253. Seed-specific elements CATGCATG ? N SRE consensus: CAGCAGATTGCG is none
254. Serum response elements

(SRE)

see CArG boxes

ACAGGATGT bHLH-ZIP Y random or likely?, Negative strand, positive direction: ACAGGATGT at 3575
255. Servenius sequences GGACCCT ? Y random or likely?, Negative strand, negative direction: GGACCCT at 4548, GGACCCT at 4496, GGACCCT at 4302
256. Shoot specific elements GATAATGATG ? N SRE consensus: CAGCAGATTGCG is none
257. Sip4ps CC(C/G)T(C/T)C(C/G)TCCG ? N CC(C/G)T(C/T)C(C/G)TCCG[29]
258. Smp1ps ACTACTA(A/T)(A/T)(A/T)(A/T)TAG ? N ACTACTA(T/A)4TAG[29]
259. SP1

(Zhang)

(G/T)GGGCGG(G/A)(G/A)(C/T) ? Y see GC boxes above, random or likely?
260. SP1-box 1

(Motojima)

GGGGCT ? Y random or likely?, Positive strand, negative direction: GGGGCT at 3039
261. SP1-box 2

(Motojima)

CTGCCC ? Y random or likely?, Positive strand, negative direction: CTGCCC at 3853
262. SP-1

(Sato)

CCGCCCC ? Y random or likely?, Negative strand, positive direction: GGGGCGG at 4439, GGGGCGG at 4429
263. SP1

(Long)

GGGGCGGGCC ? N GGGGCGGGCC[16]
264. SP1

(Yao)

GCGGC ? Y random or likely?, Negative strand, negative direction: GCCGC at 2726

Positive strand, negative direction: GCGGC at 2725

265. STAT5 TTCNNNGAA β-Scaffold factors with minor groove contacts Y random or likely?, Positive strand, negative direction: TTCCCTGAA at 3782, TTCGTTGAA at 3506
266. Sterol response elements

(Branco)

TCGTATA ? N perhaps plant specific
267. Sterol response elements

(Yao)

AGCAGATTGCG ? N liver specific
268. Stress-response elements

(STREs)

CCCCT ? Y random or likely?, Negative strand, negative direction: CCCCT at 2924

Positive strand, negative direction: CCCCT at 3059

269. Sucrose boxes NNAATCA ? Y random or likely?, Negative strand, negative direction: TGATTCC at 3474, TGATTTT at 3163, TGATTCG at 3032, TGATTCG at 2915
270. TACTAAC boxes TACTAA(C/T) ? Y random or likely?, Positive strand, positive direction: TACTAAT at 4157, ATTAGTA at 4148
271. TAGteams CAGGTAG ? Y random or likely?, Negative strand, positive direction: CAGGTAG at 4035, CTACCTG at 1198
272. Tapetum boxes TCGTGT ? Y random or likely?, Negative strand, negative direction: ACACGA at 4402, TCGTGT at 3915
273. TATA boxes TATA(A/T)A(A/T)(A/G) β-Scaffold factors with minor groove contacts Y random or likely?, Negative strand, negative direction: TTTATATA at 2871

Positive strand, negative direction: TATATAAA at 2874

274. TAT Boxes

(Yang)

TATAAAA WD40 repeat family Y random or likely?, Negative strand, negative direction: TATAAAA at 2853
275. TAT Boxes

{Fan)

TATCCAT WD40 repeat family Y random or likely?, Negative strand, negative direction: ATGGATA at 2996
276. TATCCAC boxes TATCCAC ? N GA responsive complex component
277. Tbf1 regulatory factors A(A/G)CCCTAA General Regulatory Factors Y Saccharomyces cerevisiae, random or likely?
278. T boxes

(Conlon)

TCACACCT bZIP Y random or likely?, positive strand: TCACACCT at 3968, TCACACCT at 1129
279. T boxes

(Zhang)

AACGTT bZIP Y random or likely?, positive strand: AACGTT at 2691, AACGTT at 1614
280. TCCACCATA elements TCCACCATA ? N adjacent co-dependent regulatory element of POLLEN1
281. TEA consensus sequences CATTCY ? Y random or likely?, Positive strand, negative direction: GGAATG at 4554, AGAATG at 3003
282. Tec1ps GAATGT ? Y random or likely?, Ste12p cofactor
283. Telomeric repeat DNA-binding factors

(TRFs)

TTAGGG ? Y random or likely?, Negative strand, negative direction: TTAGGG at 3976, TTAGGG at 3067
284. Tetradecanoylphorbol-13-acetate response elements

(TREs)

TGA(G/C)TCA ? N cis-regulatory element of the human metallothionein IIa (hMTIIa) promoter and SV40
285. TGF-β control elements

(TCEs)

GAGTGGGGCG ? N in mouse and rat, GCGTGGGGGA in humans
286. TGF-β inhibitory elements

(TIEs)

GAGTGGTGA ? N in the rat transin/stromelysin promoter
287. Thyroid hormone response elements

(TREs)(THRs)

AGGTCA ? Y random or likely?, See VDREs, X boxes, Positive strand, negative direction: AGGTCA at 4307
288. Transcription factor 3

(TCF3)

GTCTGGT ? Y random or likely?, Negative strand, negative direction: GTCTGGT at 2122
289. Translational control sequences

(TCSs)

AUUAUCU (Wee1 TCS1), AUUGUCU (Wee1 TCS2) and UUUGUCU (Mos and PCM-1 TCS) ? Y random or likely?, Negative strand, negative direction: TTTGTCT at 4518, ATTATCT at 4079, TTTGTCT at 2878.
290. Unfolded protein response element

(URE) (UPRE-1)

CANCNTG ? Y random or likely?, Positive strand, negative direction: CAGCCTG at 4348, CATGGTG at 4109, CAGCCTG at 4036, CATCCTG at 3905, CACCCTG at 3743, CAGCCTG at 3297, CAAGGTG at 3143, CAGCCTG at 3127
291. Unfolded protein response elements

(UPREs)

TGACGTG(G/A) bZIP Y random or likely?, XBP1 binds to UPRE, Negative strand, negative direction: TGACGTGA at 4340
292. Upstream stimulating factors

(USFs)

GCC(A/T)NN(C/G/T)(A/G) bHLH-ZIP Y random or likely?, Negative strand, negative direction: CGGTCCAC at 3953

Positive strand, negative direction: CAGATGGC at 3629

293. UUA rich elements

(Siegel)

TTATTTA(A/T)(A/T) ? Y random or likely?, Negative strand, negative direction: TTATTTATT at 4075
294. V boxes (A/G)TT(A/T)(C/T) ? Y random or likely?, Negative strand, negative direction: ATAAT at 4538, AAAAT at 4512, GTTTC at 4504, GAAAC at 4462, GTTTT at 4376, GTTTT at 4310, ATTAT at 4223, GTTTT at 4216

Positive strand, negative direction: ATTTT at 4511, AAAAC at 4396, AAAAC at 4311, ATAAT at 4225, ATAAT at 4222, AAAAT at 4219

295. Vhr1ps

(VHR1)

AATCA-N8-TGA(C/T)T ? N Response to low biotin concentrations
296. Vitamin D response elements

(VDREs)

(A/G)G(G/T)(G/T)CA ? Y random or likely?, Negative strand, negative direction: TGAACC at 4268, TGAACT at 4012, TGACCC at 3750, TGAACT at 3242, TGAACT at 3103, TGAACC at 2921
297. Vitamin D response elements

(VDREs)

A/GGG/TTCAnnnA/GGG/TTCA ? N (A/G)G(G/T)TCANNN(A/G)G(G/T)TCA
298. W boxes (C/T)TGAC(C/T) WRKY Y random or likely?, Negative strand, negative direction: GGTCAA at 4416, GGTCAA at 4308, CTGACC at 3749
299. X boxes GTTGGCATGGCAAC[4] ? N X2 box is AGGTCCA not ⌘F
300. X-boxes GT(A/C/T)N(C/T)(C/T)AT(A/G)(A/G)NAAC[40] ? N includes GTTNCCATGGNAAC
301. Xbp1ps GcCTCGA(G/A)G(C/A)g(a/g) ? N Transcriptional repressor
302. X core promoter elements (A/G/T)(C/G)G(C/T)GG(A/G)A(C/G)(A/C) ? Y random or likely?, Negative strand, negative direction: TGGTGGGACC at 3744
303. Xenobiotic response elements

(XREs)

GCGTG bHLH Y likely active or activable, Positive strand, negative direction: CACGC at 3280, GCGTG at 3046
304. Xenobiotic response elements

(XREs)

(T/G)NGCGTG(A/C)(G/C)A ? N contains the core sequence GCGTG, see AHRE above
305. Yap recognition sequences TTACTAA ? Y random or likely?, Yap1, Yap2, Yap3, and Yap5
306. Y boxes (A/G)CTAACC(A/G)(A/G)(C/T) ? N inverted CAAT box
307. YY1 binding sites CCATCTT Cys
2His
2		 Y random or likely?, Negative strand, negative direction: CCATCTT at 1654
308. Zap1ps ACCCTCA ? N ACC(C/T)(C/T)(A/C/G/T)AAGGT
309. Z boxes A(C/T)A(C/G)GT(A/G)T ? Y random or likely?, Positive strand, negative direction: ACACCTGT at 3970, ATACCTAT at 2996
310. Zinc responsive elements

(ZREs)

MHHAACCBYNMRGGT ? N (A/C)(A/C/T)(A/C/T)AACC(C/G/T)(C/T)N(A/C)(A/G)GGT

Of 310 response elements, there are 105 Ns for not present in either A1BG promoter and 205 Ys or transcription factors that occur in the promoters of A1BG. There are one or two apparent random (ACGT-containing and Quinone reductase) elements, 148 random or likely? to be evaluated and 56 likely active or activable. With 4560 nts considered, halfway would be at 2280. Less than 2280 suggests the nearest other gene. In the positive direction, 4445 nts considered, halfway would be 2222 for another gene.

Acknowledgements

The content on this page was first contributed by: Henry A. Hoff.

See also

References

  1. ↑ MeSH (8 July 2008). "Response Elements". U.S. National Library of Medicine, 8600 Rockville Pike, Bethesda, MD 20894: National Institutes of Health, Health & Human Services. Retrieved 2 September 2020.
  2. ↑ 2.0 2.1 2.2 Kenneth A. Watanabe; Arielle Homayouni; Lingkun Gu; Kuan‐Ying Huang; Tuan‐Hua David Ho; Qingxi J. Shen (18 June 2017). "Transcriptomic analysis of rice aleurone cells identified a novel abscisic acid response element". Plant, Cell & Environment. 40 (9): 2004–2016. doi:10.1111/pce.13006. Retrieved 5 October 2020.
  3. ↑ 3.0 3.1 3.2 3.3 3.4 Matthew J. Rossi; William K.M. Lai; B. Franklin Pugh (21 March 2018). "Genome-wide determinants of sequence-specific DNA binding of general regulatory factors". Genome Research. 28: 497–508. doi:10.1101/gr.229518.117. PMID 29563167. Retrieved 31 August 2020.
  4. ↑ 4.0 4.1 Z G E, Zhang YP, Zhou JH, Wang L (16 April 2014). "Mini review roles of the bZIP gene family in rice". Genetics and Molecular Research. 13 (2): 3025–36. doi:10.4238/2014.April.16.11. PMID 24782137.
  5. ↑ Takayuki Murata; Chieko Noda; Yohei Narita1; Takahiro Watanabe; Masahiro Yoshida; Keiji Ashio; Yoshitaka Sato; Fumi Goshima; Teru Kanda; Hironori Yoshiyama; Tatsuya Tsurumi; Hiroshi Kimura (27 January 2016). "Induction of Epstein-Barr Virus Oncoprotein Latent Membrane Protein 1 (LMP1) by Transcription Factors Activating Protein 2 (AP-2) and Early B Cell Factor (EBF)" (PDF). Journal of Virology. doi:10.1128/JVI.03227-15. Retrieved 4 October 2020.
  6. ↑ RefSeq (July 2014). "FOSL2 FOS like 2, AP-1 transcription factor subunit [ Homo sapiens (human) ]". 8600 Rockville Pike, Bethesda MD, 20894 USA: National Center for Biotechnology Information, U.S. National Library of Medicine. Retrieved 14 September 2021.
  7. ↑ 7.0 7.1 7.2 7.3 Bhaskar Sharma; Joemar Taganna (12 June 2020). "Genome-wide analysis of the U-box E3 ubiquitin ligase enzyme gene family in tomato". Scientific Reports. 10 (9581). doi:10.1038/s41598-020-66553-1. PMID 32533036 Check |pmid= value (help). Retrieved 27 August 2020.
  8. ↑ 8.0 8.1 Ryuto Maruyama; Makoto Shimizu; Juan Li, Jun Inoue; Ryuichiro Sato (24 March 2016). "Fibroblast growth factor 21 induction by activating transcription factor 4 is regulated through three amino acid response elements in its promoter region". Bioscience, Biotechnology, and Biochemistry. 80 (5): 929–934. doi:10.1080/09168451.2015.1135045. Retrieved 4 October 2020.
  9. ↑ Angelika Bröer; Gregory Gauthier-Coles; Farid Rahimi; Michelle van Geldermalsen; Dieter Dorsch􏰀; Ansgar Wegener; Jeff Holst; Stefan Bröer (March 15, 2019). "Ablation of the ASCT2 (SLC1A5) gene encoding a neutral amino acid transporter reveals transporter plasticity and redundancy in cancer cells" (PDF). Journal of Biological Chemistry. 294 (11): 4012–4026. doi:10.1074/jbc.RA118.006378. Retrieved 4 October 2020.
  10. ↑ Alisa A. Garaeva; Irina E. Kovaleva; Peter M. Chumakov; Alexandra G. Evstafieva (15 January 2016). "Mitochondrial dysfunction induces SESN2 gene expression through Activating Transcription Factor 4". Cell Cycle. 15 (1): 64–71. doi:10.1080/15384101.2015.1120929. PMID 26771712. Retrieved 5 September 2020.
  11. ↑ S Kouhpayeh; AR Einizadeh; Z Hejazi; M Boshtam; L Shariati; M Mirian; L Darzi; M Sojoudi; H Khanahmad; A Rezaei (1 July 2016). "Antiproliferative effect of a synthetic aptamer mimicking androgen response elements in the LNCaP cell line" (PDF). Cancer Gene Therapy. 23: 254–257. doi:10.1038/cgt.2016.26. Retrieved 3 October 2020.
  12. ↑ 12.0 12.1 Stephen Wilson; Jianfei Qi; Fabian V. Filipp (14 September 2016). "Refinement of the androgen response element based on ChIP-Seq in androgen-insensitive and androgen-responsive prostate cancer cell lines". Scientific Reports. 6: 32611. doi:10.1038/srep32611. Retrieved 3 October 2020.
  13. ↑ Akihito Otsuki; Mikiko Suzuki; Fumiki Katsuoka; Kouhei Tsuchida; Hiromi Suda; Masanobu Morita; Ritsuko Shimizu; Masayuki Yamamoto (February 2016). "Unique cistrome defined as CsMBE is strictly required for Nrf2-sMaf heterodimer function in cytoprotection". Free Radical Biology and Medicine. 91: 45–57. doi:10.1016/j.freeradbiomed.2015.12.005. PMID 26677805. Retrieved 21 August 2020.
  14. ↑ Sarah E. Lacher; Daniel C. Levings; Samuel Freeman; Matthew Slattery (October 2018). "Identification of a functional antioxidant response element at the HIF1A locus". Redox Biology. 19: 401–411. doi:10.1016/j.redox.2018.08.014. Retrieved 6 October 2020.
  15. ↑ Xu Tao; Anne E. West; Wen G. Chen; Gabriel Corfas; Michael E. Greenberg (2002). "A calcium-responsive transcription factor, CaRF, that regulates neuronal activity-dependent expression of BDNF". Neuron. 33: 383–95. doi:10.1016/S0896-6273(01)00561-X. PMID 11832226. Retrieved 2 September 2020.
  16. ↑ 16.0 16.1 Jianyin Long; Daniel L. Galvan; Koki Mise; Yashpal S. Kanwar; Li Li; Naravat Poungavrin; Paul A. Overbeek; Benny H. Chang; Farhad R. Danesh (28 May 2020). "Role for carbohydrate response element-binding protein (ChREBP) in high glucose-mediated repression of long noncoding RNA Tug1" (PDF). Journal of Biological Chemistry. 5 (28). doi:10.1074/jbc.RA120.013228. Retrieved 6 October 2020.
  17. ↑ 17.0 17.1 PA Johnson; D Bunick; NB Hecht (1991). "Protein Binding Regions in the Mouse and Rat Protamine-2 Genes" (PDF). Biology of Reproduction. 44 (1): 127–134. doi:10.1095/biolreprod44.1.127. PMID 2015343. Retrieved 6 April 2019.
  18. ↑ 18.0 18.1 Young Hun Song; Cheol Min Yoo; An Pio Hong; Seong Hee Kim; Hee Jeong Jeong; Su Young Shin; Hye Jin Kim; Dae-Jin Yun; Chae Oh Lim; Jeong Dong Bahk; Sang Yeol Lee; Ron T. Nagao; Joe L. Key; Jong Chan Hong (April 2008). "DNA-Binding Study Identifies C-Box and Hybrid C/G-Box or C/A-Box Motifs as High-Affinity Binding Sites for STF1 and LONG HYPOCOTYL5 Proteins" (PDF). Plant Physiology. 146 (4): 1862–1877. doi:10.1104/pp.107.113217. PMID 18287490. Retrieved 26 March 2019.
  19. ↑ Hideharu Hashimoto; Dongxue Wang; John R. Horton; Xing Zhang; Victor G. Corces; Xiaodong Cheng (1 June 2017). "Structural Basis for the Versatile and Methylation-Dependent Binding of CTCF to DNA". Molecular Cell. 66 (5): 711–720.e3. doi:10.1016/j.molcel.2017.05.004. PMID 28529057. Retrieved 28 August 2020.
  20. ↑ Ravi P. Misra; Azad Bonni; Cindy K. Miranti; Victor M. Rivera; Morgan Sheng; Michael E.Greenberg (14 October 1994). "L-type Voltage-sensitive Calcium Channel Activation Stimulates Gene Expression by a Serum Response Factor-dependent Pathway" (PDF). The Journal of Biological Chemistry. 269 (41): 25483–25493. PMID 7929249. Retrieved 7 December 2019.
  21. ↑ Yao EF; Denison MS (June 1992). "DNA sequence determinants for binding of transformed Ah receptor to a dioxin-responsive enhancer". Biochemistry. 31 (21): 5060–7. doi:10.1021/bi00136a019. PMID 1318077.
  22. ↑ Yan-Hui Li; Gai-Gai Zhang (12 April 2016). "Towards understanding the lifespan extension by reduced insulin signaling: bioinformatics analysis of DAF-16/FOXO direct targets in Caenorhabditis elegans". Oncotarget. 7 (15): 19185–19192. doi:10.18632/oncotarget.8313. PMID 2702736. Retrieved 27 August 2020.
  23. ↑ 23.0 23.1 Philipp Mracek; Cristina Santoriello; M. Laura Idda; Cristina Pagano; Zohar Ben-Moshe; Yoav Gothilf; Daniela Vallone; Nicholas S. Foulkes (December 6, 2012). "Regulation of per and cry Genes Reveals a Central Role for the D-Box Enhancer in Light-Dependent Gene Expression". PLoS ONE. 7 (12): e51278. doi:10.1371/journal.pone.0051278. Retrieved 10 February 2019.
  24. ↑ Joshua J. Smith, Eric S. Cole, Daniel P. Romero (15 July 2004). "Transcriptional control of RAD51 expression in the ciliate Tetrahymena thermophila". Nucleic Acids Research. 32 (14): 4313–4321. doi:10.1093/nar/gkh771. PMID 15304567. Retrieved 4 September 2020.
  25. ↑ Roberta A. Sumrada and Terrance G. Cooper (June 1987). "Ubiquitous upstream repression sequences control activation of the inducible arginase gene in yeast" (PDF). Proceedings of the National Academy of Sciences USA. 84: 3997–4001. doi:10.1073/pnas.84.12.3997. PMID 3295874. Retrieved 6 September 2020.
  26. ↑ Fumiko Hirose; Masamitsu Yamaguchi; Akio Matsukage (September 1999). "Targeted Expression of the DNA Binding Domain of DRE-Binding Factor, a Drosophila Transcription Factor, Attenuates DNA Replication of the Salivary Gland and Eye Imaginal Disc". Molecular and Cellular Biology. 19 (9): 6020–6028. doi:10.1128/MCB.19.9.6020. PMID 10454549. Retrieved 4 September 2020.
  27. ↑ Annkatrin Rose, Iris Meier and Udo Wienand (28 October 1999). "The tomato I-box binding factor LeMYBI is a member of a novel class of Myb-like proteins". The Plant Journal. 20 (6): 641–652. doi:10.1046/j.1365-313X.1999.00638.x. Retrieved 8 November 2018.
  28. ↑ Eiji Yoshihara (18 August 2020). "TXNIP/TBP-2: A Master Regulator for Glucose Homeostasis". Antioxidants. 9 (8): 765–84. doi:10.3390/antiox9080765. PMID 32824669 Check |pmid= value (help). Retrieved 5 September 2020.
  29. ↑ 29.0 29.1 29.2 29.3 29.4 Hongting Tang, Yanling Wu, Jiliang Deng, Nanzhu Chen, Zhaohui Zheng, Yongjun Wei, Xiaozhou Luo, and Jay D. Keasling (6 August 2020). "Promoter Architecture and Promoter Engineering in Saccharomyces cerevisiae". Metabolites. 10 (8): 320–39. doi:10.3390/metabo10080320. PMID 32781665 Check |pmid= value (help). Retrieved 18 September 2020.
  30. ↑ 30.0 30.1 30.2 Liu-Min Fan, Xiaoyan Feng, Yu Wang and Xing Wang Deng (2007). "Gibberellin Signal Transduction in Rice". Journal of Integrative Plant Biology. 49 (6): 731−741. doi:10.1111/j.1744-7909.2007.00511.x. Retrieved 16 October 2018.
  31. ↑ Nesrin Ozsarac, Melissa J. Straffon, Hazel E. Dalton, and Ian W. Dawes (March 1997). "Regulation of Gene Expression during Meiosis in Saccharomyces cerevisiae: SPR3 Is Controlled by both ABFI and a New Sporulation Control Element". Molecular and Cellular Biology. 17 (3): 1152–9. doi:10.1128/MCB.17.3.1152. PMC 231840. PMID 9032242.
  32. ↑ Qingliang Li, Rezaul M. Karim, Mo Cheng, Mousumi Das, Lihong Chen, Chen Zhang, Harshani R. Lawrence, Gary W. Daughdrill, Ernst Schonbrunn, Haitao Ji and Jiandong Chen (July 2020). "Inhibition of p53 DNA binding by a small molecule protects mice from radiation toxicity". Oncogene. 39 (29): 5187–5200. doi:10.1038/s41388-020-1344-y. PMID 32555331 Check |pmid= value (help). Retrieved 29 August 2020.
  33. ↑ Agata Michalska, Katarzyna Blaszczyk, Joanna Wesoly and Hans A. R. Bluyssen (28 May 2018). "A Positive Feedback Amplifier Circuit That Regulates Interferon (IFN)-Stimulated Gene Expression and Controls Type I and Type II IFN Responses". Frontiers in Immunology. 9: 1135. doi:10.3389/fimmu.2018.01135. Retrieved 18 March 2021.
  34. ↑ Marilyn Kozak (October 1987). "An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs". Nucleic Acids Research. 15 (20): 8125–8148. doi:10.1093/nar/15.20.8125. PMID 3313277.
  35. ↑ Takuya Matsumoto; Saemi Kitajima; Chisato Yamamoto; Mitsuru Aoyagi; Yoshiharu Mitoma; Hiroyuki Harada; Yuji Nagashima (9 August 2020). "Cloning and tissue distribution of the ATP-binding cassette subfamily G member 2 gene in the marine pufferfish Takifugu rubripes" (PDF). Fisheries Science. 86: 873–887. doi:10.1007/s12562-020-01451-z. Retrieved 27 September 2020.
  36. ↑ Robert G. K. Donald and Anthony R. Cashmore (1990). "Mutation of either G box or I box sequences profoundly affects expression from the Arabidopsis rbcS‐1A promoter". The EMBO Journal. 9 (6): 1717–1726. doi:10.1002/j.1460-2075.1990.tb08295.x. Retrieved 8 November 2018.
  37. ↑ Motoki Kyo, Tae Yamamoto, Hozumi Motohashi, Terue Kamiya, Toshihiro Kuroita, Toshiyuki Tanaka, James Douglas Engel, Bunsei Kawakami, Masayuki Yamamoto (13 February 2004). "Evaluation of MafG interaction with Maf recognition element arrays by surface plasmon resonance imaging technique". Genes to Cells. 9 (2). doi:10.1111/j.1356-9597.2004.00711.x. Retrieved 8 September 2020.
  38. ↑ Corine Bertolotto, Roser Buscà, Patricia Abbe, Karine Bille, Edith Aberdam, Jean-Paul Ortonne, and Robert Ballotti (February 1998). "Different cis-Acting Elements Are Involved in the Regulation of TRP1 and TRP2 Promoter Activities by Cyclic AMP: Pivotal Role of M Boxes (GTCATGTGCT) and of Microphthalmia". Molecular and Cellular Biology. 18 (2): 694–702. PMID 9447965. Retrieved 8 December 2018.
  39. ↑ Pierre‐Louis Blaiseau and Dominique Thomas (2 November 1998). "Multiple transcriptional activation complexes tether the yeast activator Met4 to DNA". The EMBO Journal. 17: 6327–6336. doi:10.1093/emboj/17.21.6327. Retrieved 4 February 2021.
  40. ↑ Eduardo Moreno, Maša Lenuzzi, Christian Rödelsperger, Neel Prabh, Hanh Witte, Waltraud Roeseler, Metta Riebesell, Ralf J. Sommer (November 2018). "DAF‐19/RFX controls ciliogenesis and influences oxygen‐induced social behaviors in Pristionchus pacificus". Evolution & Development. 20 (6): 233–243. doi:10.1111/ede.12271. Retrieved 9 March 2021.

External links

{{Phosphate biochemistry}}


Retrieved from "https://www.wikidoc.org/index.php?title=A1BG_response_element_gene_transcriptions&oldid=1718716"